Type stringclasses 4 values | ConceptID stringlengths 1 31 | mention_counts stringlengths 7 7.84M | mention stringlengths 1 99 ⌀ |
|---|---|---|---|
Disease | MESH:C535694 | {'MH': 11927, 'MHS': 564, '-MH': 53, 'MHN': 3, 'MH disease': 3, 'MH-L': 19, 'MH MOD-A': 1, 'MH Lymphoma': 7, 'MH Antineoplastic': 1, 'MH-': 42, 'OxCAP-MH': 2, 'MH:5': 1, 'MH disorders': 30, 'MH -': 2, 'MH - 5': 1, 'MH II': 4, 'MH/': 12, 'MH conditions': 12, 'MH) condition': 1, 'MH-L.': 3, 'MH Crisis': 1, 'MH complications': 2, 'MH\\Primary': 1, 'MH-S': 64, 'MH Reading Disorders': 1, 'MH dyslexia': 1, 'MH-Co': 1, 'Nourbala MH': 1, 'E-MH': 4, 'MH problems': 36, 'C-MH': 16, 'MH tumor': 2, 'MH tumors': 2, 'MH-dG': 1, 'MH lesions': 1, 'NANBH[MH': 1, 'mental health (MH) problems': 1, 'MH.47.5': 1, 'MH illness': 3, 'Weil MH': 1, 'MH.Where': 1, 'Migraine Disorders[MH': 1, 'Rheumatoid[MH': 1, 'osteoporosis[MH': 1, 'Hypertension[MH': 1, 'HIV infections[MH': 1, 'Embolism and Thrombosis[MH': 1, 'MH-MA': 1, 'SC-MH': 3, 'MH_DP': 1, 'mental health (MH': 5, 'N-MH': 2, 'MH-T': 4, 'Bacteremia[MH': 1, 'MH & HC': 1, 'OPC MH': 1, 'MH-5': 2, 'Nabi MH': 1, '(MH)-NENs secondary': 1, 'MH-NENs secondary': 1, 'MH)-NENs': 1, 'MH syndrome': 6, 'MH D': 2, 'MH disordersa': 1, 'MH disorder': 18, 'MH-R': 9, 'MH"Education': 1, 'MH"Learning': 1, 'MH"Autobiographies': 1, 'MH"Thinking': 1, 'MH-EBI': 1, 'developmental delay MH': 1, 'CCHS-MH': 6, 'SMART-MH': 2, 'MH-LMG': 1, 'Mosarof MH': 1, 'S-MH': 9, 'MHS.2018.116': 1, 'A-MH': 11, 'GHS-MHS': 5, 'MH_NS': 1, 'HI-MH': 1, 'brain MH': 1, 'IMH': 2, 'LSCAT-MH': 1, 'MH-COVID': 1, 'MESH- MH': 1, 'Manhole MH-17': 1, 'MH-15': 1, 'Manhole MH-18': 1, 'MH-18': 1, 'MH-17': 1, 'MH-M': 4, 'MH SW': 1, 'Brooke MH': 1, 'SAP-MH': 1, 'Depressive Disorder[MH': 1, 'MH&WB': 1, 'MH-N': 7, 'MH QUANTITATIVE STUDIES': 10, 'MH-G': 2, 'Rathore MH': 1, 'MHN muscle': 1, 'MH 15': 1, 'MH susceptible': 1, 'LMH': 1, 'MH Comorbidity': 1, 'ACSS-MH': 1, 'MH-HCC': 8, 'MH LOC': 2, 'MH MO': 1, 'MHS-12': 1, 'MH_M_NM_4': 1, 'MH_M': 1, 'MH_T': 1, 'MH_W_NM_5': 1, 'MH_T_NM_1': 1, 'K-MH': 3, 'MH symptoms': 13, 'L-MH': 5, 'MH and OH': 1, '(MH)': 1, 'MH and OH problems': 1, 'X-MH': 2, 'H-MH': 6, 'Motamedi MH': 1, 'CCHS - MH': 2, 'MH%': 1, 'MH condition': 17, 'MH&Y': 2, 'MH Leukemia': 9, 'Chronic MH': 1, 'MH_ANTWERPEN': 1, 'MH_WATERLAND': 1, 'MH N/': 1, 'MH-BP': 1, 'mental disorders[MH': 1, 'mental health[MH': 1, 'MHS-H': 1, 'LGG-MHS': 1, 'MH-P': 5, 'TCS-MH': 1, 'Dizziness"[MH': 1, 'Vertigo"[MH': 1, 'MH-SM': 1, 'MH,13': 1, 'MH,3': 1, 'MH-BAP': 1, 'MHS-': 2, 'Ebell MH': 2, 'HCC-MH': 1, 'mMH': 1, 'MH I': 1, 'LG/MH': 1, 'MH-OH': 1, 'MH lesion': 1, 'Goh MH': 1, 'osteonecrosis of the MH': 1, 'MH.NE': 1, 'MH masses': 1, 'MH-HMS-PL': 1, 'MH Mori': 1, 'MH 10': 1, 'MH OA': 1, 'MH unrelated to aura': 1, 'MH + aura': 1, 'MH Conditions': 2, 'MH mylohyoid muscle': 2, 'MH problemsb': 1, 'Pittler MH': 1, 'digi-MHS': 1, 'MH.Schizophrenia': 1, 'MH.Self': 1, 'MH.Life': 1, 'MH.Treatment': 1, 'MH+': 4, 'MH neurotic': 1, 'MH RA': 2, 'MH*PH': 1, 'MH-2': 4, 'MH-m': 1, 'MH IP': 1, 'Irritable Bowel Syndrome[MH': 1, 'MH-II': 4, 'Eb-MH': 1, 'mental health (MH)problems': 1, 'MH-A': 7, 'MH-Z': 1, 'Birkhauser MH': 1, 'MHA': 1, 'MH-ML': 1, 'MH PH': 1, 'MH Dept': 1, 'MH medications': 1, 'MH-COM': 1, 'MH-6': 1, 'MH-14': 1, 'MH-1 to MH-16': 1, 'MH-1': 1, 'MH Disorder': 3, 'MH&A': 4, 'MH:"Neoplasias': 1, 'MH-F': 1, 'fMoST-MH': 1, 'myocardial infarction"[MH': 1, 'coronavirus[MH': 1, 'MH-CTX': 1, 'MH diarrhea': 1, 'NCD- MH & I': 1, 'NCD-MH & I': 1, 'MH Hannover': 1, 'iMH': 1, 'MHS-G': 1, '6-MH': 1, 'MH-PSS': 1, 'MH without aura': 2, 'MH of': 3, 'asthma"[MH': 1, 'MH-S.': 6, 'RECURRENCE[MH': 1, 'TUBERCULOSIS[MH': 1, 'KGP-MH CL-008': 1, 'MH-FA': 1, 'SPSP-MH': 1, 'full-thickness MH': 2, 'FTMH': 4, 'OLMH': 1, 'MH 20': 1, 'MH 21 A': 1, 'MH 10': 1, 'MH-Dx': 5, 'MH sleep hygiene': 1, 'LSA-MH': 1, 'MH deaths': 1, 'O-MH': 1, 'PH&MH': 2, 'MH Mental health': 4, 'MH PH': 1, 'EPS-MH': 2, 'MH suicide': 1, 'MH-DH': 1, 'MH symptomsa': 1, 'MH-60': 1, 'SUD MH': 1, 'MH PH Obs': 1, 'MH Obs': 1, 'RAI- MH': 1, 'Nasr-Esfahani MH': 1, 'MH Disorders': 2, 'Moniz MH': 1, 'Neurocognitive Disorders[MH': 1, 'alzheimer disease[MH': 1, 'T-MH': 1, 'Back Pain[MH': 1, 'vesaluoma MH': 1, 'MH-syndrome': 1, 'MH.MZ': 2, 'MH-RD': 2, 'e-MH': 2, 'del-MH': 1, 'MH-Reha': 1, 'MH hypertrophy': 1, 'NOT-MH-15-025': 1, 'MH-14-': 1, 'NOT-MH-14-015': 1, 'MH-16': 1, 'MH-15-012': 1, 'CAT-MH': 2, 'MH"Interrater': 1, 'MH"Bias': 1, 'MH-TC2': 1, 'TC': 1, 'MH-TAM3': 1, 'MH&ME': 1, 'Mourad MH': 1, 'FCSEMS-MH': 1, 'MH".2': 1, 'MH tendinopathy': 1, 'MH exercise': 1, 'MH-I': 5, 'MH-E': 1, 'SF-MH': 1, 'MH-C': 4, 'mental health (MH) disorders': 1, 'HDV MH': 1, 'MA-MH': 1, 'SPECIFICITY"[MH': 1, 'MH SW': 1, 'ECM1-MH': 1, 'MH&W.': 1, 'MH&W': 1, 'MH manuka honey': 1, 'DF-MH': 1, 'MH 1': 2, 'BC-MH': 1, 'gSC-MH': 1, 'PC-MH': 2, 'ePC-MH': 1, 'MH&FC': 2, 'Ni-MH': 5, '/MH': 1, 'Williams MH': 1, 'MH HCC': 2, 'MH-ICC': 1, 'SB-MH': 1, 'MT-MH': 1, 'MH/R': 1, 'Y-MH': 1, 'MH QUANTITATIVE': 2, 'MH Fractures': 1, 'obsessive MH': 1, 'MH&D': 1, 'MHS-A': 1, 'MHS-D': 1, 'N-MH]LCA': 1, 'SH & MH LH': 1, 'MH Condition': 2, 'CHQ-MH': 1, 'MH tuberculosis': 1, 'CM MH': 1, 'MH) without aura': 1, 'Parkinson MH': 1, 'NOT-MH-20-047': 1, 'neoplasms"[MH': 2, 'Dystonic Disorders"[MH': 1, 'Blepharospasm"[MH': 1, 'Dystonia Musculorum Deformans"[MH': 1, 'Dystonia"[MH': 1, 'MH MDD': 1, 'PSC-MH': 1, 'MH-Ic': 1, 'MH-Ia': 1, 'Aurousseau MH': 1, 'hepatoma MH-134': 1, 'mental health (MH)': 1, 'PF & MH': 1, 'mental disorder[MH': 1, 'MH symptomsNumber': 1, 'START MHS': 1, 'MH-like symptoms': 1, 'MHS,22': 1, 'MH DX': 1, 'MH:18': 1, 'EE': 1, 'EE MH': 1, 'MHS 1b or 2': 1, 'hPROMIS-MH': 1, 'MH-LEACH': 1, 'R2D2-MH': 1, 'C72-MH': 1, 'Intestinal Diseases"[MH': 1, 'Stomach Diseases"[MH': 1, 'Gastroenteritis[MH': 1, 'IJzendoorn MH': 1, 'KGP-MH DU-001': 1, 'Coronavirus"[MH': 1, 'MH-S inflammation': 1, 'MH-S Inflammation': 1, 'MH NTE': 2, 'MH muscle': 1, 'MH-HDI': 1, 'MH mental health': 2, 'Cho MH': 1, 'CDC-MH': 1, 'MH depression': 1, 'MH-D': 5, 'Foster MH': 1, 'ICP-MH': 1, 'MH&N': 2, 'neoplasms[MH': 2, 'CM-MH': 1, 'MH-CH': 2, 'MH-TEDS': 1, 'Rand-MH': 1, 'lamellar MH': 1, 'FRS-MH-R': 1, 'FRS-MH-F': 1, 'MH_MC': 1, 'MH_H': 1, 'MH SVI': 1, 'MH-HIS': 1, 'MH-HISs': 1, 'MH PLATELETPHERESIS': 7, 'MH-CL': 1, 'MH crises': 1, 'ROLE OF MH CLINICIANS': 1, 'Congenital MH 1': 1, 'hematologic (MH) diseases': 1, 'MHS,': 1, 'MH-V': 3, 'Bonyadi MH': 1, 'AMD MH': 1, 'MH-134 hepatoma': 2, 'MH-u-R': 1, 'MH difficulties': 1, 'Rosa[MH': 1, 'Dysmenorrhea[MH': 1, 'Amenorrhea[MH': 1, 'Menorrhagia[MH': 1, 'MH-12': 1, 'MH-13': 1, 'MHS;negative': 1, 'MI MH': 1, 'MH L VL': 1, 'MH L': 1, 'Metaplasia[MH': 1, 'Hyperplasia[MH': 1, 'HAZUS-MH': 1, 'Lee MH 2019': 1, 'high myopia MH': 1, 'high-myopia MH': 1, 'JT & MH': 1, 'FRE-MH': 1, 'MH diseases': 2, 'ASHR-MH': 1, 'MH-GA': 1, 'MH"health': 1, '-PH&MH': 1, 'VEP-PH&MH': 1, 'VEP- PH&MH': 1, 'Su MH': 1, 'MH-85': 1, "MH's injuries": 1, 'neoplasm[MH': 1, 'hepatoma MH': 1, '5-MH': 1, 'MHS-C.': 1, 'MHS-R': 1, 'MH AF': 1, 'RAI-MH': 1, 'MH"Rural': 1, 'MH"Communication': 1, 'MH"Insurance': 1, 'MH"Special': 1, 'MH"Medically': 1, 'MH"Medicaid': 1, 'MH"Medicare': 1, 'MH-PP': 1, 'TH-MH': 1, 'Gendle MH': 1, 'CYP-MH': 1, 'PROM-MH': 1, 'PECUNIA PROM-MH': 1, 'MH distress and': 1, 'myalgiaWUP MH': 1, 'MH headache': 1, 'MH/SUD': 1, 'MH-SET': 1, 'MH macrophages': 1, 'SGC-MHS': 1, 'MH damage': 1, 'MHD': 1, 'dementia[MH': 1, 'Alzheimer Disease[MH': 1, 's-MH': 1, 'PROM MH': 1, 'Mental health (MH) condition': 1, 'MESH MH': 1, 'MHSecondary MH': 1, 'MH 2 C': 1, 'Punctate MH': 1, 'MH"Disabled': 1, 'occupational diseases[MH': 1, 'occupational medicine[MH': 1, 'MH-3': 1, 'Ledran MH': 1, 'POLYMERASE CHAIN REACTION"[MH': 1, 'LATEX FIXATION TESTS"[MH': 1, 'expansum MH 6': 1, 'MH problems3': 1, 'Headache"[MH': 1, 'VANAAREGENMORTEL MH': 1, 'MH-N.': 1, 'MH-OB': 1, 'Obs MH': 1, 'Barnett MH': 1, 'Woollacott MH': 1, 'MH-NGCs': 1, 'MH-NPS': 1, 'MH.S': 1, 'Chagas MH': 1, 'Celiac Disease"[MH': 1, 'PDF': 1, 'MH l.': 1, 'DMHL': 1, 'MH-TA': 1, 'MH-H': 1, 'MH S': 1, 'A&MH': 1, 'PAM-MH': 2, 'Spitznagle MH': 1, 'CPM-MH': 1, 'Ebrahimzadeh MH': 1, "MH '": 1, 'Park MH': 2, 'READ-MH': 1, 'SZ & MH': 1, 'MH-HCl': 1, 'MH-ID': 1, 'MHS-SPME': 1, 'MHS1': 2, 'MH impairments': 1, 'MH-like syndrome': 1, 'MH-BMV infection': 1, 'STAR-MH': 1, 'MH-325-E': 1, 'MH- ML': 1, 'RDP-MH': 1, 'MH Spinal Diseases': 1, 'MH-TIPS': 1, 'MH-HB': 2, 'MH.a': 1, 'MH type I': 1, 'I MH': 1, 'type I MH': 1, 'DeGroot MH': 1, 'MH-AMB': 1, 'Mendez MH': 1, 'MH emergency': 1, 'KGP-MH': 1, 'MH/L': 1, 'CHARACTERISTICS OF THE 15 MH-2 CELL': 1, 'MH ED presentations': 1, 'MH ED': 1, 'disease[MH]CVDTIIDM': 1, 'MH-III': 1, 'MH-IV MH-': 1, 'MH problem': 2, 'NF MH I': 1, 'NF MH II': 1, 'PED-MH': 1, 'Verlhac MH': 1, 'dementia"[MH': 1, 'MH-type': 1, 'Impairment in MH': 1, 'MH impairment': 1, 'Mental health (MH) disorders': 1, 'MH[i': 1, 'MH CCAC': 1, 'MH V': 1, 'MH-CASC': 1, 'PARTNER-MH': 2, 'chi 2 MH': 1, 'COVID-MH': 1, 'Growth Disorders"[MH': 1, 'Dwarfism[MH': 1, 'LR-MH': 1, 'MH mammillae hypoplasia': 1, 'Wilson MH': 1, '-MHS': 2, 'MH.MHSTDTC': 1, 'MH.MHPTCD': 1, 'JIN-MH': 1, 'MH infections': 1, 'MH-Tr': 1, 'MHB': 1, 'rhegmatogenous RD MH': 1, 'Rhegmatogenous RD MH': 1, 'ICC-MH': 1, 'dMoST-MH': 1, 'SNIEC MH': 1, 'PGI-C MH': 1, 'PGI-S MH': 1, 'PV MH': 1, 'MH + H': 1, 'MH-RR': 1, 'MHS1-100ML': 1, 'MH-S infections': 1, 'tibialis anterior MH': 1, 'NPH-MH': 1, 'MH_': 1, 'NCEMMD MH': 1, 'MH +': 1, 'hypertension;MH': 1, 'Anorexia"[MH': 1, 'Bulimia"[MH': 1, '3-MH': 1, 'MH-SEL': 1, 'ZO@MH': 1, 'MH Mental Health': 1, 'Na-MH': 1, 'MH-K2': 1, 'MH-K5': 1, 'MH-K1': 1, 'MH-CMP-34': 1, 'MH-CMP-31': 1, 'MH-CMP-35': 1, 'MH-CMP-': 1, 'MH-CMP': 1, 'MH-Pen': 1, 'NCSU_MH': 1, 'MHS muscle': 1, 'IDD MH': 1, 'MH-TENG': 1, 'CYS-MH': 1, 'MH)': 1, 'D-MH': 1, 'MH-006': 1, 'SARS Virus"[MH': 1, 'Heydari MH': 1, 'LC-MH': 1, 'biceps brachii muscle MH': 1, 'vastus medialis muscle MH': 1, 'Butt MH': 1, 'MHS(c)': 1, '-MH-V': 1, "MH'96": 1, 'Brink MH': 1, 'MH problemsCultural': 1, 'hYES-MH': 1, 'SSM-MH': 1, 'MH hole': 1, 'MH-OW': 1, 'MH-134 MOUSE HEPATOMA': 1} | MH |
Disease | MESH:C535695 | {'Malignancy 2': 19, 'Malignant Fibro-histiocytoma 2 2': 1, 'Bismuth type 1 and 2 lesions': 1, 'malignancies.2': 17, 'MHS': 141, 'MH susceptible': 18, 'malignancy.2': 14, 'type 1 and type 2 lesions': 5, 'MH-susceptible': 18, 'Malignant Hyperthermia Susceptibility': 3, 'type 2 carcinoma': 8, 'type 2 carcinomas': 14, 'MHS syndrome': 1, 'MHS muscle': 6, 'Malignant hyperthermia susceptibility': 16, 'malignant hyperthermia susceptibility': 18, 'malignant fibrous histiotoma,2': 1, 'RMI 2': 1, 'type 1 and 2 lesion': 1, 'Type 2 carcinoma': 3, '1 and type 2 lesions': 2, 'MHS SR': 2, 'MHN': 3, 'type 1 and 2 lesions': 4, 'malignant hyperthermia-susceptible': 4, 'MH-Susceptibility': 1, 'malignancy,2': 3, 'MhS.': 1, 'malignancy:2': 2, 'hyperpyrexia susceptible': 1, 'fungating malignancies.2': 1, 'malignancy 2': 2, 'malignant diseases.18F-FDG': 1, 'malignancy;2': 1, 'malignant hyperthermia susceptible': 2, 'epithelial1,2 and hematologic3 malignancies': 1, 'BRCA-associated malignancies': 1, 'type 2-carcinomas': 1, 'carcinoma type-2': 1, 'MALIGNANT OSTEOBLASTOCLASTOMA AFFECTING 2 BONES OF': 1, 'myeloid, T- and B-cell malignancies': 1, 'B-cell malignancy': 1, 'B-cell malignancies': 1, 'T- and B-cell malignancies': 1, 'myeloid, T- or B-cell malignancies': 1, 'Malignant Lesion type Mass 2': 1, 'haematologic malignancies.2': 1, 'Type 2 carcinomas': 3, 'MH muscle': 1, 'MHS2': 1, 'type 2 malignancy': 1, 'type 2 malignancies': 1, 'type 2 latency malignancies': 1, 'Type 2 Malignancy': 1, 'Type 2 malignancies': 2, 'VHL 2 type malignancies': 1, 'malignant neoplasms1,2': 1, 'Berndt and Harty type 1 and 2 lesions': 1, 'ISUP 2 malignancies': 1, 'Lesion type 1 and 2': 1, 'MHS condition': 1, 'MH-': 1, 'MH': 1, 'uterine malignancy.2': 2, 'disease malignancy.2': 1, 'Type 2 CRCs': 1, 'type 1 and type 2 CRCs': 1, 'type 2 CRCs': 1, 'CNE-2 malignancy': 1, 'malignancy 2': 1, 'Dubberley types 1 and 2 lesions': 1, 'type I and II MHS': 1, 'I MHS': 1, 'II MHS': 1, '2 malignancies': 1, 'type 1 or type 2 Pipkin lesions': 1, 'malignancies[2': 1, 'haematological malignancies.2': 2, 'secondary malignancies:2': 1, 'HER-2-type carcinoma': 1, 'malignant diseases.2': 1, 'oral malignancies,2': 1, 'BRCA1/2 malignancies': 1, 'malignancies,2': 1, 'MH susceptibility': 1, 'type 1 and type 2 carcinoma': 1, 'leukocortical Type 1 and intracortical Type 2 lesions': 1, 'Malignancy 2': 1, 'Ramp lesions type 1 and 2': 1, 'Type-2 carcinomas': 1, 'nonkeratinizing carcinoma (type 2': 1, 'MHS.b': 1, 'type 1 and type 2 carcinomas': 1, 'malignant.2': 1, 'MHSh': 1, 'extrahepatic malignancy.2': 1, 'PiPP': 1, 'Solid Organ Malignancy 2': 1, 'Variante 2 maligner Erguss': 1, 'C-2 osteolytic malignant lesion': 1, 'malignant Schwann sNF96.2': 1, 'carcinoma of Borrmann type 2': 1} | MHS |
Disease | MESH:C535696 | {'type 3, type 4, and types 2-5': 1, 'Malignancy 3': 9, 'malignancy.3': 12, '1, type 2, or type 3 lesions': 1, 'malignant tumor Poly-3': 1, 'gynecologic malignancies.3': 1, 'type 2, 3, or 4 fractures': 1, 'malignancies.3': 10, 'Gleason 3 and 4 carcinoma': 1, 'Jass types 2, 3, and 4': 1, 'type 1, type 2, type 3 and type 4': 1, 'Neer-Horowitz (N-H) type 2, 3, and 4 of fracture': 1, 'type 2, 3 and 4': 1, 'Goseki classes 3 and 4 carcinomas': 1, 'endometrial carcinoma and type 3 malignant curve': 1, 'Mcs3 carcinoma': 1, 'malignancies,3': 2, 'Fitzpatrick skin types 2, 3, and 4': 1, 'Eden types 2, 3, and 4': 1, 'type 2, 3, and 4 injury': 1, '(type 4 vs types 1-3)': 1, 'BARC type 2, 3, or 4': 1, 'Lethal(3)malignant brain tumor-like protein 3': 1, 'Malignancy 3': 1, 'OPMD-3': 1, '1, type 2, type 3, type 4, and type 5 fibroids': 1, 'Gartland type 2, 3, and 4': 1, '(type 2, 3, or 4)': 1, 'Type 3 carcinomas': 1, 'World Health Organization types 2 and 3 carcinomas': 1, 'CNNM2-related disorders type 3': 1, 'BARC type 2, 3, 4, and 5': 1, 'endocrine malignancies.3': 1, 'stage 1, 2, 3, 4 carcinomas': 1, 'Crowe types 2, 3, and 4': 3, 'EC-3 carcinomas': 1, 'malignant fibrohistiocytoma-3': 1, 'type 1, type 2, type 3, type 4': 1, 'esophageal malignant tumors.3': 1, 'malignant tumors.3': 4, 'Gleason 3+4 carcinomas': 1, '1 and type 3 lesions': 2, 'type 2, type 3 and type 4 AVN': 1, 'HGM 3': 1, 'Malignant skin adnexa - - 3 -': 1, 't(3;21) malignancies': 1, '15 type 2, 4 type 3': 1, 'type 2, 3, 4 or 5 MI': 1, 'oral carcinoma 3': 5, 'Lenke type 1, 2, 3 and 4 curves': 1, 'type 1 or 3 ML lesion': 1, ', 3, and 4 carcinomas': 1, 'WHO type 3 carcinoma': 2, 'WHO type 3 carcinomas': 1, 'subscapularis tear with type 3 or 4 fatty degeneration': 1, 'HHs of types 2, 3, and 4': 1, 'type 1 and type 3 lesions': 1, 'malignancy:3': 2, 'NILM 3': 2, 'type 1, 3 and 4 hypersensitivity': 1, 'Group 3 MB malignancy': 1, 'acromion type 2-3-4': 1, 'type 2 and 3 carcinomas': 1, 'malignant ascites.3': 2, 'CA 3 4 1': 1, 'Comedo carcinoma 3(4)': 1, 'galactosemia type-4, type-2, type-1 and type-3': 1, 'Sunderland type 2, 3 or 4 injury': 1, 'type 3 and 4 thoracic central vein obstruction': 1, 'malignancy;3': 1, 'type 1-type 5-type 4-type 3-type 2': 2, 'Wiberg type 2, no type 3 or 4': 1, 'malignancies.3,4': 1, 'type 2, 3, 4, and 5 IFs': 1, 'type 1 diabetes1, 2, 3, 4': 1, 'thyroid malignant tumors.3': 1, 'malignant (WHO grade 3) tumors': 1, 'Types 1, 3, 4': 1, 'Urogenital congenital malformation and malignancy 3': 1, 'Type 1, 3, and 4': 1, 'EC-3 and type II carcinomas': 1, 'malignancy 3,': 1, '(NnV-Mlp) type 1, type 2, type 3, and type 4': 1, 'LMP 3': 1, 'carcinomas of the Bormann type 3+4': 1, 'Sanders types 1, 3, and 4 calcaneal fractures': 1, 'Gass lesion types 2, 3 or 4': 1, 'Type 1, 2, 3 or 4 Pipkin fractures': 1, 'Pipkin fracture Type 2, 3 or 4': 1, 'type 2 Risk type 3 Risk type 4': 1, 'type 2 diabetes2, 3, 4': 1, 'type 3 or 4 HCC': 1, 'Type 3 Malignancy -': 1, 'Type 3 Malignancy': 1, 'type 3 malignancies': 1, 'l(3)mbt malignancies': 1, 'type 1, 2, 3 and 4': 1, 'skin type 1, 2, 3 and 4': 1, 'EHIT Type 2, 3, or 4': 1, 'Stage 3 and 4 carcinomas': 1, 'MHS3': 1, 'malignant hyperthermia susceptibility type 3': 1, 'malignancy,3': 2, 'Intra-ocular malignancy.3': 1, 'carcinomas 3, 4': 1, 'Notice types 4, 1, and 3': 1, 'type 1 and 3 lesions': 1, 'penile malignant lesions.3': 1, 'Benign 22 5 Malignant 3': 1, 'Mladina types 2, 3 and 4 deformities': 1, 'Malignancy 3': 1, 'ISUP 3 malignancy': 1, 'systemic malignancy,3': 1, 'Paley types 1, 2, 3 or 4': 1, 'urothelial carcinoma 3, 4': 1, 'type 2, 3, or 4 PD': 1, 'mucocutaneous malignancies.3': 1, 'Carragee type 1, 3, or 4': 1, 'SCAI Type 3-4 lesion': 1, 'Malignancy 3 1': 1, 'Malignancies 3': 1, 'Lenke type 1, 2, 3, 4': 1, '3, 4, and 5 carcinomas': 1, '2 and 4 type 3': 1, 'malignant.3': 1, 'type 1, type 2, and type 3 lesions': 1, 'type 2, 3 and 4 fractures': 2, 'webs of type 2, 3, and 4': 1, 'stage 3 malignancies': 1, 'Type 3 CRCs': 1, 'type 3 CRCs': 1, 'Tonnis type 2 and 3-4': 1, 'Type 2-3-4 fracture': 1, 'Type 2-3-4 fractures': 1, 'carcinomas 2, 3, 4': 1, 'Papilla types 2, 3 and 4': 1, 'invasive carcinomas 3, 4, 5': 1, '3 or type 2 carcinomas': 1, 'malignant (grade 3) tumors': 1, 'Bosniak types 2, 3 and 4': 1, 'CA-3': 1, 'type 1, 3, 4, and 5': 1, 'malignancies.1, 2, 3, 4 beta-catenin': 1, 'and malignant tumors.3': 1, 'Berndt and Harty type 2, 3, and 4': 1, 'malignancy - 3': 1, "Carpentier's type 1, 2, 3, and 4 lesions": 1, 'LF types 2, 3, and 4': 1, 'Sunderland type 2, 3, and 4': 1, '2/type 3-4': 1, 'infection type 1, 2, 3, 4, or 5': 1, 'astrocytomas with Grades 3 and 4 malignancy': 1, 'type 2 and type 3, type 4': 1, 'type I (1-2), type II (3) and type III (4-5)': 1, 'New malignancy 3': 1, 'inv(3) malignancies': 1, 'Malignancy 3': 1, 'HER-2-type carcinoma 3': 1, 'type 1, type 2, type 3, and type 4 air (ine': 1, 'Neer type 1, 2, 3, and 4 fractures': 1, 'type 2, 3 and 4 slap lesions': 1, 'oral carcinoma.3': 1, 'Malignancies of duodenal ampulla;3': 1, 'type 1, 2, 3, 4 or 5 abomasal ulcer': 1, 'endometrial, and 3 vaginal malignancies': 1, 'pulmonary malignancy.3': 1, 'Type 1-2-3(-4) fractures': 1, 'BARC types 2, 3, 4, and 5': 1, 'frontal lesions (type 3, 4, and 5': 1, '1, type 2, type 3, type 4': 1, 'mRMI 3': 1, 'type 2, type 3 and type 4': 2, 'Bismuth type 1, 3, 4 and 5': 1, 'Bismuth type 1, 3, 4, and 5': 1, 'Sanders Types 2, 3, and 4': 1, 'NAGM, type 1 and type 3 lesions': 1, 'type 2, 3, or 4': 1, 'types 2, 3 and 4': 1, '3 malignancies': 1, 'Type 3 carcinoma': 1, 'Schatzker types 1, 2, 3, and 4 fractures': 1, 'OPMD II type 3': 1, ', Type 2, Type 3 or Type 4': 1, 'Oral carcinoma 3': 1, 'Outerbridge lesions type 3 or 4': 1, 'lesion types 3 and 4': 1, 'bleeding type 2, 3 or 4': 1, 'Types 1, 3 and 4 hypersensitivity': 1, 'CB type 1,3,4, and 5 infections': 1, 'acromion Type 2, 3 and 4': 1, 'ICF type 1, type 2, type 3 and type 4': 1, '3 oral carcinoma': 1, "Gell and Coomb's type 2, 3, or 4": 1, 'WMP 3': 1, 'lesion types 1-3': 1, 'Malignant 3': 1, 'Malignancy grade 3 tumors': 1, '2 , 3 , 4 NUT carcinoma': 1, 'Borrmann 3 type carcinoma': 1, 'Neer type 2, 3 or 4': 1, 'malignant disease.3': 2, 'Crowe types 2, 3 or 4': 1, 'malignant 8000/3': 1, 'BARC type 2, type 3, type 4, type 5': 1, 'SLAP lesions) types 3 and 4': 1, 'LMP (3': 1, 'Borrmann type 3 carcinoma': 1, 'Carcinoma Simple 4 3 - -': 1, 'RS type 1,2,3, and 4': 1, 'Malignant neoplasiad 3': 1, 'Fiber Type 1 2 3 4': 1, 'invasive carcinoma of no special type 3 2': 1, 'invasive carcinoma of no special type 3 1': 1, 'invasive carcinoma of no special type 3 2 1': 1, 'EHIT) types 1, 2, 3, and 4': 1, '1, type 2, type 3, and type 4': 1, 'Type 1 disorders Type 2 disorders Type 3 disorders Type 4': 1, 'Type 1-type 1 disorders Type 2-type 2 disorders Type 3-type 3 disorders Type 4-type 4 disorders': 1, 'Cooney type 1, 2, 3, and 4 fractures': 1, 'types 1, 2, 3, 4,': 1, 'female malignancies.3': 1, '1 to type 3, 4, and even 2': 1, 'MPE.3': 1, 'C1-INH-HAE) type I/II 1, 2, 3, 4, 5': 1, 'World Health Organization (WHO) type 3 carcinomas': 1, 'GC of type 2 and type 3': 1} | malignancy.3 |
Disease | MESH:C535697 | {'type 4': 75, 'Epithelia Malignant 4': 1, 'Isshiki type 4': 2, 'especially type 4': 1, 'Sade Type 4': 1, 'Borrmann Type 4': 4, 'SPG type 4': 1, 'type-4 SI': 1, 'Borrmann type 4': 54, 'type 4 lesions': 2, 'malignancy.4': 11, 'type 1, 2, and 4': 1, 'Bartonicek/Rammelt type 4 fracture': 1, '4-NQO carcinoma': 1, 'or type 4': 2, 'Type 4 CRCs': 1, 'type 1-4': 1, 'type 2 and 4': 2, 'type 4 polyorchidism': 1, 'Ogino type 4': 1, 'Type 1 and Type 4 MIs': 2, 'Rockwood type 4': 1, 'Enneking type 4': 1, '4 T1 carcinoma': 1, 'SCC-4 carcinoma': 2, 'type 4 pneumococci': 1, 'Type 4 fractures': 4, 'tympanoplasty type 4': 1, 'hypopigmented type 4': 1, 'Type 4': 14, 'type 4 deformity': 1, 'Schatzker type 4 fractures': 1, 'Djindjian type 4': 1, 'type 4 hyperlipoproteinaemia': 1, 'Garden type 4': 6, 'type 4 carcinoma': 3, 'Malignancy 4': 5, 'Buffeli Type 4': 1, 'type 4 p-ANHs': 1, 'N-H type 4': 1, 'Garden type-4': 1, 'FIGO type 4': 1, 'pT2-4 carcinomas': 3, 'Gleason 4 carcinomas': 1, 'Bismuth type 4': 6, 'Bi-RADS type 4 lesions': 1, 'type 4 DARs': 1, 'Hepatocyte type 4': 1, '4-OPRI, type 1': 1, 'type 1 diabetes21.4': 1, 'De Flaviis type 4': 1, 'Judet type 4 fractures': 1, 'FC type 4': 2, 'haematological malignancy.4': 1, 'type 4 CM': 2, 'Neer type 4 fracture': 4, '(types 2 through 4': 1, 'Altman type 4': 1, 'Neisseria meningitidis, type 4': 1, 'type 4-': 1, 'malignancy,4': 1, 'Schatzker type 4 fracture': 3, 'Bristol type 4': 3, 'Dewey type 4': 1, 'chemoresistance type 4': 2, 'fracture complexe type 4': 1, 'Fitzpatrick skin type 1 to type 4': 1, 'Pipkin Type 4': 2, 'Borrmann type 4 carcinoma': 2, 'Gartland type 4': 6, 'Lanz Type 4': 1, 'type 4 dyssynergic pattern of defecation': 1, 'type 4 fracture': 5, 'Carcinoma hepatico 4 /': 1, 'Vl type 4': 1, 'Bryan and Morrey type 4': 1, 'Type 4 DMHI': 1, 'BARC type 2-4 and type 3-4 bleeds': 1, '-Wt-4': 1, 'Sanders type 1 and 4 fractures': 1, 'Paprosky type 4': 5, 'type 2 and type 4 fracture': 1, 'Bartonicek type 4': 1, 'Gleason pattern 4 carcinomas': 4, 'malignancies.4': 7, 'type 1 and 4': 2, 'Jamieson type 4': 1, 'Lenke Type 1-4': 1, 'Fredrickson type 4': 1, 'Neer type 4 fractures': 6, 'Circ, type 4,': 1, 'Fitzpatrick type 4': 2, 'type 4-r': 1, 'Matteoni type 4': 9, 'lesion of type 4': 1, 'uncertain type 4': 1, 'Uncertain type 4': 1, 'PAD type 4': 1, '2 and type 4': 3, 'RCDP type 4': 1, 'type 4 AGC': 2, 'Lenke types 1-4': 4, 'Sugaya type 4': 3, 'type 2+4)': 1, 'Melone type 4': 1, 'and type 4': 2, 'Bryan-Morrey type 4': 1, 'Bryan-Morrey type 4 fracture': 1, 'Schwab osteotomy type 4': 1, 'pT1-4 carcinomas': 2, 'LDS type 4': 4, 'MED types 1 and 4': 1, '-Crafts-type 1,4': 1, 'Goh type 4': 2, 'Type-1 and Type-4 HSRs': 1, 'Lenke type 4': 10, 'type 1-4 disability': 1, 'Bormann type 4': 8, 'HPIV type 4': 2, 'type 2 diabetes3,4': 1, 'emm-type 4': 1, 'Gleason pattern 4 carcinoma': 8, 'Mesenchymal type 4': 1, 'type 4 hyperlipidaemia': 1, 'aImmune reaction type 4': 1, 'Stapfer type 4': 1, 'Lenke type 4 curves': 1, 'malignancy of cluster of differentiation 4': 1, '-Rammelt type 4': 1, 'Bartonicek-Rammelt type 4 fracture': 1, 'ZAGA type 4': 1, 'Borrmann type 4 lesions': 5, 'PIOC type 4) 2': 1, 'Lenke type 1-4 curves': 4, 'Sanders type 4 fractures': 4, "Borrmann's type 1 to type 4": 1, 'DGOU Type-4': 1, 'type 4 fractures': 14, 'Bayne type 4': 1, 'VARC type 2-4': 1, 'type-4': 3, 'ACR type 4': 1, 'type 4 ML lesion': 1, 'Garden type 4 fracture': 3, 'Type 4 fimbriate': 1, '2 und type 4 fractures': 1, 'Lenke-Silva type 2-4': 1, 'Sanders and Frykberg type 2-4': 1, '4 carcinoma': 3, 'type 4 carcinomas': 2, 'Manchaiah type 4': 1, 'type 4 HHs': 1, 'Forrester Type 4': 1, 'type 4 violence': 1, 'Pipkin Types 1, 2, and 4 fractures': 1, 'Type 4 injuries': 1, 'Paley type 4': 4, 'hemochromastosis type 4': 1, 'type 1 to type 4': 1, 'NUT carcinoma-4': 1, 'Sher type 2-4 obstruction': 1, 'IPCL type 4': 1, '/4) carcinoma': 1, 'type 4 DHF': 1, 'Arlet-Durroux type 4': 1, 'Bartonicek type 2 and 4': 1, 'of Differentiation type 4': 1, 'funestus to Net Type 4': 1, '4-LLNIs Type 4': 1, 'Net Type 4': 1, 'Type 4 Fluid': 1, 'Cognard type 4': 3, 'Lenke type 1-4': 6, 'Neer type 4 fracture injury': 1, 'Tikhoff-Linberg type 4': 1, 'D type 4.0 and 4.1': 1, 'Paley types 4 a-c': 1, 'Corrosion type 4': 1, 'Borrmann type 4 lesion': 3, '1 and type 4': 3, 'LEC 4': 1, '(type 4': 2, 'type Vb - 4': 1, 'Mayfield type 4 injuries': 1, 'Lenke Type 4 curve': 1, 'PT4': 1, 'Song type 4': 1, 'OF-type 1-4)': 1, 'TRIPOD type 4': 3, 'Fielding type 4': 1, 'Bismuth-Corlette (BC) type 4': 1, 'Bismuth type 4 N0R0': 1, 'BC type 4': 1, 'Bismuth-Corlette Type 4': 1, 'BC Type 4': 1, 'FGMC type 4': 1, 'Lafosse Type 4 and': 1, 'type 4 DD': 1, 'vascular type 4': 1, 'especially type 1, 4 and X1': 1, 'OMC type 4': 1, 'type 4 JB': 1, 'Neer type 4': 4, 'bleeding type 2-4': 1, 'Gleason Pattern 4 Carcinoma': 2, 'Type 2 4': 1, 'Borrmann 4 type carcinoma': 2, 'CH type 1, 2, and 4': 1, 'OM-type 4': 1, 'UBM type 4': 1, 'OM-type 4)': 1, 'Kudo type-4': 1, 'Quigley type 4': 1, 'type 4(': 1, 'Markis type 4': 1, 'type 1 or type 4 allergy': 1, 'Gleason grade 4 carcinomas': 1, '(type 1-4': 1, 'Xcc type 4': 1, 'Ahlback Type 2-4': 1, 'type 4 (': 1, 'sinonasal malignancies.4': 1, 'NnV-Mlp) type 4': 1, 'NnV-Mpl type 4': 1, 'Tonnis type 4': 4, 'Gartland Type 4 versus': 1, 'LQT type 4': 3, 'type II/1 type IIIb/4 type IIIa/4 type IV': 1, 'BARC Type 4': 1, 'Aptenia type 4': 1, 'Schobinger type 4': 1, '1- and type 4-': 1, 'Bartonicek type 4 fractures': 2, 'Takemitsu type 4 curves': 1, 'Roussouly type 4': 2, '-type 1.4': 1, 'Suspicious carcinoma 4': 1, 'Crain type 4': 1, 'RMI 4': 1, 'HemR type 4': 1, 'Tomita type 4 or higher': 1, 'type OF 4 fractures': 1, 'OF 4 type fractures': 1, 'OF 4 type fracture': 1, 'fracture type OF 4': 1, 'Bado type 4': 1, 'Schatzker Type 4 fracture': 1, 'type 4 capituller fractures': 1, 'type 4 injury': 1, 'type 4 obstructions': 1, 'Gharbi type 4': 2, 'Carpentier type 4': 1, 'Pipkin Type 1, 2 or 4 fractures': 1, 'Type 1, 2 or 4 Pipkin fracture': 1, 'Type 4 Pipkin fracture': 1, 'Pipkin Type 4 fractures': 2, 'Pipkin type 4 fractures': 1, 'Pipkin type 4 fracture': 1, ', type 4': 1, 'Rockwood Type 4 injury': 1, 'type 4 injuries': 4, '4 type A': 1, 'type-1 and type-4 allergy': 1, 'Jeanneret type 4': 1, 'HPIV4': 1, 'Petrie type 4': 1, 'Malignancy*4': 1, 'MEN1), type 4': 1, 'Evening type 4': 2, 'error type 4': 1, 'type 4 CBC': 1, 'IgG4-Related': 1, 'IgG4': 1, '(type 4)': 1, 'type Manual 4': 1, 'carcinomas 4': 1, 'carcinoma 4': 3, 'Borrmann-4 carcinoma': 1, 'DVI type 4': 1, 'AO type 4.4': 1, 'Matarasso type 4': 1, 'type 4 PM': 1, 'carcinoma.4': 2, 'type 4 BC': 1, 'Nephropaty Type 4': 1, 'DM-Type-4': 1, 'Farm type-4': 1, 'farm type-4': 1, 'Cordeiro types 3b and 4': 1, 'type 4 fimbriate': 1, 'WHO grade 4 malignancy': 1, 'borrmann type 4': 1, 'Mladina type 4': 2, 'Lower leg EVN type 4': 1, 'Raabeia type 4': 1, 'MF (type 4)': 1, 'AP Type 4': 1, 'subscapularis Lafosse type 4': 1, 'Delbet type 4': 1, 'Lenke types 1 to 4': 2, 'type 1 and 4 type 2 fractures': 1, 'Tooth type 4': 1, 'malignancy 4': 1, 'FCT type 4': 1, 'type 4 FHR': 1, 'Sanders Type 2 and 4 fractures': 1, 'Sanders Type 4': 2, 'Sanders Type 2-4': 1, 'Phage type 4': 2, 'malignancies;4': 1, 'agr-types 1 and 4': 1, '1 and type 2-4': 1, 'MMPRT type 4': 1, 'Gell-Coombs type 4': 1, 'NP type 4': 1, 'type 4)': 2, 'Lafosse type 4': 1, 'MHS 4': 1, 'ALS type 4': 1, 'Carragee type 2 or 4 herniation': 1, 'Carragee type 4': 1, 'Cavendish type-4': 1, 'grade 4 carcinomas': 1, 'type 4 error': 1, 'Thaunat type 4 ramp lesion': 1, 'VT-4': 1, 'Ideberg Type 4 fracture': 1, 'Fracture type 4': 1, 'Norwood type 4': 1, 'Lenke Type 2 or 4': 1, 'drone type 4': 1, 'Wassel type 4': 2, 'Zelle type 4': 1, 'malignant diseases.4': 1, 'type 1 and type 4 fractures': 1, 'H Type 4': 1, 'CMS type 2 and 4': 1, 'DIII type 4': 2, 'type 1 and a type 4 CRY': 1, 'Losanoff type 2-4': 1, 'Stulberg type 4': 1, 'Borrmann type 4 GCs': 1, 'Metaplastic carcinoma 4': 1, 'type II CHI': 1, 'type 2 MIs,4': 1, 'type-1 DMGp-4': 1, 'type-2 DMGp-4': 1, 'LQTS type 4': 1, 'Mayfield type 4': 1, 'Mizutani type 4': 1, 'Mizutani Type 4': 1, 'type 4 VAD': 1, 'Gonial (type 4': 1, 'T4CC': 1, 'KAT-4 carcinomas': 3, 'KAT-4 carcinoma': 5, 'mucositis type 4': 1, 'type 1 and type 4': 1, 'Type 4 response': 1, 'Type-2 4-BUDHs': 1, 'ST7-type 4': 1, 'HAP type 4': 1, 'muccopolysaccharidosis type 4': 1, 'Type 4 carcinomas': 1, 'prancreatic carcinoma 4': 1, 'EDMD, type 4': 1, 'Bosniak type 4 lesion': 1, 'type 4 obstruction': 1, 'Invasive Malignancy 4': 1, 'type 1-4 LMHs': 1, 'Gehweiler type 4': 2, 'Gehweiler type 4 lesions': 1, 'Gehweiler type 4 fractures': 2, 'Wiltse-Newman type 4 fracture': 1, 'type 4 PPRs': 1, 'Sc. 4': 1, 'Sensilla chaetica type 4': 1, 'Bristol Stool Chart type 1-4': 1, 'Sinnecker type 4': 1, 'Kodama type 4': 1, 'Kodama type 2 and type 4': 1, 'Type 4 MG': 1, 'malignancy 4': 2, 'Allen Type 4': 1, 'type 4 Allen': 1, 'Bennett type 4': 1, 'type 4 AD': 1, 'Sanders type 4': 1, 'Sanders type 4 fractures of the calcaneum': 1, 'CE type 4': 1, 'Judet Type 4 fracture': 2, 'Judet Type 4 fractures': 2, '1 to type 4 fractures': 1, 'Lenke type 1 to 4 curves': 1, '4 carcinomas': 1, 'Todani type 1 or 4': 1, 'Todani type 1 and 4': 1, 'type 2- 4': 1, 'pT(4) carcinomas': 1, 'Pipkin fracture type 4': 1, 'weak D type 4.0 or type 4.1': 1, 'weak D type 4.0 and 4.1': 1, 'Borrmann type 4 GC': 1, 'PAS type 4': 1, 'Borrman type-4': 1, 'type 4 OCs': 1, 'SH type 4': 1, 'Borrmann type 4 AGCs': 1, 'CM type 4': 1, 'Starch (type 4': 1, 'SE4': 1, 'Complex carcinoma*4': 1, 'Alhback type 4': 1, 'EC type 4': 1, 'EM type 4': 1, 'Sanders Type 4 fractures': 2, 'Garden type 4 fractures': 1, 'MHs4': 1, 'type 4 MTs': 1, 'OMIM #277470) and type 4': 1, '4 and types': 1, "Fourrier's type 4 lesion": 1, 'Gleason grade 4 carcinoma': 2, 'Fujirock type 4': 1, 'IPNL type 4': 1, 'IPNL types 1 through 4': 1, '4 malignancies': 1, 'Type 4 MIs': 2, 'type 2 and type 4 abnormalities': 1, 'type 1 and type 4 abnormalities': 1, 'type 1-4 abnormalities': 1, 'Eden type 4': 1, 'type 1/type2 4': 1, 'AHA lesion type 4': 1, 'hyperlipoproteinaemia type 4': 1, 'or hyperlipoproteinaemia type 4 hypertriglyceridaemia': 1, 'pattern 4 carcinoma': 2, 'Gartland Type 4 fractures': 1, 'Gartland type 4 fracture': 1, 'Gartland type 4 fractures': 1, 'Gartland type 4 fractures 1-': 1, 'Neer Type 4 fractures': 1, '-type 4': 1, 'type 4-MF': 1, 'TMA type 4': 1, 'as carcinomas 4': 1, 'type-4 hypertriglyceridaemia': 1, 'Ashdown type 2, 4': 1, 'Chemoresistance Type 4': 1, 'CGL type 4': 2, '2-4 carcinomas': 1, 'type 4 PH': 1, 'Bristol stool type 4': 1, 'bad symptom type 4': 1, 'SE phage type 4': 1, 'HPIV types 1-4': 2, 'Hardy type 4': 1, "Borrmann's type-4 carcinoma": 1, 'Fujirock type 4': 1, 'Borrmann (type 4': 1, 'MGTS type 4': 1, 'Type 4) MIs': 1, 'BA type 4': 1, 'malignant disease.4': 1, 'Cierny-Mader type 4': 1, 'glomeruloid Gleason pattern 4 carcinoma': 1, 'Delbet type 4 fracture': 1, 'Jass type 1-4': 1, 'malignancies,4': 2, 'Carcinoma of the bronchus-4': 1, 'GC type 4': 1, 'SCC (4)': 1, 'HJB type 4': 1, 'type 2 and type 4 bone': 1, 'Borrman type 4': 2, 'adult malignancies.4': 1, 'HSC-4 carcinoma': 1, 'IHD Type 4': 1, 'IgG4-SC type 1, 3 and 4': 1, 'Huang-Tseng type 4': 1, 'Huang type 4': 1, 'Type 4 FPLD': 1, 'Type 1 or 4 CPAM': 1, 'Steinmetz type 4': 1, 'Subpial Type 4 lesions': 1, 'Benign and Malignant BIRADS 4 Radiographic Lesions': 1, 'Arlet and Durroux Type 4 lesion': 1, 'Type 4 Harms': 1, 'type A-4': 1, 'Frederickson type 4': 1, 'BGH type 4': 1, 'p-type 4-in': 1, 'phage type 4': 1, 'DA type 4': 1, 'Tronzo type 4 fractures': 1, 'TYPES 4': 1, '1 to type 4': 1, 'ST4': 1, 'type 1, 2, 4': 1, 'type A, 4': 1, 'ST-4': 1, 'Type 1-4': 1, 'WAP-type 4': 1, 'CCAM type 4': 1, 'Gorrie type 4 at': 1, 'Gorrie type 4': 1, 'prostatic carcinoma (Gleason 4+4) carcinoma': 1, 'RCDP types 1-4': 1, 'SGL type 4': 1, 'type 1: 4': 1, 'felony type 4': 1, 'type 4 anomaly': 1, 'MOBRNA type 4': 1, 'GII.4': 1, 'GII type 4': 1, 'Immunoglobulin Type Gamma 4': 1, 'SLAP type 4 lesion': 1, 'Neer Type 4 fracture': 1, 'Van Praagh type A 4': 1, 'type 4 Bismuth MHS': 1, 'Compliance type 4': 1, 'type 4 DIEA': 1, 'types 2-4': 1, 'SOFCOT type 4': 1, 'Crawford type 4)': 1, 'Delalande type 4': 1, 'Paley Type 4': 1, 'OF type 4': 2, 'CMS type 4': 1, 'vascular or type 4': 1, 'Malignance:4': 1, 'type 2 and type 4 OCBs': 1, 'Bosniak Type 4': 1, 'CVSD type 4': 1, 'SmartPeg type 4': 1, 'BARC type 4': 1, 'Schatzker type 4)': 1, 'supracondylian fracture type 4': 1, 'Hiranuma type 4': 1, 'multimorbidity types 2 and 4': 1, 'MM type 4': 1, 'type 2 diabetes3, 4': 1, 'CRs type 4': 1, 'CMY-2 Type 4 Y': 1, 'Nectin-4 Carcinoma': 1, 'malignant fibrous 4': 1, 'pattern type 4': 2, 'lesion type 4': 1, 'type 4 Ficat': 1, 'type 4 lesion': 1, 'Bahren type 4 anomaly': 1, 'Bahren type 4 anomalies': 1, 'Bahren type 4': 1, 'GP 4 carcinomas': 1, 'maternal malignancies.4': 1, 'type 1, type 4': 1, 'type 4 AGCs': 1, 'Bolman type 4 carcinoma': 1, 'cutaneous type 4': 1, 'Lenke Type 4': 1, 'Tessier Type 4': 1, 'Case 4 Type L': 1, 'type 2-4': 1, 'Fisch type 4': 1, 'type 4 PIV': 1, 'Bosniak category type 4': 1, 'and type-4': 1, 'FMH type 4': 1, 'OCB type 4': 1, 'type 4 NET': 1, 'OPDM types 1-4': 1, 'type 4 reactions': 1, 'Adeno type 4': 1, 'type 4-ISO': 1, 'HPIV Types 1-4': 1, 'type 1, 2, and 4 zygomas': 1, 'Hiatt Type 4': 1, 'BT-4': 1, 'Buttazzoni type 4': 1, 'Malignancy 4': 1, 'Josten Type 4': 1, 'Josten type 4 fractures': 1, 'Bleeding type 2-4': 1, 'type 2 and type 4': 1, 'OM Type 4': 1, 'Gharbi type 2 or 4': 1, 'Gehweiler Type 4 Fractures': 1, 'Gehweiler type 4 fracture': 1, 'type 4 PrPSc': 1, 'SCAD type 4': 1, 'VSD, Type 4': 1, 'Sunderland Type 2-4': 1, 'LaPrade types 1 to 4 lesions': 1, 'MCa-4 carcinoma': 1, 'type 4 reaction': 1, 'Sythesis of type 1-4 BA': 1, 'Type-4': 1, 'Graf type 4': 1, 'Mackenzie type 4': 1, 'Sampathu type 4': 1} | type 4 |
Disease | MESH:C535698 | {'malignancy.5': 7, 'malignancy,5': 1, 'type 2 and 4-5 MIs': 1, 'malignant disease,5': 1, 'Malignancy 5': 1, 'malignancies.5': 11, 'Lenke curves types 2, 4, 5': 1, 'Malignant hyperthermia susceptibility 5': 1, 'Mucinous malignant 5': 1, 'Malignancy-5': 1, 'type 4, type 5 and type 2': 1, 'Gleason pattern 4 or 5 carcinomas': 1, 'type 2 diabetes3, 4, 5': 1, 'Malignancy 5': 2, 'MHS5': 4, 'MHS 5, 7 and 8': 1, 'malignancies:5': 1, 'Gleason pattern 4 or 5 carcinoma': 1, 'gastric malignancy.5': 1, 'malignancy.[5': 1, 'SFM 5': 1, 'Ameloblastic carcinoma 5 - 4': 1, 'malignancies,5': 1, 'Malignant hyperthermia susceptibility type 5': 1, 'malignancy Thyroid 5': 1, 'SM 5, 16': 1, 'malignant fibrous 2.5': 1, 'PMEC-5': 1, 'type 4 and type 5 PTIHs': 1, 'Gleason pattern 4 and 5 carcinomas': 1, 'malignant hyperthermia susceptibility type 5': 1, 'Malignant 10Benign 5': 1} | malignancies.5 |
Disease | MESH:C535699 | {'malignancies,6': 5, 'malignancy,6': 1, 'malignant astrocytoma 4-6': 1, 'malignancy.6': 6, 't(6;9) myeloid malignancies': 1, 'malignant tumor.6': 1, 'Sarcoma Unclassified malignant tumor 6': 1, 'malignancies.6': 4, 'malignant tumor,6': 1, 'Lenke types 2, 3, 4, 5, and 6': 1, 'benign and malignant tumors.6': 1, 'maternal malignancies.6': 1, 't(6;9) malignancies': 1, 'Developed malignancy 6': 1, 'MHS6 deficiency': 1, 'malignancies 1, 2, 6, 8': 1, 'LDS type 1, type 2, type 3, type 4, type 5, and type 6': 1, 'malignant tumors.6': 3, 'female malignancies.1,6': 1, 'solid malignancies.6': 1, 'IC-NST 4, 5, 6, 17, 20': 1, 'carcinomas 3, 4, 5, 6': 1, 'malignancy.6,9,19': 1, 'HG Type 1.2.3.4.5.6.7': 2, 'gynecological and 6 rectal malignancies': 1, 'Friend Virus susceptibility genes 1 to 6': 1, 'malignant mesothelioma.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 MSLN': 1, 'Malignant Transformation 6': 1, 'Types 1, 2, 3, 4, 5, and 6 Farber diseases': 1, 'malignancies.5,6': 1, 'malignancies.[6': 1, 'malignant tumors,6': 2, 'LMP 6': 1, 'Malignancies in III-6': 1, 'hepatic malignant transformation.6': 1} | malignancy.6 |
Disease | MESH:C535700 | {'mesenchymal tumors': 4909, 'mesenchymal tumor': 3188, 'mesenchymal cell tumor': 15, 'mesenchymal': 729, 'Mesenchymal tumors': 271, 'mesenchymal lesion': 137, 'mesenchymal stem': 15, 'PMT': 108, 'phosphaturic mesenchymal tumor': 253, 'phosphaturic mesenchymal tumors': 145, 'PMTs': 49, 'myxoid mesenchymal tumor of': 5, 'mesenchymal and hepatic tumors': 2, 'mesenchymal dysplasia': 105, 'mes': 12, 'MM': 224, 'malignant mesenchymoma': 210, 'lung mesenchymal tumor': 1, 'gastrointestinal mesenchymal tumors': 211, 'MES': 372, 'MES GSC': 9, 'Mesenchymal tumor': 84, 'mesenchymal malignancy': 261, 'mesenchymal uterine tumor of the uterus': 1, 'Benign mesenchymal tumor': 4, 'primary mesenchymal tumors of the lung': 2, 'myxoid mesenchymal tumor of infancy': 31, 'malignant mesenchymal tumour': 79, 'mesenchymal malignancies': 326, '-mesenchymal': 114, 'mesenchymal lesions': 241, 'Mesenchymal': 69, 'malignant mesenchymal tumors': 331, 'malignant mesenchymal tumor': 472, 'to mesenchymal': 15, 'Malignant mesenchymoma': 58, 'malignant mesenchymomas': 20, 'vascular mesenchymal tumor': 6, 'mesenchymal, nonmeningothelial tumors': 7, 'EndMA': 2, 'benign mesenchymal tumor': 434, 'myxoid mesenchymal tumor': 43, 'Pro, Mes': 1, 'Mes': 36, 'mesenchymal solid tumors': 5, 'MES GBMs': 24, 'Adult Intracranial Myxoid Mesenchymal Tumor': 1, 'Intracranial myxoid mesenchymal tumor': 8, 'IMMTs': 4, 'Intracranial myxoid mesenchymal tumors': 8, 'submucosal mesenchymal tumors': 9, 'mesenchymal-derived tumors': 12, 'Phosphaturic mesenchymal tumors': 54, 'PMMTI': 33, 'gastrointestinal mesenchymal tumor': 79, 'MESENCHYMAL': 94, 'Malignant mesenchymal tumors of the': 2, 'MMTs': 3, 'malignant pleomorphic mesenchymal tumors': 1, 'pleomorphic mesenchymal tumors': 6, 'mesenchymal carcinoma': 56, 'mesenchymal tumors of the skin': 7, 'vaginal mesenchymal tumor': 2, 'benign mesenchymal tumors': 511, 'malignant mesenchymal liver tumours': 1, 'congenital mesenchymal dysplasia': 1, 'pleomorphic mesenchymal tumor': 4, 'retroperitoneal mesenchymal tumors': 8, 'benign gastric mesenchymal tumors': 2, 'mesenchymal and dedifferentiated tumors': 1, 'uterine mesenchymal tumors': 119, 'Malignant mesenchymoma of mesentery': 1, 'mesenchymal tumors of the gastrointestinal': 11, 'mesenchymal lesionin': 1, 'mesenchymal tumor of the': 7, 'malignant mesenchymal hepatic tumors': 1, 'malignant mesenchymal and neuroectodermal tumors': 1, 'myxoid mesenchymal tumors': 28, 'GIMTs': 21, 'Mesenchymal lesions': 13, 'Mesenchymal Tumor': 33, 'mesenchymal tissue tumor': 19, 'mesenchymal GI tumors': 7, 'mesenchymal malignancy of soft tissue': 3, 'malignant mesenchymal tumor of omentum majus': 1, 'mesenchymal sarcoma tumors': 1, 'Benign mesenchymal scrotal tumors': 1, 'mesenchymal stromal': 2, 'mesenchymal malformation': 6, 'mesenchymal tumors of the uterus': 30, 'MSL': 157, 'ML': 15, 'Benign mesenchymal tumors of': 2, 'MP': 13, 'MSL and': 2, 'Mesenchymal dysplasia': 10, 'uterine mesenchymal tumor': 31, 'mesenchymal liver tumor': 12, 'mesenchymal liver tumors': 10, 'intra-abdominal mesenchymal tumors': 5, 'mesenchymal-like tumors': 50, 'mesenchymal disorders': 20, 'mesenchymal tumor of': 14, 'mesenchymal malignancy of the dura': 1, 'intracranial mesenchymal malignancy': 1, 'CM': 9, 'Pulmonary mesenchymal alterations': 1, 'mesenchymal proliferative lesion': 5, 'malignant mesenchymal tumours': 69, 'mesenchymal and ectodermal abnormalities': 2, 'mesenchymal stromal tumors': 8, 'anorectal mesenchymal tumors': 4, 'mesenchymal hypoplasia': 3, 'Malignant Mesenchymal Tumor': 33, 'MMT': 26, 'malignant Mesenchymal Tumor': 2, 'mesenchymal cartilage-forming tumor': 1, 'gastric mesenchymal tumor': 28, 'mesenchymal transformation': 28, 'mesenchymal" disorders': 2, '"mesenchymal" disorders': 1, 'mesenchymal tumor of bone': 4, 'mesenchyme deficiency': 2, 'mesenchymal uterine tumor': 7, 'pure mesenchymal uterine tumors': 1, 'mesenchymal uterine tumors': 25, 'MPMUT': 1, 'Mesenchymal Tumors': 51, 'stromal or mesenchymal lesions': 3, 'malignant mesenchymal sarcoma': 6, '-mesenchymal transformation': 61, 'mesenchymal/': 2, 'mesenchymal origin tumors': 11, 'EnMT': 4, 'VARIOUS MESENCHYMAL DISEASES': 1, 'Mesenchymal tumors of the lungs': 1, 'myxoid mesenchymal tumors of infancy': 4, 'Primitive mesenchymal tumor of infancy': 1, 'Osteochondrosis PMT': 1, 'Phosphaturic Mesenchymal Tumor': 35, 'Phosphaturic Mesenchymal Tumors': 13, 'Phosphaturic mesenchymal tumor': 81, 'Mesenchymal Mesenchymal IMT': 1, 'pulmonary mesenchymal tumors': 3, 'Mesenchymal tumors of the lung': 1, 'mesenchymal tumor': 1, 'Malignant mesenchymoma of the retroperitoneum': 3, 'mesenchymal malignant tumor': 54, 'mesenchymal malignant tumors': 51, 'benign mesenchymal gastric tumors': 2, 'Mesenchymal tumors of the': 9, 'Malignant retroperitoneal mesenchymomas': 1, 'malignant mesenchymal tumor pain': 1, 'MS': 33, 'mesenchymal fibroblastic tumors': 2, 'mesenchymal cell tumors': 18, 'mesenchymal tumor of the skin': 1, 'congenital tumorous malformation of mesenchymal tissue': 1, 'Gastric Mesenchymal Tumors': 3, 'gastric mesenchymal tumors': 76, 'Gastric mesenchymal tumors': 9, 'mesenchymal tumors of intermediate malignancy': 2, 'mesenchymal tumors of': 19, 'mesenchymal-like tumor': 12, 'mesenchymal tissue defect syndromes': 1, 'renal mesenchymal tumor': 35, 'mesenchyme tumors': 3, 'mesenchymal malignant lesion of': 1, 'mesenchymal chondrosarcomatous': 1, 'mesenchymal tumors of the': 35, 'mesenchymal nonmeningothelial tumors': 3, 'gastric epithelial and mesenchymal tumors': 1, 'ME': 25, 'intrauterine malignant mesenchymal tumors': 1, 'benign mesenchymal lesion': 30, 'mesenchymal Group 3 tumors': 1, 'mesenchymal-': 15, 'uterine mixed epithelial/mesenchymal or mesenchymal malignancies': 1, 'ETM': 1, 'Malignant mesenchymal tumors': 25, 'EndMT': 29, 'Mesenchymal tissue lesions': 1, 'neural and mesenchymal': 1, 'mesenchymal disorder': 47, 'mesenchymal-type tumors': 13, 'Mesenchymal-like tumors': 3, 'Gastrointestinal mesenchymal tumor': 5, 'mesenchymal stromal tumor': 6, 'Gastrointenstinal mesenchymal tumors': 1, 'MES-': 15, 'MES-like': 8, 'MES-like tumors': 3, 'mesenchymal skin tumors': 6, 'mesenchymal tumors': 1, 'mesenchymal tumors of the neck': 1, 'mesenchymal-derived solid tumors': 1, 'dermal or hypodermal mesenchymal tumor': 1, 'SE mesenchymal tumor': 1, 'Mesenchymal systemic disease': 1, 'mesenchymal or neuroectodermal malignancies': 1, 'mesenchymal tissue disease': 1, 'Malignant mesenchymal tissue tumors': 1, 'malignant mesenchymal tissue tumors': 1, 'mesenchymal tumors of the GI': 2, 'mesenchymal and neuroectodermal malignancies': 1, 'mesenchymal subepithelial tumors': 3, 'mesenchymal primary tumors': 4, 'mesenchymal/stromal tumors': 2, 'Benign phosphaturic mesenchymal tumors': 2, 'MM of bladder': 1, 'Bladder MM': 1, 'Primary malignant mesenchymoma of bladder': 1, 'bladder MM': 1, 'Mesenchymal tumors of the gastrointestinal system': 1, 'gastrointestinal related mesenchymal tumors': 1, 'gastrointestinal related malignant mesenchymal tumors': 1, 'GIST': 6, 'GI mesenchymal tumor': 7, 'GI mesenchymal tumors': 39, 'mesenchymal abnormality': 14, 'CONGENITAL MESENCHYMAL': 1, 'PN-MES': 12, 'Malignant mesenchymal tumor': 21, 'Malignant mesenchymal tumors of the urachus': 1, 'Malignant mesenchymoma of the prostate': 1, 'malignant mesenchymoma of the prostate': 1, 'hepatic mesenchymal tumor': 15, 'renal mesenchymal tumors': 48, 'Malignant Mesenchymal Tumour': 13, 'Myxoid Mesenchymal Tumor': 3, 'Myxoid Mesenchymal Tumor of': 1, 'benign mesenchymal tumor of the bone': 1, 'primary mesenchymal hepatic tumor': 1, 'malignant mesenchymoma of the liver': 6, 'primary mesenchymal tumor': 26, 'Mesenchymal tumors of the uterus': 12, 'proneural, and mesenchymal tumors': 1, 'sarcomatous mesenchymal tumors': 1, 'mesenchymal solid tumor': 8, 'mesenchymal and non-mesenchymal tumors': 4, 'primary mesenchymal tumor of the vulva': 1, 'Mesenchymal malignancies': 6, 'Intracranial mesenchymal tumor': 10, 'Mesenchymal, non-meningothelial tumors': 3, 'neurogenic and mesenchymal tumors': 3, 'phosphaturic mesenchymal tumor of the': 2, 'mesenchymal placental tumor': 1, 'MES tumors': 50, 'Mesenchymal, Non-Meningothelial Tumors': 3, 'Mesenchymal renal tumors': 3, 'primary mesenchymal renal tumor': 1, 'malignant mesenchymal nephroma': 2, 'malignant mesenchymoma of bone': 4, 'MSL BC': 1, 'cutaneous mesenchymal tumor': 9, 'mesenchymal benign tumor': 17, 'mesenchymal extraskeletal tumor': 1, 'mesenchymal tumor of the uterus': 7, 'tumor mesenchymal': 2, 'primary mesenchymal tumor of the liver': 2, 'fat containing mesenchymal tumor': 1, 'Malignant mesenchymoma of the pleura': 3, 'mesenchymal alteration': 1, 'uterus mesenchymal tumors': 1, 'uterine mesenchymal malignant tumors': 2, 'neurogenic mesenchymal tumors': 2, 'sinonasal phosphaturic mesenchymal tumor': 2, 'Sinonasal phosphaturic mesenchymal tumor': 2, 'sinonasal PMT': 3, 'benign gastric mesenchymal tumor': 2, 'malignant mesenchymal tumors of the submandibular and carotid triangle': 1, 'mesenchymal tissue tumors': 9, 'Intracranial phosphaturic mesenchymal tumor': 2, 'mesenchymal stem-': 8, 'Renal mesenchymal tumors': 10, 'RMTs': 3, 'RMT': 4, 'Malignant mesenchymoma of the stomach': 1, 'skin mesenchymal tumors': 2, 'fibroblastic differentiated mesenchymal tumor': 1, 'lowgrade mesenchymal tumor': 1, 'bone mesenchymal tumor': 1, 'mesenchymal injuries': 2, 'Mesenchymal tumors of the thyroid': 2, '-differentiated mesenchymal tumors': 1, 'Benign mesenchymal tumors of the spinal canal': 1, 'mesenchymal tumor RMS': 1, 'Gastrointestinal mesenchymal tumors': 14, 'Esophageal mesenchymal tumor': 2, 'primary malignant mesenchymal tumour': 2, 'Mesenchymal,': 1, 'PM': 1, 'sporadic mesenchymal tumor': 2, 'mesenchymal tumors of the jaws': 3, 'GIST mesenchymal tumors': 1, 'benign orbital mesenchymal tumor': 1, 'MSP': 4, 'PMT malignant tumors': 1, 'embryological mesenchymal developmental anomalies': 1, 'blastomatoid mesenchymal': 1, 'mediastinal mesenchymal tumors': 4, 'benign and malignant mesenchymal tumors of the mediastinum': 1, 'Mediastinal mesenchymal tumors': 1, 'mesenchymal and embryonal tumors': 1, 'mesenchymal perineal tumors': 1, 'palatal mesenchymal defects': 1, 'SSM': 3, 'mesenchymal injury': 8, 'atypical mesenchymal tumor of uncertain malignancy': 1, 'mesenchymal lesion of uncertain malignancy': 1, 'mesenchymal tumoral': 3, 'abnormality of mesenchyme': 1, 'meningothelial mesenchymal tumor': 1, 'mesenchymal dysfunction': 8, 'DIFFERENTIATION OF MESENCHYMAL': 1, 'benign mesenchymal tumor of the liver': 9, '-mesenchymal-': 1, 'gastrointestinal (GI) mesenchymal tumors': 5, 'malignant mixed mesenchymoma': 1, 'pseudocystic mesenchymal tumor': 3, 'Primary cranial Mesenchymal': 1, 'Uterine mesenchymal tumors': 16, 'Mes-GSC': 1, 'mesenchymal tumors of the thyroid': 2, 'gastric epithelioid mesenchymal tumor': 1, 'mesenchymal tissue disorders': 3, 'mesenchymal malignancy of the gastrointestinal tract': 1, 'POM': 5, 'epithelioid mesenchymal tumors': 10, 'systemic mesenchymal disease': 2, 'gonadal mesenchymal tumors': 1, 'mesenchymal abnormalities': 26, 'Combined mesenchymal tumors': 1, 'mesenchymal tumors of the liver': 6, 'mesenchyme defect': 1, 'MES tumor': 16, 'intramucosal mesenchymal tumor': 2, 'mesenchymal tumor of the ethmoid sinus': 1, 'Subepithelial mesenchymal tumors': 1, 'mesenchymal myxoid tumor': 8, 'Malignant Mesenchymal Tumors': 10, 'classical and mesenchymal tumors': 1, 'malignant mesenchymal lesion': 5, 'mesenchymal malignancy of the bladder': 6, 'MESENCHYME': 3, 'mesenchymal CRCs': 2, 'Malignant mesenchymomas': 7, 'hamartomatous mesenchymal tumor': 1, 'Mesenchymal benign tumors': 2, 'Malignant pure mesenchymal uterine tumours': 1, 'mesenchymal tumor of the cauda equina': 1, 'mesenchymal-like carcinoma': 7, 'MES glioma tumor': 1, 'MES glioma tumors': 1, 'mesenchymal and stromal tumor': 2, 'EndMT-related': 2, 'neural, endocrine, and mesenchymal tumors': 1, 'mesenchymal tumors of the appendix': 3, 'primary mesenchymal malignant tumor': 3, 'epithelial-mesenchymal or mesenchymal tumors': 1, 'mesenchymal gastrointestinal tumors': 9, 'tumor EndMT': 2, 'intracranial mesenchymal myxoid tumors': 1, 'primary intracranial mesenchymal tumors': 1, 'intracranial myxoid mesenchymal tumor': 18, 'primary intracranial mesenchymal tumor': 2, 'IMMT': 7, 'intracranial mesenchymal tumors': 8, 'intrathoracic mesenchymal tumor': 2, 'mesenchymal malignancy of': 1, 'hepatic nonvascular mesenchymal tumors': 1, 'mesenchymal subgroup of CRCs': 1, 'mesenchyme': 11, 'malignant mesenchymal disease': 1, 'pleural mesenchymal tumor': 1, 'mesenchymal disease': 21, 'retroperitoneal malignant mesenchymoma': 7, 'mesenchymal renal tumor': 11, 'mesenchymal sarcomagenesis': 1, 'developmental mesenchymal tumor': 1, 'epithelioid mesenchymal tumor': 4, 'MC': 3, 'mesenchymal tumor of esopahgus': 1, 'mesenchymal defect': 20, 'malignant mesenchymal tumor of the uterus': 7, 'Malignant mesenchymoma of the heart base': 1, 'Metastatic malignant mesenchymoma': 1, 'mesenchymal tumor of the tendon': 1, 'stromal/mesenchymal tumors': 2, 'ependymoma-like tumors with mesenchymal differentiation': 1, 'benign mesenchymal spindle tumor': 1, 'cutaneous mesenchymal lesions': 2, 'perifollicular mesenchymal tumors': 1, 'intracranial mesenchymal tumor': 23, 'MESENCHYMAL STROMAL': 2, 'Primary adrenal mesenchymal tumors': 3, 'mesenchymal benign tumors': 12, 'non-mesenchymal tumors': 19, 'pediatric mesenchymal tumors': 3, 'Rare Mesenchymal Tumors': 1, 'benign and malignant mesenchymal tumors': 19, 'malignant bone mesenchymoma': 1, 'Benign endobronchial mesenchymal tumors': 2, 'benign endobronchial mesenchymal tumors': 1, 'mesenchymal) tumors': 7, '(mesenchymal) tumors': 1, 'Mesenchymal orbital tumors': 1, 'inborn mesenchymal developmental error': 1, 'benign mesenchymal': 2, 'MS tumors': 1, 'MMT-95': 1, 'Malignant Mesenchymal Tumor 95': 1, 'mesenchymal developmental defects': 2, '-to-mesenchymal transformation': 3, 'Benign mesenchymal tumors': 28, 'mesenchymal gut tumors': 2, 'mesenchymal conjunctival tumor': 1, 'malignant mesenchymal tumor of': 2, 'Oral and maxillo-facial mesenchymal malignant neoplasms': 1, 'mesenchymal malignances': 1, 'benign mesenchymal lesions': 26, 'mesenchymal nonlipogenic tumor': 2, 'mesenchymal tissue deficiencies': 1, 'Primary cardiac malignant mesenchymal tumor': 1, 'mesenchymal carcinomas': 7, 'mesenchymal tumors of voluntary muscles': 1, 'mesenchymal or stromal tumors': 2, 'mesenchymal tissue cell tumor': 4, 'meningothelial mesenchymal tumors': 1, 'MES-like tumor': 8, 'Epithelioid mesenchymal tumors': 2, 'penile urethral mesenchymal tumor': 1, 'mineralising mesenchymal lesion': 1, 'mesenchymal stem-like': 4, 'Benign Hepatic Mesenchymal Hamrtoma': 1, 'mesenchymal jaw tumors': 1, 'ICM': 3, 'Endothelial to mesenchymal transformation': 1, 'mesenchymal non-meningothelial tumors': 9, 'undifferentiated mesenchymal tumors': 10, 'ENDOTHELIAL-MESENCHYMAL': 3, 'mesenchymal anomalies': 8, "mesenchymal origin's tumor": 1, 'endothelial mesenchymal transformation': 3, 'malignant mesenchymal tumor of the liver': 9, 'benign mesenchymal lesions of': 1, 'mesenchymal and sarcoma tumors': 2, 'mesenchymal tumor of umbilical cord': 1, 'GIMT': 5, 'Myxoid Mesenchymal Tumor of Infancy': 3, 'mesenchymal tumor of the middles fossa': 1, 'nonmeningothelial mesenchymal tumor of': 1, 'Small bowel mesenchymal tumors': 1, 'intra-abdominal malignant mesenchymoma': 2, 'mesenchymal superficial malignancy': 1, 'mesenchymal begin tumors': 1, 'Mesenchymal tumors of the small bowel': 1, 'or mesenchymal tumors': 1, 'tumors of mesenchymal': 6, 'mesenchymal types of tumors': 1, 'Uterine Mesenchymal Tumors': 4, 'Neural Mesenchymal Classical Tumor': 1, 'extratesticular mesenchymal tumors': 2, 'myxedematous mesenchymal tumor': 2, 'to mesenchymal transformation': 3, 'mesenchymal tumor of intermediate malignancy': 1, 'primary mesenchymal tumors': 15, 'malignant phosphaturic mesenchymal tumors': 1, 'malignant phosphaturic mesenchymal tumor': 2, 'benign stromal/mesenchymal tumor': 1, 'non-mesenchymal malignancies': 2, 'Orbital mesenchymal tumors': 1, 'Cutaneous mesenchymal tumors': 2, 'mesenchymal phosphaturic tumor': 2, 'mesenchymal syndrome': 4, 'malignant mesenchymal-like tumor of the bladder': 1, 'benign mesenchymal uterine tumors': 1, 'benign mixed mesenchymal tumor': 4, 'BMMT': 1, 'N-mesenchymal': 1, 'malignant mesenchymal tumor of the gastrointestinal (GI) tract': 1, 'adipose mesenchymal': 2, 'Mesenchymal Tumors Non-Mesenchymal Tumors': 1, 'cutaneous phosphaturic mesenchymal tumor': 1, 'Malignant mesenchymal tumors of the larynx': 6, 'maxillofacial malignant mesenchymal tumours': 1, 'mesenchymal type tumors': 8, 'gastric submucosal mesenchymal tumor': 1, 'and mesenchymal malignancies': 1, 'benign renal mesenchymal tumor': 5, 'fibro-osseous, and mesenchymal tumors': 1, 'NSM': 2, 'vascular / mesenchymal tumor': 1, 'mesenchymal tumors and': 1, '-mesenchymal tumor': 1, 'bowel mesenchymal tumors': 1, 'mesenchymal-CTC': 1, 'SM': 8, 'vascular and mesenchymal tumors': 4, 'mesenchymal tumor of the appendix': 1, 'mesenteric mesenchymal tumor': 3, 'Retroperitoneal Mesenchymal Tumors': 1, 'Retroperitoneal mesenchymal tumors': 1, 'and mesenchymal': 7, 'mesenchymal defects': 22, 'mesenchymal tissue disorder': 2, 'tumor of mesenchymal tissue': 1, 'Mesenchymal/nonmeningothelial tumors': 1, 'mesenchymal tumor of the liver': 17, 'benign mesenchymal malignancies': 1, 'RCCMalign mesenchymal tumor': 1, 'mesenchymal tumor of the dermis': 1, 'malignant spindle mesenchymal tumor': 1, 'intranodal mesenchymal tumor': 1, 'Malignant mesenchymal tumours': 6, 'benign mesenchymal tumor of the': 2, 'metanephric mesenchymal': 1, 'nontrophoblastic mesenchymal tumors of the placenta': 1, 'mesenchymal tumor of skin': 1, 'Thoracic mesenchymal malignant tumors': 2, 'UMT': 2, 'mesenchymal tumor NOS': 1, 'mesenchymal (MES) tumor': 1, 'non-lipogenic mesenchymal tumors': 1, 'biMs': 1, 'mesenchymal (and non-mesenchymal) tumors': 1, 'proliferative mesenchymal disorder': 1, 'PMT-': 1, 'PMT-MCTs': 1, 'mesenchymal and neuro-ectodermal tumors': 1, 'Non-Mesenchymal tumors': 1, 'mesenchymal dysplasias': 6, 'neural, classical, and mesenchymal': 1, 'MES-type': 2, 'mesenchymal tumor of uterus': 2, 'undifferentiated mesenchymal tumor': 8, 'Intracranial Myxoid Mesenchymal Tumor': 4, 'phosphaturic mesenchymal tumor in the': 1, 'Left atrial malignant mesenchymoma': 2, 'thigh mesenchymal tumor': 1, 'Pp': 1, 'Mesenchymal-like tumor': 2, 'Mesenchymal malignant tumor': 1, 'mesenchymal metastatic tumors': 2, 'Malign mesenchymal tumor': 3, 'idiopathic mesenchymal disorder': 1, 'Benign mesenchymal tumorsa': 1, 'mesenchymal and malignant lesions': 1, 'M-E': 1, 'aGastrointestinal mesenchymal tumors': 1, 'mesenchymal lesions of': 3, 'mesenchymal lesion of the': 2, 'benign mesenchymal and mixed tumors': 1, 'primary malignant mesenchymoma of the lung': 1, 'Primary malignant mesenchymoma of the lung': 1, 'Malignant Mesenchymoma': 4, 'Primitive mesenchymal tumor': 1, 'mesenchymal (group 2) tumors': 1, 'mesenchymal tumors of the retroperitoneum': 2, 'nasal mesenchymal tumor': 1, 'glial and mesenchymal tumors': 2, 'genital mesenchymal tumors': 5, '-mesenchymal interactive': 1, 'osteoblastic mesenchymal tumors': 2, 'Uterine malignant mesenchymoma': 1, 'MES-like (M) tumor': 1, 'mesenchymal diseases': 19, 'Mes tumors': 4, 'nonmuscular mesenchymal tumors': 1, 'nonmuscular mesenchymal malignant tumors': 1, 'nephrogenic mesenchyme': 1, 'Mes tumor': 5, 'malignant mesenchymal lesions': 5, 'Mesenchymal Tumors of the': 2, 'MS) tumor': 1, 'MESN tumor': 1, 'MESN': 1, 'genital stromal mesenchymal tumor': 1, 'mesenchymal and solid tumors': 2, 'mesenchymal and neural tumors': 4, 'Vascular and mesenchymal tumors': 1, 'Mesenchymal tumors of the gastrointestinal (GI)': 4, 'semi-malignant mesenchymal tumours': 1, 'mesenchymal tumors of uterus': 2, 'mesenchymal bone tumors': 5, 'mediastinal mesenchymal tumor': 4, 'Mesenchymal tumors of skin and': 1, 'Primary mesenchymal tumors of thyroid': 1, 'pediatric mesenchymal tumor': 1, 'MODIFICATION OF MESENCHYMAL': 1, 'mesenchymal thyroid tumors': 1, 'Malignant mesenchymal tumour': 5, 'malignant cutaneous mesenchymal tumors': 1, 'CMT': 1, 'primary cutaneous mesenchymal tumors': 1, 'esophageal mesenchymal tumors': 8, 'urothelial and mesenchymal': 1, 'mesenchymal neoplastic lesions': 1, 'urothelial and mesenchymal tumors': 1, 'intra-axial mesenchymal tumor of the CNS': 1, 'mesenchymal type tumor': 2, 'Primary mesenchymal tumors of the penis': 1, 'intraperitoneal mesenchymal tumors': 2, 'DM': 17, 'Primary mesenchymal tumors': 8, 'small bowel mesenchymal tumor': 3, 'mesenchymal and nonmesenchymal tumors': 3, 'Mesenchymal lesions of': 1, 'mesenchymal derived tumor of': 1, 'Uterine Mesenchymal Tumor': 4, 'mesenchymal and leiomyomatoid tumors': 1, 'uterine mesenchymal and vascular tumors': 1, 'C1/MES tumor': 1, 'Malignant mesenchymoma of the soft palate': 1, 'mesenchymal hepatic tumor': 5, 'MES-GBMs': 4, 'MES transformation': 1, 'SEM-': 1, 'SEM': 3, 'benign unclassified mesenchymal tumor': 1, 'mSTCs': 1, 'thoracic mesenchymal malignant tumors': 1, 'primary mesenchymal orbital tumor': 1, 'endocardial mesenchymal tumors': 2, 'malignant mesenchymal tumor of liver': 1, 'phosphaturic mesenchymal tumor of the foot': 1, 'melanocytic, and mesenchymal tumors': 1, 'Mesenchymal Lesions': 3, 'MES/CL tumors': 2, 'MES/CL': 1, 'neural and mesenchymal tumors': 4, 'mesenchymal proliferative lesions': 4, 'mesenchymal originated malignant tumor': 1, 'Undifferentiated mesenchymal tumors': 2, 'CMS4 mesenchymal tumors': 5, 'Stem/Serrated/Mesenchymal': 1, 'hepatic mesenchymal tumors': 11, 'Hepatic mesenchymal tumors': 3, 'malignant hepatic mesenchymal tumors': 1, 'caudate mesenchymal tumors': 1, 'solid mesenchymal tumors': 2, 'mesenchymal cervical tumor': 1, 'DEFINITION OF MESENCHYMAL': 1, 'LBM': 6, 'mesenchymal malignant tumour': 5, 'urinary mesenchymal tissue tumor': 2, 'mesenchymal tumors of small': 1, 'mesenchymal malignancies of the gastrointestinal tract': 2, 'Phosphaturic Mesenchymal tumors': 1, 'luminal (basal and mesenchymal) tumors': 1, 'MESENCHYMAL CELL': 4, 'lipofibrovascular mesenchymal tumor-like mass': 1, 'non-vascular benign mesenchymal tumors': 1, 'liver malignant mesenchymoma': 1, 'duodenal mesenchymal tumor': 2, 'aggressive mesenchymal tumors': 2, 'PMC': 1, 'Primitive myxoid mesenchymal tumor of infancy': 9, 'MEMTs': 1, 'mesenchymal or embryonal tumors': 2, 'mesenchymal nonmeningothelial tumor': 3, 'dermal and subcutaneous mesenchymal tumor': 1, 'intracranial myxoid mesenchymal tumors': 12, 'phospaturic mesenchymal tumor': 2, 'PMT-MCT': 1, 'mesenchymal subepithelial tumor': 2, 'malignant mesenchymal hepatic tumor': 1, 'Malignant mesenchymal tumors of the uterine corpus': 1, 'benign mesenchymal liver tumor': 2, 'mesenchymal extraskeletal malignant tumors': 1, '-MSL': 1, 'benign proliferative mesenchymal lesion': 1, 'Mesenchymal myofibroblastic': 1, 'Primary malignant mesenchymal tumors of the liver': 1, 'malignant mesenchymoma of the pleura': 1, 'intrathoracic or intracranial mesenchymal tumor': 1, 'malignant mesenchymal pulmonary tumor': 1, 'benign mesenchymal diseases': 2, 'non-endothelial mesenchymal tumors': 2, 'non-endothelial mesenchymal and lymphohematopoietic tumors': 2, 'nonendothelial mesenchymal tumors': 1, 'EMPs': 2, 'malignant neuroectodermal, mesenchymal, epithelioid, or melanocytic tumor': 1, 'vaginal mesenchymal malignancy': 1, 'vaginal mesenchymal tumors': 1, 'Malignant mesenchymal vaginal tumor': 1, 'mesenchymal vaginal tumor': 1, 'vaginal malignant mesenchymal tumor': 1, 'Gastric mixed mesenchymal tumors': 1, 'adenocarcino-mesenchymal tumors': 1, 'spinal myxoid mesenchymal tumor': 1, 'spinal extramedullary myxoid mesenchymal tumor': 1, 'mesenchymal esophageal tumors': 1, 'atrial malignant mesenchymoma': 2, 'benign mesenchymal mammary tumor': 1, 'malignant mesenchymoma) of bone': 1, 'primary malignant mesenchymoma of bone': 5, 'Primary malignant mesenchymoma of bone': 5, 'cutaneous and subcutaneous mesenchymal tumors': 1, 'Malignant mesenchymal tumors of the vulva': 1, 'Primary renal mesenchymal tumors': 1, 'Malignant mesenchymal kidney tumors': 1, 'Malignant mesenchymal tumours of the corpus uteri': 1, 'Metanephric Mesenchymal': 1, 'Benign mesenchymal tissue': 1, 'mesenchymal differentiated tumors': 1, 'mesenchymal neoplasma': 3, 'glial and mesenchymal tumor': 2, 'adrenergic and mesenchymal tumors': 1, 'Adrenergic and mesenchymal tumors': 1, 'mesenchymal, non-meningothelial tumor grade III': 1, 'fibroblastic mesenchymal tumor': 11, 'malignant mesenchymal uterine tumours': 2, 'MES-specific': 1, 'digestive mesenchymal tumors': 5, 'mesenchymal and vascular dysplasia': 1, 'uterine myxoid mesenchymal tumors': 1, 'Benign gastric mesenchymal tumors': 1, 'mesenchymal tumor of the foot pad': 1, 'mesenchymal-derived malignancies': 3, 'mesenchymal invasion': 1, 'Primary malignant mesenchymoma of the heart': 2, 'mesenchymal neoplastic lesion': 3, 'mesenchymal-like': 11, 'mesenchymal origin tumor': 6, '-Mes': 1, 'Mes GSCs': 1, 'mesenchymal tumors of the conjunctiva and caruncle': 1, 'mesenchymal mesenteric tumor': 1, 'malignant mesenchymal tumors of the': 3, 'and mesenchymal tumors': 6, 'Mesenchymal tumors of the pancreas': 7, 'mesenchymal tumors of the pancreas': 3, 'mesenchymal-derived tumor': 9, 'meCAF': 1, 'multicentric mesenchymal tumors': 1, 'Combined mesenchymal sarcoma and carcinoma': 1, 'Esophageal mesenchymal tumors': 2, 'Mesenchymal Malignant Tumour': 1, 'proneural and mesenchymal tumor': 1, 'benign GI mesenchymal tumors': 1, 'mesenchymal lesions of the gut': 1, 'Benign mesenchymal tumors of the uterus': 1, 'proneural and mesenchymal tumors': 2, 'mesenchyme-lineage tumors': 1, 'malignant mesenchymoma of the tunica vaginalis': 1, 'upper gastrointestinal mesenchymal tumors': 2, 'mesenchymal myofibroblastic tumor': 1, '-mesenchymal transient': 1, 'MODULATION OF MESENCHYMAL': 1, 'Mesenchymal, nonmeningothelial tumors': 2, "'mesenchymal' tumor": 1, 'tissue mesenchymal lesions': 1, 'congenital mesenchymal disorder': 1, 'spinal PMT': 2, 'spinal PMTs': 2, 'Vasculogenic Mesenchymal Tumor': 2, 'vasculogenic mesenchymal tumors': 1, 'vasculogenic mesenchymal tumor': 3, 'mesenchymal-type tumor': 3, 'Non-Mesenchymal Tumors': 1, 'Mesenchymal non-meningothelial tumors': 6, 'Rare Mesenchymal Tumor': 1, 'Mesenchymal/': 1, 'Mesenchymal maldevelopment': 1, 'mesenchymal pediatric tumor': 2, 'SIOP-MMT': 2, 'Complex mesenchymal dysplasia': 1, 'primary mesenchymal malignancy': 1, 'mesenchymal intrapulmonary tumors': 1, 'mesenchymal or neurogenic tumor': 1, 'qM carcinoma': 1, 'qM': 1, 'qM carcinomas': 1, 'qM tumors': 1, 'primitive myxoid mesenchymal tumor of infancy': 6, 'mesenchymal-like CRCs': 1, 'common mesenchymal tumor': 3, 'PMTs of the pelvis': 1, 'Malignant phosphaturic mesenchymal tumor of the pelvis': 1, 'pelvic PMT': 1, 'mixed mesenchymal tumors': 2, 'MES)': 2, 'CL+ME': 2, 'mesenchymal tumor of the jaw': 1, 'digestive tract mesenchymal tumors': 2, 'malignant mesenchymal, neurogenic': 1, 'mesenchymal GBMs': 3, 'serrated mesenchymal tumors': 2, 'LMPs': 4, 'nonneural mesenchymal tumors': 1, 'Mesenchymal nonneural tumors': 1, 'ossifying mesenchymal tumor of': 1, 'necrotic mesenchymal tumors': 2, 'congenital mesenchymal renal tumors': 1, 'mesenchymal malignant uterine tumors': 1, 'stromal or mesenchymal tumor': 1, 'proliferative mesenchymal lesion': 5, 'primary mesenchymal tumors of the pancreas': 5, 'malignant pancreatic mesenchymal tumors': 1, 'Primary mesenchymal tumors of the pancreas': 7, 'IM': 2, 'submucosal mesenchymal tumor': 8, 'Malignant mesenchymal lesion': 2, 'neurogenic, endocrine, and mesenchymal tumors': 2, 'thoracic mesenchymal tumor': 1, 'Sinonasal Phosphaturic Mesenchymal Tumor': 1, 'Mesenchymal Dysplasiaand': 1, 'hepatic mesenchymal cell tumor': 1, 'mesenchymal tumors within the pancreas': 1, 'mammary mesenchymal tumors': 1, 'mesenchymal circulating tumor': 2, 'skin or mesenchymal tumors': 1, 'malignant mesenchymoma of the brain': 1, 'Malignant mesenchymoma of the brain': 1, 'MIE': 1, 'MTC': 2, 'uterine malignant mesenchymal tumors': 6, 'mesenchymal glioma tumor': 1, 'undifferentiated uterine mesenchymal malignancy': 1, 'differentiated mesenchymal tumor': 2, 'differentiated mesenchymal tumor': 1, 'Mesenchymal diseases': 1, 'malignant mesenchymoma of the mediastinum': 1, 'Malignant mesenchymoma of the right retroperitoneum': 1, 'benign mesenchymal tumors and lesions': 1, 'Visceral mesenchymal tumors': 1, 'MSC': 3, 'mesenchymal-origin malignancies': 1, 'Mesenchymal carcinoma': 3, 'mesenchymal benign tumor of the colon': 1, 'mesenchymal tumorlet': 1, 'mesenchymal tumors of the cornea': 1, 'N PMT': 1, 'malignant PMT': 2, 'Embryonal and non-meningothelial mesenchymal tumors': 1, 'embryonal and mesenchymal non-meningothelial tumors': 1, 'non-meningothelial mesenchymal tumors': 5, 'embryonal and non-meningothelial mesenchymal tumors': 1, 'Embryonal and non-meningothelial mesenchymal tumors of the': 1, 'mesenchymal or sarcoma-like tumors': 2, 'mesenchymal bone tumor': 6, 'mesenchymal or neuro-ectodermal tumors': 1, 'liver mesenchymal tumors': 4, 'Malignant mesenchymoma of the esophagus': 2, 'mesenchymal or nonmesenchymal tumors': 1, 'mesenchymal neoplastic disease': 1, 'neoplastic mesenchymal disease': 1, 'sinonasal phosphaturic mesenchymal tumors': 1, 'neural, classical and mesenchymal tumors': 1, 'Malignant mesenchymal tumors of genitourinary tract': 1, 'subglottic mesenchymal tumors': 1, 'paratesticular malignant mesenchymal tumor': 1, 'duodenal mesenchymal tumors': 3, 'malignant mesenchymal origin tumor': 1, 'basal and mesenchymal-like tumors': 1, 'MONITOR MESENCHYMAL': 1, 'ADIPOSE MESENCHYMAL': 1, 'ACTIVITY OF MESENCHYMAL STROMAL': 1, 'mesenchymal and lymphoid tumors': 3, 'mesenchymal harmatomas': 2, 'Myxoid mesenchymal tumor': 2, 'mesenchymal tumor of the orbit': 2, 'Primary intraabdominal malignant mesenchymal tumors': 1, ', and Mesenchymal tumors': 1, 'Primary bronchopulmonary mesenchymal tumors': 1, 'Mes-': 1, 'mesenchymal tumors.42': 1, 'epiMT': 1, 'malignant mesenchymal tumours of the digestive tract': 1, 'mesenchymal tumors of bone': 4, 'mesenchyme and ectoderm malformations': 1, 'ductal and mesenchymal malignancies': 1, 'malignant mesenchymoma of the bladder': 2, 'mesenchymal lung tumors': 2, 'mesenchymal deficiency': 5, 'mesenchymal pelvic tumor': 1, 'non-mesenchymal malignant tumors': 4, 'mesenchymal subtype tumors': 1, 'mesenchymal tumor hypoglycemia': 2, 'Mesenchymal stromal tumor': 1, 'Primary mesenchymal tumors of penis': 1, 'MLIA': 3, 'mesenchymal malignant tumours': 11, 'mesenchymal-based tumors': 2, 'uterine mesenchymal malignancies': 4, 'mesenchymal and mixed (mesenchymal and epithelial) tumors': 1, 'OTHER MESENCHYMAL DISEASES': 1, 'neural and mesenchymal tumor': 1, 'mesenchymal tumor': 1, 'malignant mesenchymal-derived tumor': 1, 'Mixed mesenchymal tumor': 1, 'mixed mesenchymal tumor': 3, 'FATE SPECIFICATION OF MESENCHYMAL': 1, 'gastrointestinal mesenchymal origin tumor': 1, 'AS MESENCHYMAL STEM/': 1, 'Malignant mesenchymal tumors of the kidney': 1, 'mesenchymal foreskin tumor': 1, 'CASE OF MESENCHYMAL DYSTROPHY': 1, 'Benign Mesenchymal Sinonasal Tumors': 1, 'benign mesenchymal sinonasal tumors': 1, 'benign submucosal mesenchymal tumor': 1, 'malignant mesenchymoma of the maxilla': 1, 'benign or mesenchymal tumors': 1, 'Primary malignant mesenchymal tumors': 3, 'Mayo MES': 1, 'UCSD MES': 1, 'giant malignant mesenchymoma of the liver': 1, 'Malignant mesenchymoma of mediastinum': 1, 'SIOP MMT': 1, 'malignant PMTs': 1, 'Malignant PMTs': 1, 'benign PMTs': 1, 'splenic mesenchymal tumors': 2, 'benign mesenchymal tumors of': 4, 'left atrial malignant mesenchymoma': 1, 'Primary malignant mesenchymoma': 1, 'mesenchymal tumor type': 1, 'mesenchymal stem like': 1, 'Primary Cutaneous Epithelioid Mesenchymal Tumor': 1, 'primary cutaneous epithelioid mesenchymal tumor': 1, 'mesenchymal tumour of intermediate (borderline) malignancy': 1, 'and mesenchymal rhabdomyosarcomatous': 1, 'non-mesenchymal lesions': 1, 'fat cell mesenchymal tumors': 1, 's-MPs': 1, 'PMT lesion': 2, 'rhinopharyngeal vault PMT': 1, 'mesenchymal stem cell-derived malignancies': 1, 'IMT': 4, 'mesenchymal and secondary tumors': 1, 'SIOP Mesenchymal Malignant Tumors': 1, 'QM': 6, 'Mesenchymal tumors of': 7, 'mesenchymal chondrosarcoma5': 1, 'benign PMT': 1, 'Myxoid Mesenchymal Tumors of the Uterus': 1, 'malignant mesenchymal tumors of the CNS': 1, 'mesenchymal sarcoma-like tumors': 1, 'cardiac malignant mesenchymoma': 1, 'primary malignant mesenchymoma': 1, 'UMT types': 1, 'Corpus uteri mesenchymal tumors': 1, 'UMT lesions': 1, 'UMT type': 1, 'mesenchymal myxoid tumor of infancy': 2, 'Primitive mesenchymal myxoid tumor of infancy': 1, 'mesenchymal, non-meningothelial tumors': 5, 'mesenchymal and non-mesenchymal epithelioid neoplasms': 1, 'malignant mediastinal mesenchymoma': 2, 'bone mesenchymal tumors': 1, 'mesenchymal and non-mesenchymal neoplasms': 3, 'polypoid mesenchymal tumor': 1, 'mesenchymal and ectodermal tumors': 1, 'malignant mesenchymoma of the spermatic cord': 2, 'laryngeal mesenchymal malignancies': 1, 'carcinomatous mesenchymal tumor': 1, 'ectopic endocardial mesenchymal transformation': 1, 'malignant mesenchymal tumour of the liver': 1, 'mesenchymal cutaneous lesions': 1, 'MULTIPOTENCY OF MESENCHYMAL': 1, 'Mesenchymal anal and perianal tumors': 1, 'Benign mesenchymal anal tumors': 1, 'Superficial Mesenchymal Tumors': 1, 'malignant mesenchymal tumors of the skin': 1, 'Malignant superficial mesenchymal tumors': 1, 'superficial mesenchymal tumors': 2, 'malignant superficial mesenchymal tumors': 1, 'Malignant Superficial Mesenchymal Tumors': 1, 'pulmonary mesenchymal tumor': 4, 'mesenchymal pathologic': 1, 'Mesenchymal tumor hypoglycemia': 1, 'intrahepatic mesenchymal tumor': 1, 'Mesenchymal vulvar tumors': 1, 'mesenchymal serrated"': 1, 'mesenchymal-cell tumor': 1, 'mesenchymal monoclonal tumor': 1, 'primary retroperitoneal mesenchymal tumor': 1, 'primary mesenchymal malignancies': 3, 'extraskeletal mesenchymal tumors': 1, 'classical (CL) and mesenchymal (MS) tumors': 1, 'Malignant mesenchymoma of the kidney': 2, 'vulvo-vaginal mesenchymal myxoid tumor': 1, 'Primary malignant mesenchymal tumors of kidney': 1, 'mesenchymal malignancies of': 2, "PMT's": 1, 'OMT': 2, 'Proliferative or Mesenchymal disease': 1, 'subcutaneous mesenchymal tumors': 2, 'mesenchymal tumor of skeletal muscle': 1, 'subepithelial mesenchymal tumors': 3, 'mesenchymal and nonmeningothelial tumors': 3, 'Congenital mesenchymal tumors': 1, 'Malignant mesenchymoma of the bladder': 1, 'Malignant phosphaturic mesenchymal tumor': 2, 'mesenchymal orbital tumor': 3, 'intraneural mesenchymal tumors': 1, 'Mesenchymal tumors in the': 1, 'nodular mesenchymal tumor': 1, 'mesenchymal tumors of skin and': 2, 'mesenchymal and nonmesenchymal lesions': 1, 'cartilage-forming mesenchymal tumor': 2, 'Malignant mesenchymal tumors of female genitalia': 1, 'mesenchymal tumors with necrosis': 1, 'purely mesenchymal tumor of the uterus': 1, 'Mesenchymal tumor of the liver': 1, 'infiltrating hybrid mesenchymal tumor of skeletal muscle': 1, 'Infiltrating hybrid mesenchymal tumor of skeletal muscle': 1, 'Malignant mesenchymoma of pleura': 1, 'primary mesenchymal tumors of the liver': 1, 'cartilage-containing mesenchymal tumor': 1, 'mesenchymitis': 1, 'soft-tissue mesenchymal malignancies': 1, 'benign mesenchymal-derived tumors': 1, 'mesenchymal gastrointestinal malignancy': 1, 'retroperitoneal mesenchymal tumor': 2, 'Atypical mesenchymal tumor': 1, 'Fibroblastic mesenchymal tumors': 1, 'congenital mesenchymal anomalies': 3, 'Benign mesenchymal lesions': 1, 'Benign mesenchymal lesion': 5, 'Malignant mesenchymal lesions': 2, 'mesenchymal congenital anomaly': 1, 'non-vascular mesenchymal tumors': 4, 'nonvascular mesenchymal tumors': 3, 'mesenchymal malignancy of bone': 2, 'inflammatory mesenchymal': 1, 'IMS': 1, 'benign mesenchymal tumors of the uterus': 2, 'malignant mesenchymoma of the': 1, 'malignant mesenchymoma) of the fibula': 1, 'extrathyroidal malignant mesenchymal tumours': 1, 'thyroid mesenchymal tumor': 1, 'mesenchymal tumors of the thyroid gland': 3, 'malignant thyroid mesenchymal tumours': 1, 'Malignant thyroid mesenchymal tumours': 1, 'mesenchymal chrondrosarcoma': 1, 'SIOP Malignant Mesenchymal Tumor': 1, 'benign mesenchymal tumor of the uterus': 2, 'Longeveron allogenic mesenchymal': 1, 'Mesenchymal Extratesticular Tumors': 1, 'Sarcomatous mesenchymal tumor': 1, 'benign, differentiated mesenchymal tumors': 1, 'Metastatic mesenchymal tumor': 1, 'Metastate Mesenchymal Metastate Metastate': 1, 'rickets-associated mesenchymal tumors': 1, 'Mesenchymal tumor Lipoma': 1, 'metastatic mesenchymal tumor': 1, 'Mesenchymal/metastatic carcinoma': 1, 'TMCs': 1, 'malign mesenchymal tumour': 2, 'Uterine Myxoid Mesenchymal Tumors': 1, 'myxoid uterine mesenchymal tumors': 4, 'benign and intermediate mesenchymal tumors': 1, 'non-neurogenic mesenchymal tumors': 1, 'oral cavity mesenchymal tumors': 2, 'Malignant mesenchymal liver tumors': 1, 'benign and malignant mesenchymal tumours': 4, 'malignant mesenchymoma of the small intestine': 2, 'non-mesenchymal malignant tumours': 2, 'primary mesenchymal tumors of the colon': 1, 'Primary mesenchymal tumors of the colon': 1, 'mesenchymal_tumor': 1, 'Tumor of the mesenchyme': 1, 'Thoracic mesenchymal tumor': 1, 'benign esophageal mesenchymal tumors': 1, 'mesenchymal cell malignancy': 1, 'Primary mesenchymal adrenal tumors': 1, 'mesenchymal extraskeletal malignancies': 3, 'Congenital malignant mesenchymoma of the face': 1, 'epithelioid mesenchymal malignancies': 2, 'EndoMA': 1, '-MSCs': 1, 'non-rhabdomyosarcoma mesenchymal tumors': 1, 'mesenchymal liver malignancy': 1, 'Mesenchymal and Neuroectodermal Malignant Tumors': 1, 'mesenchymal non-melanocytic tumors': 1, 'intraventricular intracranial mesenchymal tumor': 1, 'primary lung mesenchymal tumor': 1, 'lipogenic mesenchymal tumors': 1, 'and mesenchymal liver tumors': 1, 'mesenchymal non-endothelial tumors': 1, 'dysfunction of Cajal mesenchymal': 1, 'pulmonary mesenchymal malformation': 1, 'malignant mesenchymal-cell tumors': 1, 'mesenchymal harmatoma': 3, 'Mesenchymal harmatoma': 1, 'Primary Intracranial Mesenchymal Tumor': 1, 'mesenchymal ectoderm': 1, 'primary and secondary mesenchymal tumors': 1, 'MES-GB': 1, 'dermal mesenchymal malignancy': 2, 'orbital mesenchymal tumor': 2, 'orbital mesenchymal tumors': 1, 'mesenchymal polypoid lesions': 1, 'benign mesangial mesenchymal tumor': 1, 'Mesenchymal and Non-meningothelial Tumors': 1, 'mesenchymal tumor of the bone': 2, 'Retroperitoneal malignant mesenchymoma': 7, 'benign uterine mesenchymal tumors': 2, 'phosphaturic mesenchymal tumor,': 2, 'endothelial-mesenchymal transformation': 3, 'nonmesenchymal and mesenchymal tumors': 1, 'CHARACTERIZATION OF MESENCHYMAL': 1, 'rare mesenchymal tumors': 3, 'Mesenchymal Circulating Tumor': 1, 'malignant mesenchymal tumor of bone': 1, 'mesenchymal malignant primary tumor': 1, 'benign differentiated mesenchymal tumors': 1, 'GSC-MES': 2, 'MES-GSC90': 1, 'mesenchymal nonmeningothelial" tumor': 1, 'malignant mesenchymal cell tumor': 3, 'Mesenchymal defects': 2, 'mesenchymal osteoblastic tumor': 2, 'vascular-mesenchymal overgrowth': 3, 'Retroperitoneal Malignant Mesenchymoma': 1, 'mesenchymal mixed tumor': 2, 'Mesenchymal Mixed Tumor': 1, 'primary retroperitoneal malignant mesenchymoma': 1, 'non-neural mesenchymal tumors': 1, 'Malignant Vascular Mesenchymal Tumors': 1, 'malignant vascular mesenchymal tumor': 1, 'Mesenchymal malignant tumorsLeiomyosarcomaFollicular': 1, 'Malignant mesenchymoma of the mesocolon': 1, 'Cardiac malignant mesenchymoma': 1, 'plemorphic mesenchymal tumors': 1, 'Osseous PMTs': 1, 'Benign mesenchymal tumors of the abdomen': 1, 'Intracranial phosphaturic mesenchymal tumors': 2, 'neural, mesenchymal': 1, ', mesenchymal': 1, 'phosophaturic mesenchymal tumor': 1, 'liver mesenchymal tumor': 2, 'adipocytic mesenchymal tumors': 2, 'adipocytic mesenchymal tumor': 2, 'benign mesenchymal cutaneous tumor': 1, 'Endothelial-to-mesenchymal transformation': 1, 'adult mesenchymal tumors': 2, 'malignant mesenchymal spindle cell tumor': 1, 'mesenchymal nonepithelial retroperitoneal tumors': 1, 'Mesenchymal, non-meningiothelial tumors': 1, 'benign dermal mesenchymal tumors': 1, 'malignant mesenchymal tissue tumor': 1, 'Malignant Mesenchymal Tumours': 1, 'mesenchymal tumors in the pancreas': 1, '-mesenchymal tumors': 2, 'mesenchymal (MES) tumors': 2, 'primary mesenchymal tumors of the orbit': 1, 'benign mesenchymal renal tumor': 3, 'Renal Mesenchymal Tumor': 3, 'mesenchymal or biphasic tumors': 1, 'mesenchymal thoracic tumor': 3, 'Mesenchymal and neurogenic esophageal tumors': 1, 'GTM': 1, 'mesenchymal) tumor': 1, 'ME-like': 1, 'mesenchymal malignomas': 1, 'MetM': 1, 'mesenchymal spindle tumor': 1, 'anaplastic mesenchymal tumor': 1, 'mesenchymal and histiocytic tumors': 1, 'mesenchymal cells tumors': 1, 'adipose mesenchymal tumor': 2, 'gastrointesitinal and peripheral mesenchymal tumors': 1, 'non-gastrointestinal mesenchymal tumors': 1, 'Primitive Myxoid Mesenchymal Tumor of Infancy': 4, 'esophageal mesenchymal tumor': 5, 'mesenchymal chondroid dermal tumors': 1, 'mesenchymal renal tumors': 8, 'Benign mesenchymal renal tumors': 2, 'non-reproductive mesenchymal tumors': 1, 'non-lymphoid mesenchymal malignancies': 1, 'Primary malignant mesenchymoma of the bone': 1, 'MTL': 1, 'benign mesenchymal tumors of the': 1, 'mesenchymal and cartilaginous malignancy': 1, 'mesenchymal CTC': 5, 'primary renal mesenchymal tumor': 1, 'mesenchymal-type carcinomas': 2, 'Mes-like': 2, 'Mes-like tumors': 1, 'mesenchymal tumor of the pelvis and perineum': 3, 'MES-like Malignant': 1, 'congenital mesenchymal malformation': 1, 'stromal and mesenchymal lesions': 2, 'Luminal and mesenchymal-': 1, 'QM tumors': 3, 'mesenchymal and mixed tumors': 2, 'Malignant mesenchymoma in the scrotum': 1, 'mesenchymal and': 2, 'and mesenchymal tumor': 3, 'Proliferative and Mesenchymal tumors': 1, 'Gnathic Bony and Mesenchymal Tumors': 1, 'Mesenchymal Dysplasia': 2, 'Malignant perirenal mesenchymoma': 1, 'Mesenchymal chondronsarcoma': 1, 'phosphaturic mesenchymal tumor of the femur': 2, 'mesenchymal condition': 1, 'Mesenchymal tissue tumor': 3, 'malignant mesenchymal bone tumor': 1, 'malignant mesenchymal tumor of the left mandible': 1, 'EMS': 1, 'malignant mesenchymal tumor of the bone': 1, 'mesenchymal tumors of the eyelids': 1, 'phosphaturic mesenchymal lung tumor': 1, 'malformation of the MM': 1, 'TUMORS OF MESENCHYMAL ORIGIN': 1, 'gonadal-mesenchymal tumors': 1, 'primitive myoid mesenchymal tumor of infancy': 1, 'PHOTOINITIATION OF MESENCHYMAL': 1, 'malignancy of mesenchyme': 1, 'laryngeal mesenchymal malignancy': 1, 'Mesenchymal (MES) tumors': 1, 'MCTC': 3, 'primary myxoid mesenchymal tumor of': 1, 'Mesenchymal Tumors of the Pancreas': 1, 'Malignant gastric mesenchymal tumor': 1, 'Submucosal mesenchymal tumors of': 1, 'submucosal mesenchymal tumor of': 1, 'benign mesenchymal tumors of the gastrointestinal system': 1, 'fibrogenic mesenchymal tumor': 1, 'extracranial mesenchymal anomalies': 1, 'mesenchymal (sarcoma) tumor': 1, 'extragastric mesenchymal tumor': 1, 'Malignant mesenchymoma of median nerve': 1, 'Mesenchymal tumors of the pelvis and abdomen': 1, 'Primary Pulmonary Mesenchymal Tumors': 1, 'benign mesenchymal tumor of the lung': 1, 'giant pelvic mesenchymal tumor': 1, 'Mesenchymal Tumors Lesions': 1, 'intermediate mesenchymal tumors': 1, 'biphasic mesenchymal malignancy': 1, 'Mesenchymal tumors of pancreas': 1, 'mesenchymal tumor of the gastrointestinal': 1, 'benign and malignant mesenchymal tumors of': 1, 'mesenchymal tumors of the gastrointestinal (': 1, 'primary mesenchymal malignancy of liver': 1, 'mesenchymal tumorspheres': 1, 'Malignant mesenchymal tumors of kidney': 1, 'perivascular and mesenchymal tumors': 2, 'intranasal mesenchymal tumors': 1, 'Mesenchymal syndromes': 1, 'Mesenchymal malignant tumors': 3, 'mesenchymal neometaplasia': 1, 'mesenchymal-like carcinomas': 1, 'vasculo-mesenchymal malformations': 1, 'Malignant mesenchymal renal tumor': 1, 'Malignant mesenchymal masses': 1, 'Malignant Mesenchymal Renal Tumor': 1, 'Primary malignant mesenchymal renal masses': 1, 'DISCOVERED MESENCHYMAL': 1, 'epithelioid mesenchymal tumor of the palate': 1, 'epidermal, melanocytic, adnexal, and mesenchymal tumors': 1, 'mesenchymal-type carcinoma': 2, 'mesenchymal and mesenchymal/stem-like': 1, 'mesenchymal subtype carcinoma': 1, 'Non-lymphoid mesenchymal tumor': 1, 'fibroblastic mesenchymal tumors': 4, 'primary malignant mesenchymal tumour of the liver': 2, 'intestine Malignant Mesenchymoma': 1, 'intramural mesenchymal tumor': 1, 'HGM': 1, 'IDENTIFICATION OF MESENCHYMAL': 1, 'MES GSCs': 2, 'hemorrhagic mesenchymal tumors': 1, 'ME GBMs': 1, 'synovial mesenchymal or lymphatic malignancies': 1, 'epithelioid benign and malignant mesenchymal tumors': 1, 'MESImm': 1, 'uterine mesenchymal benign tumors': 1, 'Intracranial_mesenchymal_tumors': 2, 'Intracranial mesenchymal tumors': 3, 'mesenchymal malignancies.1': 1, 'malignant mesenchymal tumours of the': 1, 'mixed phosphaturic mesenchymal tumor': 1, 'mesenchymal and proliferative tumors': 2, 'AMSCs malignancy': 1, 'mesenchymal tumor of the pancreas': 3, 'mesenchymal malignancies of bone and soft tissue': 1, 'ISM': 2, 'mesenchymal-associated': 1, 'MATS': 1, 'malignant mesenchymal uterine tumors': 2, 'undifferentiated/mesenchymal-like tumors': 1, 'mesenchymal tumors of the small bowel': 1, 'lymphoid and mesenchymal tumors': 1, 'M-GBM tumor': 1, 'stromal and mesenchymal tumors': 3, 'mesenchymal or stromal lesions': 1, 'Malignant mesenchymoma of the spermatic cord': 4, 'Malignant mesenchymal': 1, 'Submucosal mesenchymal tumor': 1, 'SMT': 1, 'Pediatric mesenchymal tumors': 2, 'Malignant mesenchymoma of the mediastinum': 1, 'MESENCHYMAL DISEASES': 1, 'Malignant mesenchymoma of the liver': 3, 'MET': 3, 'mesenchymal, non-meningothelial tumor': 2, 'Abdominopelvic Mesenchymal Tumors': 2, 'mesenchymal tumor malignancy': 2, 'adipose-derived mesenchymal tumor': 1, 'primitive mesenchymal tumor': 2, 'malignant uterine mesenchymal tumours': 1, 'astrocytic and mesenchymal tumors': 2, 'mesenchymal, lymphoid, and melanocytic tumors': 1, 'Phosphaturic mesenchymal tumor of spinal nerve': 1, 'phosphaturic mesenchymal tumor of the left femur': 1, 'phopshaturic mesenchymal tumor': 1, 'primary mesenchymal (endothelial) hepatic tumors': 1, 'Phosphaturic mesenchymal tumor of the nasal cavity': 1, 'phosphaturic mesenchymal tumor of bone': 2, 'ecto-mesenchymal': 1, 'GIE-MES tumors': 1, 'Nonepithelial or mesenchymal tumors': 1, 'malignant mesenchymal tumors of the PPR': 1, 'undifferentiated malignant mesenchymoma': 1, 'endothelial-to-mesenchymal transformation': 2, 'appendiceal malignant mesenchymal tumors': 1, 'GBM mesenchymal tumors': 1, 'EFFECT OF ALLOGENEIC MESENCHYMAL': 1, 'myxoid benign mesenchymal tumors': 1, 'Malignant mesenchymal tumors of the uterus': 3, 'mesenchymal primary malignancies': 1, 'Mesenchymal tissue malignancies': 1, 'mesenchymal origin diseases': 1, 'mesonephric mesenchymal hypoplasia': 1, 'malignant mesenchymal tissue sarcoma': 2, 'mesenchymal regional tumor': 1, 'gastric mesenchymal tissue tumor': 1, 'mesenchymal or connective tumors': 1, 'mesenchymal, non-meningiothelial tumors': 1, 'dermal mesenchymal tumors': 3, 'malign mesenchymal tumors': 2, 'Mesenchymal Malignancies': 1, 'vascular mesenchymal tumors': 3, 'mesenchymal non-meningothelial" tumor': 2, 'mesenchymal metaplastic carcinoma': 1, 'PCM': 2, '-DM': 1, 'sexual cord mesenchymal tumors': 1, 'benign pleomorphic mesenchymal tumors': 1, 'mesenchymal and melanocytic tumors': 1, 'mesenchymal osteogenesis': 1, 'Mesenchymal tumors of the scrotum': 1, 'primary mesenchymal deficiency': 1, 'basal/mesenchymal tumorspheres': 1, 'gastrointestinal mesenchymal malignancies': 1, 'ON MESENCHYMAL': 1, 'Paratesticular malignant mesenchymoma': 1, 'cartilage forming mesenchymal tumors': 1, 'mesenchymal mediastinal tumors': 1, 'digestive mesenchymal malignancy': 1, 'PMT-OF': 1, 'PMT OF': 1, 'Mes carcinoma': 2, 'MESENCHYMAL STEM': 4, 'Mesenchymal-like CTC': 1, 'intrascrotal mesenchymal tumors': 1, 'vascular mesenchymal malignancy': 1, 'Malignant mesenchymoma of the mandible': 3, 'phosphaturic mesenchymal tumor of the jaws': 1, 'phosphate mesenchymal tumors': 1, 'urinary mesenchymal tumor': 3, 'Mesenchymal necrosis': 1, 'mesenchymal-only carcinoma': 1, 'Vasculogenic mesenchymal tumor': 1, 'VMT': 2, 'benign phosphaturic mesenchymal tumor': 1, 'non-mesenchymal tumor': 3, 'melanocytic but not mesenchymal tumors': 1, 'MULTIPLE MALIGNANT MESENCHYMAL': 1, 'LGG.Mesenchymal': 1, 'mesenchymal malignancies of the bone': 1, 'benign mesenchymal submucosal tumors of the': 1, 'Mesenchymal tumors of the appendix': 4, 'melanocytic or mesenchymal tumors': 1, 'DME': 1, 'Intermandibular malignant mesenchymoma': 1, 'mesenchymal and neuroepithelial malignancies': 1, 'Mesenchymal and neurogenic tumors': 1, '/mesenchymal permeability impairment': 1, 'paratesticular mesenchymal tumors': 1, 'paratesticular mesenchymal tumor': 1, 'Paratesticular Mesenchymal Malignancies': 1, '-human mesenchymal': 1, 'mesenchymal uterine malignancy': 1, 'Spinal PMTs': 1, 'mesenchymal and proneural tumors': 2, 'phosphaturic mesenchymal tumor of the pelvis': 1, 'translocation associated mesenchymal tumors': 1, 'primary laryngeal malignant mesenchymoma': 1, 'Malignant mesenchymoma of the larynx': 1, 'mesenchymal 20': 1, 'Mesenchymal 20': 1, 'Malignant mesenchymoma of the medial facial': 1, 'mesenchymal malignant tumors of the pharynx': 1, 'Mesenchymal Tissue Tumors': 1, 'Mesenchymal Malignancy': 1, 'Mesenchymal chondrosarcoama': 1, 'malignant mesenchymal cell tumor of the liver': 1, 'GI tract mesenchymal tumors': 1, 'malignant retroperitoneal mesenchymal tumor': 1, 'mesenchymal cutaneous tumors': 1, 'benign mesenchymal cell tumors': 1, 'Mesenchyme': 1, 'developmental disorder of mesenchymal': 1, 'primitive mesenchymal myxoid tumor': 1, 'mesenchymal tumors of the gastrointestinal system': 1, 'malign mesenchymal tumor': 6, 'mesenchymal or haematological malignancies': 1, 'tissue mesenchymal tumors': 2, 'MES-SN': 1, 'Mesenchymal stem-like': 1, 'Malignant mesenchymal tumor of': 1, 'Malignant mesenchymoma of the small intestine': 1, 'MAT': 2, 'mesenchymal deficiencies': 1, 'Cervical node Malignant mesenchymal tumor': 1, 'PN-MSC': 1, 'Primary malignant mesenchymal tumours': 1, 'mesenchymal/invasive tumors': 1, 'Malignant uterine mesenchymal tumour': 1, 'uterine and extrauterine mesenchymal tumors': 1, 'primary paratesticular mesenchymal tumors': 1, 'Primary paratesticular mesenchymal tumors': 1, 'MES neoplastic': 1, 'mesenchyme defects': 1, 'Malignant mesenchymoma of spermatic cord': 1, 'mesenchymal gut lesions': 1, 'NMTs': 1, 'solid mesenchymal tumor': 1, 'mesenchymal gynecological malignancies': 1, 'atrial mesenchymal tumors': 2, 'atrial mesenchymal tumor': 1, 'Pectoral Malignant Mesenchymoma': 1, 'primary mesenchymal tumors of the': 1, 'mesenchymal, osteoid, and bone-forming tumor': 1, 'mesenchymal remodelling': 2, 'fibroosseous and mesenchymal tumors': 1, 'detrusor mesenchymal tumors': 1, 'childhood mesenchymal tumor': 1, 'mesenchymal-ness': 1, 'CLASSICAL MESENCHYMAL': 1, 'mesenchymal skin tumor': 5, 'diaphragmatic mesenchymal tumor': 1, 'vulvar mesenchymal tumors': 2, 'Endothelial mesenchymal transformation': 1, 'mesenchymal and angiogenetic dysplasia': 1, 'gastric mesenchymal malignancy': 1, 'Malignant mesenchymoma of the lung': 1, 'gastric and small bowel mesenchymal tumors': 1, 'gastric benign mesenchymal tumors': 1, 'GMTs': 3, 'benign cutaneous mesenchymal lesion': 4, 'digestive tract mesenchymal tumor': 2, 'Maxillary malignant mesenchymoma': 1, 'mesenchymal overgrowth tumors': 1, 'Pure mesenchymal tumors': 2, 'Primary mesenchymal tumors of the thyroid gland': 1, 'Primary Mesenchymal Tumors of the Thyroid Gland': 1, 'Thyroid mesenchymal tumors': 1, 'thyroid mesenchymal tumors': 2, '-Mesenchymal': 5, 'borderline mesenchymal tumors': 1, 'mesenchymal and stromal tumors': 6, 'intraabdominal mesenchymal tumor': 1, 'Me': 2, 'Mesenchymal Condrosarcoma': 1, 'mesenchymal/metastatic carcinoma': 1, 'mesenchymal hepatic tumors': 1, 'Gastrointestinal (GI) mesenchymal tumors': 2, 'MCMD': 1, 'Malignant mesenchymoma of the left atrium': 1, 'Malignant mesenchymoma of the heart': 3, 'primary malignant mesenchymoma of the heart': 1, 'mesenchymal edematous lesions': 1, 'cutaneous mesenchymal lesion': 1, 'mesenchymal-originated tumors': 2, 'Mesenchymal - lipoma': 1, 'Endothelial-mesenchymal transformation': 1, 'intramural mesenchymal tumors': 5, 'Mesenchymal uterine tumor': 1, 'urinary mesenchymal tumors': 1, 'M/MSL': 1, 'basal and mesenchymal tumor': 2, 'laryngeal PMT': 1, 'mesenchymal tumors arising': 1, 'Mesenchymal malignant tumors of the thyroid': 1, 'Mesenchymal invasion': 1, 'EM': 1, 'malignant mesenchymoma of soft tissue': 1, 'mesenchymal GI lesions': 1, 'mesenchymal tumor lesions': 3, 'Non-endothelial mesenchymal tumors': 1, 'spinal mesenchymal tumors': 1, 'omental mesenchymal tumors': 2, 'stiff mesenchymal tumors': 1, 'soft mesenchymal tumors': 2, 'mesenchymal Mullerian malignant tumor': 2, 'MMMT': 3, 'AMT': 1, 'tract mesenchymal tumors': 1, 'mesenchymal or embryonic tumors': 1, 'mGBM tumors': 1, 'Malignant mesenchymoma of mesenteric localization': 1, 'spindle and mesenchymal tumors': 1, 'undifferentiated mesenchymal malignancy': 2, 'Malignant mesenchymomas of soft tissue': 1, 'MT': 2, 'benign mesenchymal tumor arising': 1, 'CRMP': 1, 'adult mesenchymal malignancies': 2, 'spindle mesenchymal tumors': 2, 'spindle mesenchymal tumor': 3, 'Epithelia-mesenchymal': 1, 'mesenchymal proliferative disorders': 2, 'C1.MES tumors': 1, 'circulating mesenchymal tumor': 1, 'mesenchymal (M) tumors': 1, 'mesenchymal and biphasic malignancies': 2, 'mesenchymal malignant': 1, 'myocardial mesenchyme': 1, 'mesenchymal benign or malignant tumours': 1, 'CNS and mesenchymal tumors': 1, 'mesenchymal tumor perforation': 1, 'mesenchymal malignancies of the orbit': 1, 'tumors of mesenchyme': 2, 'dermal mesenchymal tumor': 4, 'aggressive mesenchymal tumor': 1, 'malignant mesenchymal chondroblasts': 1, 'benign mesenchymal adipose tumors': 1, 'IAMT': 1, 'Implant-associated mesenchymal tumors': 1, 'implant-associated mesenchymal tumors': 1, 'benign ossifying mesenchymal tumor of bone': 1, 'benign ossifying mesenchymal tumor of the bone': 1, '-mesenchymal) origin tumors': 2, 'myxoid/mesenchymal tumors of infancy': 1, 'Mesenchymal uterine tumors': 3, 'extrapancreatic mesenchymal tumors': 1, 'CMS4-mesenchymal tumors': 1, 'malignant mesenchymal tumors of soft tissue or bone': 1, 'Mesenchymal dysplasias': 1, 'mesenchymal malignancy of the uterus': 1, 'Malignant mesenchymoma of ulnar nerve': 1, 'mesenchymal malignancy of bone or soft tissue': 1, 'malignant mesenchymal tumors of the liver': 1, 'mesenchymal chodrosarcoma': 1, 'primary malignant liver mesenchymal tumor': 1, 'Primary malignant liver mesenchymal tumor': 1, 'mesenchymal system tumor': 1, 'malignant mesenchymal tumors of the uterus': 6, 'primary mesenchymal tumor of': 1, '-mesenchymal-transformation': 1, 'omental mesenchymal tumor': 1, 'congenital hemangiolymphatic mesenchymal malformation syndrome': 1, 'dermal malignant mesenchymal tumor': 1, 'malignant mesenchymal tumor of the kidneys': 1, 'Malignant metastatic mesenchymoma': 1, 'Mesenchymal syndrome': 1, 'Primary congenital malignant mesenchymoma of the eyelid': 1, 'osseous mesenchymal tumors': 1, 'Malignant mediastinal mesenchymoma': 2, 'mesenchymal-derived malignant tumors': 1, 'malignancy of mesenchymal GBM': 1, 'cutaneous mesenchymal tumors': 10, 'congenital mesenchymal pathology': 1, 'embryologic and mesenchymal dysplasia': 1, 'mKIC': 1, 'Phosphaturic mesenchymal tumor of ethmoid sinus': 1, 'inflammatory or mesenchymal lesions': 1, 'Malignant mesenchymal liver tumours': 1, 'mesenchymal lesions of the': 1, 'Mesenchymal tumors of the gut': 1, 'additional malignant mesenchymal': 1, 'submucosal mesenchymal lesions': 1, 'Mesenchymal tumor of the pancreas': 1, 'Malignant mesenchymal tumors of the gallbladder': 1, 'nephroblastic and mesenchymal tumors': 1, 'neurectodermal or mesenchymal tumors': 1, 'phospathaturic mesenchymal tumor': 1, 'Mesenchymal tumors of the liver': 7, 'fibroblastic mesenchymal skin tumor': 1, 'USE OF MESENCHYMAL': 2, 'Phosphaturic mesenchymal tumor of the tibia': 1, 'malignant mesenchymal tumors of the skin and soft tissue': 1, 'Miscellaneous mesenchymal tumors': 1, '-to-mesenchymal': 1, 'PMT lesions': 1, 'benign or malignant mesenchymal tumor': 2, 'Epithelioid mesenchymal malignancies': 1, 'primary mesenchymal tumors of': 1, 'adrenal mesenchymal tumors': 1, 'adrenal mesenchymal tumor': 1, 'MOLECULAR PARTICLE THEORY OF MESENCHYMAL': 1, 'tumors of mesenchymal tissue': 1, 'fibromyxoid mesenchymal tumor': 2, 'Mesenchyme-related Tumors': 1, 'mesenchyme-related tumors': 1, 'mesenchymal inflammatory': 1, 'MES-type tumors': 1, 'Infantile malignant mesenchymoma': 1, 'intraabdominal malignant mesenchymal tumors': 1, 'vascularized mesenchymal tumor': 1, 'mesenchymal or neurocristic tumors': 1, 'OM': 2, 'mesenchymal malignant tumors of': 1, 'intraabdominal mesenchymal tumors': 3, 'nonsynovial sarcoma mesenchymal tumors': 1, 'Malignant mesenchymoma of the thyroid': 1, 'Primary malignant mesenchymoma of the thyroid': 1, 'superficial mesenchymal tumor': 2, 'Malignant mesenchymoma of the uterus': 1, 'MM defects': 1, 'ENDOTHELIAL TO MESENCHYMAL': 1, 'sinonasal mesenchymal tumor': 1, 'intramucosal mesenchymal tumors': 1, 'MTAC': 1, 'nonepithelial mesenchymal tumors of': 1, 'TBM': 1, 'MesS tumor': 1, 'MesS': 1, 'MesS tumors': 1, 'MesS.': 1, 'benign mesenchymal liver tumors': 1, 'Nonendocrine mesenchymal tumors': 1, 'and Mesenchymal Tumors': 1, 'mesenchymal tumors of the bone': 1, 'mesenchymal adipose tumors': 1, 'muscle malignant mesenchymal tumors': 1, 'MesCC': 1, 'PERICYTE-MESENCHYMAL': 1, 'primary mesenchymal malignancy of the gastrointestinal tract': 1, 'mesenchymal and non-mesenchymal malignancies': 1, 'malignant mesenchymal tumors of the uterine body': 1, 'Uterine Benign Mesenchymal Tumors': 1, 'endMT defects': 1, 'mesenchymal and neurogenic tumors': 2, 'Tumor EndMT': 1, 'Mesenchymal Ischaemia': 1, 'mesenchymal malignancies,9': 1, 'MES GSCS': 1, 'mesenchymal tumors in the gastrointestinal': 1, "Dominici's mesenchymal tumor": 1, 'MALIGNANT MESENCHYMOMA': 1, 'SIOP malignant mesenchymal tumor': 1, 'Endothelial-mesenchymal': 1, 'mesenchymal tumor of malignancy': 1, 'ME 1': 1, 'congenital mesenchymal tumors': 1, 'mesenchymal, ependymal and Schwann cell tumors': 1, 'benign and malignant mesenchymoma': 1, 'luminal mesenchymal': 1, 'Mesenchymal abnormality': 1, 'Vascular mesenchymal tumors': 1, 'mesenchymal tumors of the uterine corpus': 2, 'carcinoma-associated mesenchymal': 1, 'mesenchymal tumors of the gastrointestinal (GI)': 3, 'cutaneous, mesenchymal, renal': 1, 'Mesenchymal tumors Carcinoma': 1, 'adipose mesenchymal tumors': 1, 'Malignant mesenchymal tumors of the penis': 1, 'Mesenchymal-': 2, 'embryonal and mesenchymal tumors': 1, 'mesenchymal neoplasmata': 1, 'penile mesenchymal tumor': 1, 'primary pulmonary mesenchymal tumors': 1, 'malignant mesenchymal skin tumors': 1, 'Pulmonary Malignant Mesenchymal Tumors': 1, 'PPMMTs': 1, 'primary pulmonary malignant mesenchymal tumors': 1, 'Primary malignant mesenchymal lung tumors': 1, 'Primary Pulmonary Malignant Mesenchymal Tumors': 1, 'pulmonary malignant mesenchymal tumors': 1, 'Primary pulmonary malignant mesenchymal tumors': 1, 'uterine malignant mesenchymal tumor': 4, 'Mesenchymal deficiency': 1, 'MESENCHYMAL CELL SPECIFICATION': 1, 'and pleomorphic mesenchymal tumors': 1, 'mesenchymal tumors of the orbit': 1, 'primary mesenchymal tumor of the orbit': 2, 'endometrial and mesenchymal malignancies': 1, 'mesenchyme disorder': 1, 'mesenchyme disease': 1, 'cervicovaginal mesenchymal abnormalities': 1, 'anomaly of the pulmonary mesenchyme': 1, 'GI mesenchymal malignancies': 2, 'primary pulmonary mesenchymal tumor': 1, 'Basal and Mesenchymal tumors': 1, 'Mesenchymal proliferative lesion': 1, 'Mesenchymal and proliferative tumors': 1, 'mesenchymal and embryonic tumors': 1, 'MESENCHYMAL-LIKE': 1, 'mesenchymal and lymphohistiocytic lung tumor': 1, 'retroperitoneal malignant mesenchymal tumor': 1, 'mesenchymal tumor of the thyroid gland': 1, 'mesenchymal tumors of upper': 1, 'mesenchymal tumors in the': 1, 'neural, and mesenchymal tumors': 1, 'mGSC': 1, 'Occipital mesenchymal tumors': 1, 'hypervascular mesenchymal tumor': 1, 'mesenchymal mixed tumor of the liver': 1, 'mesenchymal-type malignancy': 1, 'primary myxoid mesenchymal tumor of infancy': 1, 'pancreas and mesenchymal tumor': 1, 'Primary pulmonary mesenchymal tumors': 2, 'mesenchymal" tumors': 1, 'mesenchymal and lymphohistiocytic tumors': 1, 'Primary hepatic mesenchymal tumors': 1, 'DENTAL MESENCHYMAL': 1, 'Metaplastic carcinoma with mesenchymal differentiation': 1, 'mesenchymal or': 1, 'tumor mesenchymal': 1, 'mesenchymal myxoid tumors': 2, 'gynecological mesenchymal malignancy': 1, 'mesenchymalized tumors': 1, 'mesenchymalized carcinoma': 1, 'epidermal and mesenchymal tumors': 1, 'mesenchymal large-cellymphoma': 1, 'cutaneous and subcutaneous mesenchymal malignancies': 1, 'mesenchymal tumor of the mandible': 1, 'mesenchymal soft-part tumors': 1, 'mesenchymal metastatic tumors in the pancreas': 1, 'mesenchymal tumor of orbit': 1, 'mesenchymal orbital tumors': 1, 'cutaneous (myo) fibroblastic mesenchymal tumors': 1, 'cutaneous (myo)fibroblastic mesenchymal tumors': 1, 'mesenchymal/non-mesenchymal tumors': 1, 'tubular mesenchymal injury': 1, 'mesenchymal vascular abnormalities': 1, 'Mesenchymal and Proliferative tumors': 1, 'mesenchymal,': 1, 'epithelioid mesenchymal tumors of the uterus': 3, 'mesenchymal tumor of the gastric antrum': 1, 'mesenchymal-associated diseases': 1, 'malignant mesenchymal tumor of the': 1, 'primary malignant mesenchymal tumors of the pancreas': 1, 'malignant mesenchymal tumor of the pelvic cavity': 1, 'uterine and nonuterine mesenchymal tumors': 1, 'Pseudoneoplastic Mesenchymal Lesions': 1, 'mesenchymal necrosis': 2, 'Anaplastic malignant mesenchymoma of the kidney': 1, 'anaplastic malignant mesenchymoma': 1, 'Infantile mesenchymal tumors': 1, 'neurogenic or mesenchymal tumors': 1, 'neurogenic or mesenchymal origin tumors': 1, 'mesenchymal submucosal tumors': 1, 'mesenchymal region lesions': 1, 'GIMTS': 1, 'gastric malignant mesenchymomas': 1, 'mesenchymal tumorspecific': 1, 'Canine malignant mesenchymomas': 1, 'hepatic malignant mesenchymoma': 2, 'nephrogenic mesenchymal defect': 1, 'MES) tumor': 1, 'primary mesenchymal tumor of the bone': 1, 'hepatic malignant mesenchymal tumor': 1, 'LMS5-mesenchymal tumors': 1, 'mesenchymal dysplasia syndrome': 1, 'benign mesenchymal tumor of the orbit': 1, 'intraabdominal nonepithelial (mesenchymal) tumors': 1, 'tumors of mesenchymal tissues': 1, 'sarcomatous phosphaturic mesenchymal tumor': 1, 'MES-GSC': 1, 'Lung Mesenchymal Malignant Transformation': 1, 'epithelioid type mesenchymal tumor': 1, 'Mixed mesenchymal tumors of the uterus': 1, 'ectopic mesenchymal': 1, 'nephroblastic, mesenchymal and metanephric tumors': 1, 'mesenchymal tumors specific to the lung': 1, 'Malignant mesenchymal tumor of the sacrum': 1, 'Mesenchymal Tumor Harboring': 1, 'Malignant mesenchymomas of the small intestine': 1, 'lympho- and mesenchymal-proliferative disorders': 1, 'Primary mesenchymal tumors of the liver': 2, 'localized mesenchymal tumor': 2, 'mesenchymal proliferative disease': 1, 'p5 mesenchymal abnormality': 1, 'Mesenchymal abnormalities': 2, 'malignant, mesenchymal tumours': 1, 'mesenchymal lesions tumors': 1, 'gastrointestinal, mesenteric, or omental mesenchymal tumor': 1, 'EndMT defect': 1, 'mesenchymal and vascular disorders': 1, 'Thoracic phosphaturic mesenchymal tumors': 1, 'phosphaturic mesenchymal tumors of the spine': 1, 'nonpancreatic mesenchymal tumors': 1, 'Mesenchymal gastric tumor': 1, 'ectodermal and mesenchymal abnormalities': 1, 'Diseases of the mesenchyme': 1, 'fibrous mesenchymal tumors': 3, 'ENRICHED MESENCHYMAL CELL POPULATION': 1, 'non-lymphoid mesenchymal tumors': 1, 'nonlymphoid mesenchymal tumors': 2, 'Pulmonary primary mesenchymal tumors': 1, 'pulmonary primary mesenchymal tumor': 1, 'Epithelioid Mesenchymal Tumors': 1, 'MMS': 2, 'skin mesenchymal tumor': 1, 'sarcomatoid/mesenchymal-type tumors': 1, 'mesenchymal tumors of adipose': 2, 'primary malignant mixed mesenchymal tumour of the heart': 1, 'Primary malignant mixed mesenchymal tumour of the heart': 1, 'malignant mesenchymoma of the esophagus': 2, 'MES/BSL': 1, 'mesenchymal and angiogenetic disorder': 1, 'BENIGN MESENCHYMAL GASTRIC TUMOR': 1, 'benign or malignant mesenchymal tumors': 3, 'mesenchymal tumors of the lung': 1, 'mesenchymal HCCs': 1, 'mesenchymal sheath': 1, 'dysreactive mesenchymal diseases': 1, 'benign mesenchymal tissue-originated tumor': 1, 'Esophageal Mesenchymal Tumors': 1, 'CL/ME': 1, 'embryonal mesenchymal tumor of': 1, 'mesenchymal chondsarcoma': 1, 'Micropapillary Mesenchymal tumors': 1, 'Lymphoid and mesenchymal tumors': 1, 'Mesenchymal, non-meningothelial tumors of the': 1, 'Phosphaturic Mesenchymal Tumor of the Ankle': 1, 'phosphaturic mesenchymal tumor of the ankle': 1, 'sexual cord-mesenchymal tumor': 1, 'uterine mesenchymal malignancy': 2, 'ME) 2': 1, '-standing mesenchymal lesion': 1, 'rhino-sinusal mesenchymal tumor': 1, 'Primary malignant mesenchymal tumour of the liver': 1, 'esophageal mesenchymal originating tumor': 1, 'Malignant pancreatic mesenchymal tumors': 1, 'Primary mesenchymal tumor of the pancreas': 1, 'soft tissue mesenchymal malignancies': 1, 'tissue mesenchymal malignancies': 1, 'Malignant mesenchymoma of the cervix': 1, 'uterine mesenchymal stromal tumors': 1, 'benign mesenchymal gastric tumor': 2, 'mesenchymal tumors of the perineum': 1, 'benign mesenchymal disease': 1, 'paratesticular malignant mesenchymoma': 1, 'Malignant mesenchymoma of the scrotum': 1, 'Primary malignant mesenchymal tumours of the greater omentum': 1, 'Uterine corporeal mesenchymal tumors': 1, 'mesenchymal tumors of the uterine': 1, 'uterine corporeal mesenchymal tumors': 1, 'benign mesenchymal tumors of the lungs': 1, 'benign from malignant mesenchymal tumors': 1, 'Benign Mesenchymal Tumors': 1, 'extra-renal (mesenchymal) tumors': 1, 'Mesenchymal liver tumors': 1, 'Myxoid Mesenchymal tumors': 1, 'MB': 1, 'osteogenic mesenchymal tumor': 1, 'and Mesenchymal': 1, 'intramuscular mesenchymal tumor of': 1, 'mesenchymal mammary tumors': 1, 'extragastric mesenchymal tumors': 1, 'Extragastric mesenchymal tumors': 1, 'ENDOTHELIAL-TO-MESENCHYMAL': 1, 'Primary mesenchymal liver tumors': 2, 'Malignant mesodermal (mesenchymal) tumors of bladder': 1, 'lung, gastrointestinal and mesenchymal tumors': 1, 'Thyroid mesenchymal and stromal tumors': 1, 'gastrointestinal mesenchymal tumors of': 1, 'uterine mesenchymal and mixed epithelial/mesenchymal tumors': 1, 'uterine pure mesenchymal and mixed epithelial/mesenchymal tumors': 1, 'mesenchymal micro tumors': 1, 'subepithelial mesenchymal tumors of': 1, 'MTICs': 1, 'MTIC': 1, 'mesenchymal-origin tumor': 2, 'mesenchymal malignant tumor of the liver': 1, 'mesenchymal liposarcomatous tumors of the uterine corpus': 1, 'Malignant mesenchymoma of the lower leg': 1, 'malignant mesenchymoma of the lower leg': 1, 'mixed and mesenchymal tumors of the mucosa': 1, 'malignant mesenchymal tumors of the small intestine': 1, 'nasal malignant mesenchymoma': 1, 'mesenchymal lesion of': 1, 'Mesenchymal Tumors of the Pelvis': 1, 'neuro-ectodermal and mesenchymal tumors': 1, 'MESENCHYMAL STROMAL CELL DEPLETION': 1, 'malignant mesenchymal tumors of soft tissues': 1, 'mullerian mesenchymal malignant tumours': 1, 'mesenchymal mullerian malignant tumour': 1, 'Mixed mesenchymal malignant tumours': 1, 'mesenchymal extra-axial tumors': 1, 'mesenchymal overgrowth': 1, 'malignant mesenchymal tumors of uterus': 1, 'MMTUs': 1, 'Mesenchymal Carcinoma': 1, 'Multiple congenital mesenchymal tumors': 1, 'and mesenchymal urothelial carcinoma': 1, 'malignant mesenchymal tumors of the parotid gland': 1, 'intraluminal mesenchymal tumor': 1, 'PN MES': 1, 'mesenchymal and mesenchymal stem-like tumors': 1, 'pediatric mesenchymal malignancy': 1, 'Naso-Ethmoidal Phosphaturic Mesenchymal Tumor': 1, 'neural or mesenchymal': 1, 'malignant mesenchymoma of the chest wall': 1, 'Malignant mesenchymoma of the chest wall': 1, 'Mesenchymal and neurilemmal tumors': 1, 'mesenchymal primary tumor': 1, 'embryologic mesenchymal disorder': 1, 'mesenchymal and basal tumors': 1, 'mesenchymal proliferative tumors': 1, 'mesenchymal vulvar tumors': 1, 'mesenchymal tumor,1': 1, 'RM': 3, 'HARM': 1, 'lung-specific mesenchymal tumors': 1, 'Endo-MT': 1, 'Tumors of the Non-Meningothelial Mesenchyme': 1, 'mesenchyme abnormalities': 1, 'gastric mesenchymal cell tumors': 1, 'Gastric mesenchymal cell tumors': 1, 'Mesenchymal Malignant Tumor': 1, 'non-chondroid mesenchymal tumors': 1, 'malignant odontogenic mesenchymal lesions': 1, 'dural-based mesenchymal tumors': 2, 'Mesenchymal heterology': 1, 'malignant mesenchymoma of lung': 1, 'malignant mesenchymomas of lung': 1, 'embryonal mesenchymal tumors': 1, 'mesenchymal (': 1, 'mesenchymal hepatitis': 1, 'mesenchymal and biphasic tumors': 1, 'extra-renal mesenchymal tumors': 1, 'haematological and mesenchymal malignancies': 1, 'heterologous mesenchymal': 1, 'MCHMD (2)': 1, 'metaplastic carcinoma with heterologous mesenchymal differentiation': 1, 'MCHMD': 1, 'MCHMD E+': 1, 'non-mesenchymal diffuse carcinoma': 1, 'MAE': 1, 'cutaneous and mesenchymal tumors': 1, 'benign or malignant mesenchymoma': 1, 'visceral mesenchymal tumors': 1, 'Intra-abdominal mesenchymal tumors': 1, 'Gastric mesenchymal tumor': 2, 'mesenchymal malignancy of the bone': 1, 'Mesenchymal Lesions of': 1, 'malignant mesenchymoma of the diaphragm': 1, 'Malignant mesenchymoma of the orbit': 1, 'malignant orbital mesenchymoma': 1, 'malignant mesenchymoma of the orbit': 1, 'Mixed mesenchymal tumor of the retroperitoneum': 1, 'malignancy of mesenchymal tissues': 1, 'urogenital mesenchymal tumors': 1, 'Myxoid mesenchymal tumor of infancy': 1, 'Malignant mesenchymoma of the lesser epiploon': 1, 'mesenchymal fibrous tumors': 1, 'mesenchymal non-meningothelial malignant tumor': 1, 'benign mesenchymal myxoid tumor': 1, 'renal MM': 1, 'Mesenchymal Patient': 1, 'Mesenchymal Patient 1': 1, 'MES)-': 1, 'Malignant mesenchymoma of kidney and': 1, 'Mesenchymal Tumors of': 1, 'mesenchymal cutaneous and subcutaneous tumor': 1, 'Malignant mesenchymal tumors of the female genital tract': 1, 'primary mesenchymal': 1, 'mesenchymal-derived malignancy': 1, 'mesenchymal" (Lund Infiltrated) tumors': 1, 'primary indolent mesenchymal tumor of the testis': 1, 'intrathoracic mesenchymal malignancy': 1, 'Tumors with mesenchymal': 1, 'mesenchymal classified tumors': 1, 'Malignant mesenchymal brain tumor': 1, 'malignant mesenchymal brain tumor': 1, 'primary malignant mesenchymoma of the bone': 1, 'mesenchymal developmental defect': 1, 'Mesenchymal skin tumors': 1, 'mesenchymal gastrointestinal tumor': 1, 'IMT intracranial mesenchymal tumor': 1, 'malignant mesenchymal tumors of cartilage': 1, 'GI mesenchymal lesions': 1, 'Mesenchymal-like': 1, 'Mesenchymal Stromal Overgrowth': 1, 'Malignant phosphaturic mesenchymal tumors': 1, 'genital stromal mesenchymal tumors': 1, 'embryonal mesenchymal tumor of the lung and': 1, 'hepatic mesenchymal epithelioid tumors': 1, 'gastrointestinal (GI) mesenchymal tumor': 1, 'posterior mediastinal mesenchymal tumor': 1, 'MSP-RAS': 1, 'mesenchymal lipoma': 1, 'ML tumors': 1, 'Mesenchymal tumor of the gallbladder': 1, 'Benign mesenchymal tumors of the gallbladder': 1, 'mesenchymal malignancies of soft tissue and bone': 1, 'mesenchymal skeletal tumors': 1, 'mesenchymal myofibroblastic lesion': 1, 'mesenchymal like tumors': 1, 'mesenchymal tumor of the lung': 1, 'benign mesenchymal subepithelial tumors': 1, 'phosphaturic mesenchymal tumor of the fibula': 1, 'tumor-associated mesenchymal': 1, 'malignant mesenchymal cell tumors': 1, 'phosphaturic mesenchymal tumor mixed': 1, 'mesenchymal vaginal tumors': 1, 'undifferentiated malignant mesenchymal sarcoma': 1, 'mesenchymal neoplasm.1': 1, 'malignant cardiac mesenchymoma': 1, 'Haematopoietic or Mesenchymal Tumourigenesis': 1, 'malignancies of mesenchymal tissue': 1, 'intracranial mesenchymal myxoid tumor': 1, 'MF': 1, 'benign mesenchymal tumors of the gastrointestinal': 1, 'MES Tumor': 1, 'epithelial-mesenchymal gastric tumor': 1, 'Malignant mesenchymoma of the buttock': 1, 'non-phosphaturic mesenchymal tumors': 1, 'Mesenchymal tumors of the thyroid gland': 1, 'atypical mesenchymal tumor': 1, 'Primary intra-abdominal malignant mesenchymal tumours': 1, 'mesenchymal neoplastic': 1, 'mesenchymal sarcomaat1.5': 1, 'dedifferentiated malignant mesenchymal tumor': 1, 'malignant mesenchymal and neurogenic tumors': 1, 'PMTs in the': 1, 'jaw PMTs': 1, 'jaw phosphaturic mesenchymal tumors': 1, 'Jaw phosphaturic mesenchymal tumors': 1, 'tissue PMTs': 1, 'malignant mesenchymal and neurogenic tumours': 1, 'AM': 1, 'Msc': 1, 'proliferative or mesenchymal tumors': 1, 'proliferative and mesenchymal tumors': 2, 'basal and mesenchymal mammary malignancies': 1, 'benign mesenchymal tumors of the skeletal muscles': 1, 'Skeletal muscle Mesenchymal tumor': 1, 'uterine mesenchymal (i.e. myometrial) tumors': 1, 'IMMUNOSUPPRESSIVE PROPERTIES OF MESENCHYMAL': 1, 'fibular mesenchymal tumor': 1, 'lympho-reticular and mesenchymal malignancies': 1, 'neurogenic or fibrous or mesenchymal tumor': 1, 'EXPANDED MESENCHYMAL': 1, 'mesenchymal-derived benign tumors': 1, 'mesenchymal and metanephric lesions': 1, 'phosphaturic mesenchymal tumor of the craniofacial sinuses': 1, 'benign mesenchymal tumor of the trachea': 1, 'mesenchymal tumor not otherwise specified': 1, 'Gl mesenchymal tumor': 1, 'mesenchymal-cell tumors': 1, 'malignant mesenchymal lesions of the skin': 1, 'benign proliferative mesenchymal lesions': 1, 'Malignant mesenchymal nephroma of infancy': 1, 'malignant mesenchymal soft tissue tumor': 1, 'MTs': 1, 'Mesenchymal 2': 1, 'myxoid mesenchymal uterine tumors': 1, 'sellar mesenchymal and stromal tumors': 1, 'Mesenchymal CTC': 1, 'hMM': 1, 'Hypophosphaturic mesenchymal tumor of the ethmoid': 1, 'hypophosphaturic mesenchymal tumor of the ethmoid': 1, 'epithelioid and mesenchymal tumors': 1, 'musculoaponeurotic mesenchymal origin tumors': 1, 'and mesenchymal subtype tumors': 1, 'mesenchymal subtype': 1, 'mesenchymal origin malignancies': 1, 'Malignant mesenchymoma arising from': 1, 'malignant mesenchymoma arising from': 1, 'mesenchymal tumorsJuvenile': 1, 'FNCLCC mesenchymal tumor': 1, 'Uterine epithelioid mesenchymal tumors': 1, 'MM positional abnormalities': 1, 'tumor MES': 1, 'mesenchymal CHSs': 1, 'mesenchymal) lesions': 1, 'myxoid mesenchymal tumor of the pelvis and perineum': 1, 'polypoid mesenchymal lesions': 1, 'esophagheal mesenchymal tumors': 1, 'esophageal benign submucosal mesenchymal tumor': 1, 'mesenchyme tumor': 1, 'glio-mesenchymal tumors': 1, 'gastric subepithelial mesenchymal tumor': 1, 'Giant Mesenchymal Uterine Tumor': 1, 'Mesenchymal tumors of the skin': 7, 'bimorphic mesenchymal tumors': 1, 'non-meningothelial (mesenchymal) tumors of the CNS': 1, 'benign stromal/mesenchymal tumors': 1, 'dermal malignant mesenchymal tumors': 1, 'mesenchymal cutaneous tumor': 2, 'mesenchymal dermal tumor': 1, 'PMT Syndrome': 1, 'PMT syndrome': 1, 'mesenchymal endobronchial tumor': 1, 'submucosal stromal and mesenchymal tumors': 1, 'stromal or mesenchymal tumors': 1, 'Renal mesenchymal tumor': 1, 'uterus mesenchymal tumor': 1, 'neurogenic mesenchymal tumor': 1, 'lymphoid or mesenchymal tumors': 1, 'mesenchymal stromal tumor-': 1, 'mesenchymal stromal liver tumor-like lesion': 1, 'mesenchymal tumor-like': 1, 'spinal phosphaturic mesenchymal tumor': 1, 'non-mesenchymal carcinoma': 1, 'Mesenchymal-like carcinoma': 1, 'mesenchymal malignancies of the uterus': 1, 'EMP': 1, 'mesenchymal and primary glial/neuronal tumors': 1, 'mesenchymal neurogenic or myogenic tumor': 1, 'EpMT': 1, 'Mesenchymal Amoeboid': 1, 'malignant mesenchymal tumors of the orbit': 1, 'mesenchymal-derived malignant tumor': 1, 'bone-forming malignant mesenchymal tumor': 1, 'Phosphaturic Mesenchymal Nasal Tumor': 1, 'malignant mesenchymal lung tumor': 1, 'mesenchymal lung tumor': 1, 'malignant mesenchymal tumor of the lung': 1, 'CRYOPRESERVATION OF MESENCHYMAL STEM/': 1, 'Benign and mesenchymal tumors': 1, 'mesenchymal or lymphoid tumor': 1, 'tubular gut mesenchymal neoplasms': 1, 'mesenchymal tubular gut neoplasms': 1, 'mesenchymal-osteolineage abnormalities': 1, 'mesenchymal-osteolineage dysfunction': 1, 'Mesenchymal-osteolineage dysfunction': 1, 'Mesenchymal tissue defects': 1, 'peripheral mesenchymal tumors': 1, 'Mesenchymal myxoid tumor': 1, 'Benign mesenchymal mixed tumor (': 1, 'Mesenchymal HCC827': 1, 'SIOP Malignant Mesenchymal Tumour': 1, 'Mesenchymal developmental defects': 1, 'Mesenchymal solid tumors': 1, 'Malignant mesenchymal tumors of the tongue': 1, 'submucosal mesenchymal lesion': 2, 'malignant mesenchymal sarcomas*2': 1, "Lehmann's MSL": 1, 'HNTMCs': 1, 'benign mesenchymal tumor lesion': 1, 'Peripheral oral mesenchymal tumors': 1, 'TROPISM OF MESENCHYMAL': 1, 'ACTIVITY OF MESENCHYMAL': 1, 'TRANS-DIFFERENTIATION OF TUMOR-ASSOCIATED MESENCHYMAL': 1, 'mesenchymal and nodular sclerosis': 1, 'Tumor mesenchymal': 1, 'mesenchymal fibrous tumor': 1, 'neural or mesenchymal tumors': 1, 'mesenchymal tum ors of the nerve': 1, 'Mesenchymal scrotal tumors': 1, 'mesenchymal origin': 1, '-derived-mesenchymal solid tumors': 1, 'neurogenic or mesenchymal tumor': 1, 'undifferentiated malignant mesenchymal tumor': 1, 'mesenchymal)': 1, 'mesenchymal tumor of the gastrointestinal (GI)': 1, 'Parathyroid Malignant Mesenchymal proliferation': 1, 'malignant mesenchymal tumor of the aorta': 1, 'Cutaneous Malignant Mesenchymal Tumors': 1, 'mesenchymal or lymphoid malignancies': 1, 'nonfibrohistiocytic mesenchymal tumors': 1, 'mesenchymal malignancy of the lung': 1, 'mesenchymal and non-mesenchymal lesions': 1, 'abdominopelvic mesenchymal tumors': 1, 'mesenchymal solid malignancy': 1, 'MULTIPLE MESENCHYMAL': 1, 'AS MESENCHYMAL': 1, 'fibroblastic and histiocytic mesenchymal tumors': 1, 'digestive mesenchymal tumor': 1, 'Primary mesenchymal tumors of the retroperitoneum': 1, 'histiocytic mesenchymal lesion': 1, 'mesenchymal body': 1, 'intracranial myxoid mesenchymal tumor of the': 1, 'Encapsulated mesenchymal tumor': 1, 'UMTs': 1, 'benign anal mesenchymal tumors': 1, 'MGS': 1, 'MES MR': 1, 'mesenchymal phosphaturic': 1, 'thoracic mesenchymal tumors': 1, 'mesenchymal myofibroblastic malignancy': 1, 'Hepatic malignant mesenchymoma': 1, 'Phospaturic mesenchymal tumor': 1, 'vasoformative mesenchymal tumor': 1, 'malignant mesenchymoma of the lung': 1, 'mesenchymal alveolar tumor': 1, 'adipose-derived mesenchymal tumors': 1, 'malignant mesenchymal neuroendocrine tumor': 1, 'mesenchymal benign and malignant tumours': 1, 'mesenchymal-like disease': 1, 'mesenchymal tumors of bone and': 1, 'Non-mesenchymal tumors': 1, 'mesenchymal submucosal tumor': 1, 'mesenchymal hepatic lesions': 1, 'Malignant mesenchymal tumors of the oral cavity': 1, 'Malignant mesenchymoma of the hand': 1, 'PHT': 1, 'nodal mesenchymal tumors': 1, 'spindle cell malignant mesenchymal tumor': 1, 'malignant mesenchymal tumors of': 1, 'mesenchymal tumor-glomangiopericytoma': 1, 'soft tissue mesenchymal malignancy': 1, 'mesenchymal non-meningiothelial tumors': 1, 'malignant esophageal mesenchymoma': 1, 'malignant hepatic mesenchymoma': 1, 'OC mesenchymal': 1, 'adenomatous and mesenchymal tumor': 1, 'necrotic mesenchymal tumor': 1, 'mesenchymal tumor of the tongue': 1, 'cutaneous mesenchymal fibrous tumors': 1, 'mesenchymal bone-forming tumors': 1, 'Exocrine, endocrine, and mesenchymal tumors': 1, 'malignant mesenchymal tumor lesion': 1, 'retroperitoneal MM': 1, 'benign polymorphous mesenchymal tumor of soft parts': 1, 'BPMT': 1, 'Ependymoma-like tumor with mesenchymal differentiation': 1, 'ELTMD': 1, 'mesenchymal-inflammatory': 1, 'phosphaturic mesenchymal tumor of the acetabulum': 1, 'Retroperitoneal mesenchymal-derived tumor': 1, 'SEMTM': 1, 'mesenchymal cartilage tumors': 1, 'Malignant mesenchymal tumors of oropharyngeal mucosa': 1, 'nonmeningothelial mesenchymal tumors': 2, 'intradural mesenchymal tumors': 1, 'Mesenchymal Lipoma': 1, 'mesenchymal derived tumors': 1, 'intrathoracic malignant mesenchymal tumours': 1, 'primary intrathoracic malignant mesenchymal tumours': 1, 'thoracic malignant mesenchymal tumours': 1, 'Primary intrathoracic malignant mesenchymal tumours': 1, 'extracardiac malignant mesenchymal tumours': 1, 'localized mesenchymal tumors': 1, 'malignant mesenchymal': 1, 'Mesenchymal Malignant Tumors': 1, 'DIFFERENTIATION OF MM': 1, 'mesenchymal mixed tumors': 1, 'GTme': 1, 'non-meningothelial mesenchymal tumor': 1, 'Ependymoma mesenchymal-like tumor': 1, 'Mesenchymal tumors of the gallbladder': 1, 'mesenchymal pulmonary tumor': 1, 'mesenchymal tumors of the peritoneum': 1, 'phosphaturic mesenchymal tumors of bone and sinonasal tract': 1, 'intra-abdominal, epithelioid mesenchymal tumor': 1, 'mesenchymal malignant tumor of the retroperitoneum': 1, 'Primary mesenchymal intrathoracic tumors': 1, 'extracranial and intracranial mesenchymal anomalies': 1, 'mesenchymal sarcomata': 1, 'undifferentiated, intra- and extraosseous, mesenchymal tumors': 1, 'chondro-mesenchymal': 1, 'Primary mesenchymal tumors of the': 1, 'mesenchymal anomaly': 1, 'submucosal mesenchymal gastric tumors': 1, 'malignant mesenchymal tumor metastasis': 1, 'Pediatric Mesenchymal Tumors': 1, 'Mesenchymal tumor of uterus': 1, 'mesenchymal tumor of the skull': 1, 'mesenchymal tissue malignant tumor': 1, 'Metaplastic mesenchymal type carcinomas': 1, 'metaplastic (mesenchymal/ matrix producing) carcinoma': 1, 'MES-GBM tumors': 1, 'PN- and MES-GBM tumors': 1, 'PN-MES tumor': 1, 'cell mesenchymal tumor': 1, 'phosphaturic mesenchymal tumor of the toe': 1, 'mesenchymal OO-associated tumors': 1, 'mesenchymal-tumors': 1, 'perivascular mesenchymal tumors': 1, 'Mesenchymal tumors of the lower': 1, 'Transitional and Mesenchymal-like tumors': 1, 'or Mesenchymal-like tumors': 1, 'Panuveal malignant mesenchymoma': 1, 'Intraocular malignant mesenchymal tumors': 1, 'mesenchymal series tumor': 1, 'primary mesenchymal tumors of the gastrointestinal': 1, 'melanocytic and mesenchymal tumors': 1, 'mesenchymal serrated': 1, 'MES GBM tumor': 1, 'Malignant mesenchymoma of the thigh': 1, 'mesenchymal soft-tissue malignancy': 1, 'Metaplastic carcinoma mesenchymal': 1, 'dural based mesenchymal tumors': 1, 'ICC': 1, 'BIOLOGICAL CHARACTERISTICS OF MESENCHYMAL STEM CELL EXOSOMES': 1, 'mesenchymal GI malignancies': 1, 'MNSGIT': 1, 'malignant mesenchymal tumor of the dermis': 1, 'mesenchymal tumors of the abdomen': 1, 'Type II EndMT': 1, 'neoplastic mesenchymal lesions': 1, 'primary mesenchymal lesion': 1, 'mesenchymal subclass tumors': 1, 'desmo-plastic mesenchymal tumors': 1, 'Mesenchymal lesion': 2, 'benign and malignant mesenchymal tumors of the thyroid': 1, 'nodular cutaneous mesenchymal tumor of intermediate malignancy': 1, 'benign mesenchymal tumor of the pancreas': 1, 'primary malignant mesenchymoma of the liver': 1, 'malignant mesenchymal tumor of the renal pelvis': 1, 'mesenchymal non-meningoendothelial tumors': 1, 'Mesenchymal tumor of the small pelvis': 1, 'mesenchymal tumor of the small pelvis': 1, 'GSCs': 1, 'malignant mesenchymoma of the retroperitoneum': 1, 'mesenchymal tumors of the renal pelvis': 1, 'mesenchymal intracranial tumors': 1, 'phosphate urinary mesenchymal tissue tumor': 1, 'benign phosphaturic mesenchymal tumors': 1, 'mesenchymal tumor of skin and subcutis': 1, 'malignant renal mesenchymal tumour': 1, 'Mesenchymal tumors of the uterine corpus': 1, 'TAMCs': 1, 'Submucosal mesenchymal lesion': 1, 'heterologous mesenchymal differentiation': 1, 'secondary mesenchymal tumor': 1, 'mesenchymal/non-meningothelial': 1, 'mesenchymal tissue malignancies': 1, 'Mesenchymal malignancy': 1, 'mesenchymal or other rare tumors': 1, 'mesenchymal stem cell-related malignancy': 1, 'myxoid malignant mesenchymal tumors': 1, 'Semi-malignant retroperitoneal mesenchymal tumors': 1, 'forehead mesenchymal tumor': 1, 'Proneural and mesenchymal tumors': 1, 'MESENCHYMAL TRANSFORMATION': 1, 'phosphaturic mesenchymal tumor of the mandible': 1, 'mesenchymal and mixed tumors of uterus': 1, 'Mesenchymal and mixed tumors of uterus': 1, 'intranodal mesenchymal tumors': 1, 'thyroid, reproductive system, and mesenchymal tissue tumors': 1, 'uterine malignant mesenchymoma': 1, 'ethmoidal sinus mesenchymal tumors': 1, 'mesenchymal tumors of the ethmoid sinus': 1, 'mesenchymal sinus tumors': 1, 'ME tumors': 1, 'lung Mesenchymal tumors': 1, 'congenital mesenchymal and angiogenetic disorder': 1, 'congenital mesenchymal or angiogenetic disorder': 1, 'gastric submucosal mesenchymal tumors': 1, 'primitive myxoid mesenchymal tumors of infancy': 1, 'MULTIPOTENT MESENCHYMAL': 1, 'Mesenchymal hilar tumors': 1, 'Myxoid mesenchymal tumors': 1, 'mAo': 1, 'Myxoid mesenchymal tumors of uterus': 1, 'mesenchymal tumor mass': 1, 'Mesenchymal orbital tumor': 1, 'Primary intracranial mesenchymal tumors': 1, 'PMTs tumorogenesis': 1, 'benign mesenchymal disorder': 1, 'vestigial and mesenchymal tumors': 1, 'Cutaneous mesenchymal': 1, 'PRIMARY MALIGNANT MESENCHYMAL': 1, 'malignant mesenchymal renal tumor': 1, 'benign mesenchymal tumor of the oral cavity': 1, 'mesenchymal-like immune activated': 1, 'mucosal-based mesenchymal tumors': 1} | mesenchymal tumors |
Disease | MESH:C535701 | {'sinonasal malignancy': 284, 'sinonasal infection': 93, 'Teratocarcinosarcoma of the cheek': 1, 'Teratocarcinosarcoma': 35, 'TCS': 19, 'sinonasal': 217, 'sinonasal sarcoma': 117, 'Sinonasal Tract Malignancies': 3, 'sinonasal tract malignancies': 13, 'Sinonasal tract malignancies': 9, '/sinonasal cavity': 1, 'sinonasal symptoms': 701, 'sinonasal symptom': 75, 'Sinonasal Symptom': 3, 'sinonasal polyposis': 266, 'sinonasal NHLs': 7, 'sinonasal inflammatory disease': 79, 'Sinonasal teratocarcinosarcoma': 63, 'Sinonasal': 75, 'sinonasal disease': 1051, 'sinonasal inflammatory conditions': 12, 'sinonasal disorders': 126, 'sinonasal malignancies': 475, 'Sinonasal malignancy': 17, 'Sinonasal symptoms': 76, 'sinonasal obstruction': 24, 'sinonasal teratocarcinosarcoma': 67, 'SNTCS': 40, 'sinonasal lesions': 144, 'Sinonasal infection': 8, 'Sinonasal tissue': 1, 'Sinonasal disease': 75, 'sinonasal abnormalities': 28, 'sinonasal conditions': 71, 'sinonasal infections': 81, 'sinonasal or endocrinological complications': 1, 'sinonasal inflammatory diseases': 21, 'Sinonasal lesions': 12, 'sinonasal involvement': 23, 'Sinonasal involvement': 30, 'Inflammatory sinonasal disease': 3, 'pulmonary and sinonasal T2 inflammatory disease': 1, 'inflammatory sinonasal diseases': 6, 'sinonasal disorder': 18, 'sinonasal SCCs': 25, 'sinonasal inflammatory': 9, 'sinonasal diseases': 349, 'sinonasal necrosis': 1, 'sinonasal discomfort': 3, 'Necrotizing Sinonasal Lesions': 1, 'necrotizing sinonasal lesions': 1, 'sinonasal necrotizing lesions': 1, 'Sinonasal hemangiomas': 4, 'Paranasal sinus teratocarcinosarcoma': 1, 'dysplastic sinonasal mucosa': 1, 'BSNS': 32, 'TCS-': 1, 'Sinonasal malignancies': 103, 'Sinonasal Sarcoma': 29, 'Sinonasal Malignancies': 38, 'Sinonasal infections': 5, 'sinonasal lesion': 50, 'inflammatory sinonasal pathologies': 1, 'Sinonasal Malignancy': 16, 'Sinonasal Symptoms': 21, 'sinonasal obstructions': 3, 'Sinonasal abnormality': 3, 'sinonasal meningioma': 11, 'sinonasal meningiomas': 7, 'sinonasal hemangiomas': 11, 'sinonasal pathologic': 1, 'SNTCSs': 2, 'teratocarcinosarcoma': 53, 'Sinonasal teratocarcinosarcomas': 4, 'Sinonasal diseases': 17, 'sinonasal sarcomas': 31, 'Sinonasal sarcomas': 6, 'Sinonasal Sarcoma with Neural and Myogenic': 1, 'sinonasal sarcoma with neural and myogenic': 1, 'sinonasal hemangioma': 9, 'sinonasal emergency': 1, 'ESS': 5, 'Sinonasal cavity': 4, 'sinonasal morbidities': 4, 'sinonasal trauma': 13, 'sinonasal complications': 48, 'teratocarcinosarcoma of the': 1, 'Teratocarcinosarcoma of the': 1, 'SNP': 12, 'Sinonasal pathology': 5, 'Sinonasal Disease': 37, 'SNM': 22, 'sinonasal or dental infection': 1, 'Sinonasal Cavity': 5, 'Sinonasal complications': 13, 'Sinonasal mucosal MMs': 1, 'Sinonasal SCCs': 1, 'Sinonasal Olfactory Dysfunction': 1, 'sinonasal-related olfactory dysfunction': 2, 'sinonasal olfactory dysfunction': 7, 'Sinonasal olfactory dysfunction': 1, 'Non-sinonasal-Related Olfactory Dysfunction': 1, 'sinonasal erosion': 1, 'sinonasal olfactory disease': 2, 'Malignant sinonasal disease': 2, 'Sinonasal polyposis': 40, 'sinonasal pathologies': 52, 'sinonasal glomangiopericytoma': 24, 'SN-GPC': 2, 'sinonasal congestionCase': 1, 'sinonasal complaints': 43, 'sinonasal and reflux symptoms': 2, 'sinonasal inflammatory disorder': 4, 'sinonasal non-ITAC': 1, 'sinonasal SCC': 16, 'Sinonasal Mucus': 1, 'sinonasal inflammatory disorders': 17, 'sinonasal pathology': 24, 'sinonasal olfactory disorders': 2, 'Sinonasal relapses': 1, 'Sinonasal Mucosa': 12, 'Sinonasal malignant malenoma': 1, 'Sinonasal conditions': 3, 'sinonasal problems': 31, 'sinonasal radiographic disease': 2, 'sinonasal condition': 13, 'Sinonasal Disorder': 1, 'Dental and Sinonasal Disorder': 1, 'Sinonasal and otomastoid infections': 1, 'sinonasal and otomastoid infections': 1, 'Sinonasal inflammatory disorders': 2, 'sinonasal morbidity': 1, 'sinonasal allergy': 2, 'sinonasal midline defect': 1, 'sinonasal mucosa': 6, 'Sinonasal NK/T-': 1, 'sinonasal abnormality': 7, 'TBSP': 1, 'sinonasal papillomata': 3, 'sinonasal type papillomata': 1, 'Sinonasal Diseases': 11, 'sinonasal congestion': 19, 'unilateral sinonasal disease': 2, 'Sinonasal Deformities': 1, 'sinonasal injury': 4, 'sinonasal hemangioperictyomas': 1, 'Teratocarcinosarcomas': 4, 'teratocarcinosarcomas': 11, 'Tumors of the sinonasal cavity': 1, 'sinonasal or': 2, 'Sinonasal Polyposis': 12, 'sinonasal non-inflamnatory diseases': 1, 'Biphenotypic sinonasal sarcoma': 9, 'Sinonasal glomangiopericytoma': 19, 'Sinonasal Glomangiopericytoma': 11, 'sinonasal inflammatory process': 2, 'sinonasal mucosal thickening': 3, 'Sinonasal Teratocarcinosarcoma': 16, 'Sinonasal Irrigation': 1, 'sinonasal and systemic symptoms': 1, 'Sinonasal mucosa CRSsNP': 1, 'Sinonasal congestion': 8, 'inflammatory sinonasal disorders': 4, 'sinonasal damage': 4, 'sinonasal and related symptoms': 1, 'sinonasal and related': 1, 'hyperplastic sinonasal polyposis': 4, 'sinonasal inflammatory mucosal disease': 1, 'sinonasal opacities': 1, 'sinonasal and/or': 2, 'Sinonasal symtoms': 1, 'sinonasal moderately differentiated': 1, 'sinonasal and oral symptoms': 1, 'sinonasal mucosal ulcers': 1, 'sinonasal invasive infections': 1, 'sinonasal Scopulariopsis brevicaulis': 1, 'Sinonasal Inflammatory Disease': 3, 'sinonasal cavity tumors': 4, 'Sinonasal I': 1, 'Sinonasal Tract': 1, 'Sinonasal and pulmonary symptoms': 1, 'Sinonasal haemangiopericytoma': 6, 'sinonasal inflammatory condition': 5, 'SNID': 1, 'SNMs': 9, 'inflammatory sinonasal disease': 12, 'Sinonasal PMT': 1, 'Sinonasal OD': 1, 'Sinonasal tract': 5, 'benign sinonasal disease': 2, 'sinonasal neoplastic lesion': 1, 'sinonasal opacification': 5, 'sinonasal dysfunction': 10, 'sinonasal inflammatory reaction': 1, 'sinonasal malignant': 1, 'Sinonasal Lesions': 5, 'sinonasal polypi': 2, 'ethmoid teratocarcinosarcoma': 1, 'Diseases of the sinonasal system': 1, 'sinonasal or olfactory disorders': 1, 'sinonasal, neoplastic': 1, 'sinonasal obstructive symptoms': 4, 'Sinonasal botryomycosis': 1, 'sinonasal tract': 7, 'Sinonasal symptom': 11, 'Sinonasal disorders': 4, 'Sinonasal polyposisMycetoma': 1, 'intracranial or sinonasal infection': 1, 'Sinonasal Teratocarcinosarcoma-A': 1, 'sinonasal SDC': 1, 'Sinonasal BSCC': 1, 'biphenotypic sinonasal sarcoma': 3, 'sinonasal vasculitic symptoms': 1, 'sinonasal mucosal damage': 3, 'Congenital Teratocarcinosarcoma': 1, 'Polypoidal sinonasal lesions': 1, 'inflammatory disease of the sinonasal mucosa': 1, 'Sinonasal-type haemangiopericytoma': 1, 'sinonasal mucosal disease': 6, 'sinonasal tract malignancy': 2, 'Sinonasal GPC': 2, 'sinonasal GPC': 2, 'sinonasal glomangiopericytomas': 2, 'sinonasal ITAC': 1, 'Metastatic Tumors of the Sinonasal Cavity': 1, 'SND': 7, 'sinonasal surgery': 2, 'sinonasal ENKLs': 1, 'sinonasal OF': 1, 'Extracranial sinonasal tract meningioma': 1, 'sinonasal pathological': 1, 'sinonasal endoscopic abnormalities': 1, 'Sinonasal pathologies': 3, 'BSNS BSNS': 1, 'sinonasal SNGPC': 1, 'SNGPC': 2, 'sinonasal NEC': 4, 'Sinonasal malignances': 3, 'sinonasal teratocarcinosarcomas': 5, 'sinonasal palatal disease': 1, 'Teratocarcinosarcoma of the nose,': 1, 'teratocarcinosarcoma of the nose,': 1, 'sinonasal malignant lesions': 3, 'Biphenotypic Sinonasal Sarcoma': 3, 'T4bN0M0 TCS': 1, 'Sinonasal inflammatory disease': 3, 'BSNS lesion': 1, 'benign sinonasal diseases': 2, 'sinonasal SFTs': 2, 'Sinonasal Sarcomas': 2, 'sinonasal thickening': 1, 'sinonasal pleomorphous reticulosis': 1, 'Sinonasal/rhinocerebral disease': 1, 'malignancy of sinonasal epithelium': 1, 'sinonasal and': 3, 'allergic sinonasal polyposis': 1, 'Sinonasal sarcoma': 4, 'sinonasal ulcerations': 1, 'SNp': 1, 'sinonasal or neurological symptoms': 2, 'sinonasal osteogenesis': 2, 'sinonasal and oral cavity SCC': 1, 'sinonasal tract disruption': 1, 'Polypoid sinonasal lesion': 1, 'sinonasal HPCs': 4, 'sinonasal TCS': 3, 'sinonasal haemangiopericytoma': 8, 'Sinonasal FD': 1, 'sinonasal fibrous dysplasia': 3, 'sinonasal FD': 2, 'sinonasal bony involvement': 1, 'Sinonasal fibrous dysplasia': 1, 'sinonasal problem': 1, 'sinonasal-type haemangiopericytoma': 2, 'sinonasal inflammatory polyposis': 1, 'sinonasal obstructive disease': 2, 'sinonasal mucosa inflammatory disease': 2, 'SINONASAL': 2, 'sinonasal or rhino-orbito-cerebral infections': 1, 'sinonasal and pulmonary symptoms': 3, 'sinonasal ailments': 1, 'sinonasal mucosal abnormality': 1, 'sinonasal tract necrosis': 1, 'Sinonasal problems': 4, 'congenital cranial or sinonasal malformations': 1, 'Chemosensory and Sinonasal Dysfunction': 1, 'SNTC': 5, 'sinonasal/basicranial MFS': 1, 'Sinonasal/': 1, 'Sinonasal/basicranial myxofibrosarcoma': 1, 'sinonasal/basicranial myxofibrosarcoma': 1, 'sinonasal cavity': 6, 'BSS.2': 1, 'BSS': 3, 'DN-SNSCC': 1, 'Teratocarcinosarcoma of the oral cavity': 1, 'Sinonasal complaints': 6, 'Sinonasal Issues': 1, 'sinonasal disordersWeak': 1, 'Sinonasal Complications': 5, 'sinonasal complications of': 1, 'Sinonasal Complications of': 1, 'sinonasal MCLs': 1, 'sinonasal AiCCs': 1, 'Sinonasal SFTs': 1, 'sinonasal defect': 1, 'Teratocarcinosarcoma of the nasal cavity and ethmoid': 1, 'sinonasal or allergic symptoms': 3, 'sinonasal adult sarcoma': 1, 'sinonasal obstructive': 1, 'glomangiopericytoma of sinonasal tract': 1, 'sinonasal biphenotypic sarcoma': 1, 'Sinonasal biphenotypic sarcoma': 1, 'sinonasal granulomatous disease': 3, 'SINONASAL CAVITY': 1, 'sinonasal fistulation': 2, 'sinonasal destruction': 2, 'SNC': 1, 'Sinonasal mucosal thickening': 1, 'Sinonasal NIAC': 1, 'sinonasal NECs': 2, 'midline destructive lesions of the sinonasal': 1, 'sinonasal malignant disease': 1, 'SN': 4, 'sinonasal tissue destruction': 1, 'SNS': 6, 'sinonasal tissue anomaly': 1, 'sinonasal inflammatory complications': 1, 'SNT': 1, 'SNT SFTs': 1, 'sinonasal mucosa disease': 1, 'sinonasal mucosal injury': 2, 'sinonasal fistulae': 2, 'sinonasal fistula': 4, 'systemic or sinonasal infection': 1, 'sinonasal disease only': 1, 'sinonasal, pharyngeal, and allergic sinonasal diseases': 1, 'sinonasal Malignancies': 1, 'sinonasal disease symptoms': 2, 'thyroid teratocarcinosarcoma': 2, 'Sinonasal Symptomatology': 1, 'sinonasal symptomatology': 1, 'HSNE': 1, 'inflammatory diseases of the sinonasal mucosa': 1, 'sinonasal quality of life defects': 1, 'sinonasal traumas': 1, 'Sinonasal NKT': 1, 'Sinonasal inflammatory': 1, 'Sinonasal Disorders': 2, 'impairment of sinonasal function': 1, 'tumors of the sinonasal cavity': 1, 'sinonasal tract meningiomas': 2, 'Primary sinonasal atypical meningioma': 1, 'Sinonasal mucosa': 1, 'sinonasal and temporal lesion': 1, 'sinonasal anomalies': 5, 'sinonasal polyposis disease': 1, 'sinonasal mucosa toxicity': 1, 'Inflammatory Sinonasal Diseases': 1, 'sinonasal and pulmonary infections': 1, 'sinonasal, or other mucosal diseases': 1, 'sinonasal capillary haemangioma': 1, 'autoimmune sinonasal destruction': 1, 'sinonasal malignity': 1, 'sinonasal carcinomahistologic': 1, 'sinonasal and intracranial lesions': 1, 'sinonasal bleeding': 2, 'sinonasal mucosal': 1, 'sinonasal obstructive pathologies': 1, 'sinonasal NUT': 1, 'sinonasal, orbital, or spinal infections': 1, 'chronic sinonasal symptoms': 1, 'sinonasal inflammatory lesions': 2, 'sarcomas of sinonasal cavities': 1, 'sinonasal and pulmonary sequalae': 1, 'sinonasal complaint': 3, 'and sinonasal': 1, 'Sinonasal NCMs': 1, 'sinonasal ectopic meningiomas': 1, 'sinonasal sequelae': 1, 'Sinonasal complications of': 1, 'sinonasal affection': 1, 'Sinonasal Remedies': 1, 'sinonasal remedies': 1, 'sinonasal hemorrhage': 1, 'impaired sinonasal function': 1, 'Sinonasal abnormalities': 2, 'nasal teratocarcinosarcoma': 1, 'Nasal teratocarcinosarcoma': 1, 'Sinonasal tract (SNT': 1, 'Sinonasal Inflammatory Diseases': 1, 'AN Sinonasal': 1, 'Craniofacial and sinonasal malignancies': 1, 'sinonasal, kidney, and liver': 1, 'Sinonasal Mucosa Disorders': 1, 'Sinonasal mucosa disorders': 1, 'sinonasal mucosal disorders': 1, 'sinonasal mucosa disorders': 1, 'obstructions of the sinonasal canals': 1, 'sinonasal-associated': 1, 'sinonasal heamangioma': 1, 'sinonasal malignances': 2, 'sinonasal deficiencies': 1, 'neurological or sinonasal diseases': 1, 'sinonasal anaplastic sarcoma': 1, 'Malignant teratocarcinosarcoma of the sphenoid sinus': 1, 'sinonasal papilloma47': 1, 'Sinonasal swellings': 1, 'nasal or sinonasal complaints': 3, 'sinonasal impairment': 2, 'sinonasal ectopic meningioma': 1, 'sinonasal function impairment': 1, 'sinonasal complication': 2, 'sinonasal and glottic lesions': 1, 'sinonasal-pecific': 1, 'Sinonasal CFRD': 1, 'rhino-sinonasal disorders': 1, 'unilateral sinonasal symptoms': 1, 'sinonasal amyloid': 1, 'sinonasal swelling': 2, 'sinonasal polypoid disease': 2, 'sinonasal cavity disease': 1, 'sinonasal neoplastic': 1, 'TCS teratocarcinosarcoma': 2, 'sinonasal benign lesion': 2, 'sinonasal or other': 1, 'Sinonasal collision malignancies': 1, 'sinonasal ABC': 1, 'Sinonasal Pathologies': 1, 'sinonasal airway diseases': 1, 'sinonasal diseases and': 1, 'Pediatric Sinonasal Malignancies': 1, 'Pediatric sinonasal malignancies': 1, 'sinonasal or pulmonary infections': 2, 'sinonasal toxicity': 2, 'malignant teratocarcinosarcoma': 2, 'Malignant teratocarcinosarcoma of the nose and paranasal sinuses': 1, 'Malignant teratocarcinosarcoma of the': 1, 'sinonasal sarcoma not otherwise specified': 1, 'Sinonasal Teratocarcinosarcomas': 2, 'Sinonasal Sinus': 1, 'sinonasal sinus': 1, 'sinonasal disease and': 1, 'Sinonasal Disease and': 1, 'Sinonasal organized': 3, 'sinonasal defects': 1, 'Odontogenic sinonasal pathology': 1, 'Sinonasal comorbidity': 1, 'sinonasal inflammatory processes': 1, 'SinoNasal': 3, 'sinonasal obstructive and inflammatory disorders': 1, 'TERATOCARCINOSARCOMA': 1, 'of the sinonasal cavity': 1, 'Sinonasal tract NET': 1, 'sinonasal AMs': 1, 'sinonasal alveaolar rhabdosarcomas': 1, 'sinonasal rhabdosarcomas': 1, 'non-sinonasal-related olfactory dysfunction': 1, 'Non-sinonasal-related olfactory dysfunction': 1, 'Sino nasal teratocarcinosarcoma': 1, 'sinonasal disease.11': 1, 'sinonasal disease.22': 1, 'Sinonasal hemangioma': 1, 'Sinonasal Hemangioma': 2, 'sinonasal myospherulosis': 1, 'Sinonasal myospherulosis': 1, 'Sinonasal KSCC': 1, 'Sinonasal Hyposmia': 1, 'sinonasal hyposmia': 1, 'primary sinonasal myxofibrosarcoma': 1, 'Primary sinonasal myxofibrosarcoma': 1, 'Sinonasal SCC': 4, 'Sinonasal symptomsa': 1, 'Sinonasal UndifferentiatedCarcinoma': 1, 'ISMS': 1, 'sinonasal-type': 1, 'Chronic Sinonasal Pseudotumor': 1, 'sinonasal pseudotumors': 1, 'Sinonasal meningioma': 1, 'sinonasal and cerebral infections': 1, 'sinonasal haemongiopericytoma': 1, 'sinonasal UCs': 1, 'Sinonasal involvement by': 1, 'sinonasal vascular anomalies': 1, 'sinonasal irritation': 1, 'Sinonasal CMF': 1, 'sinonasal CMF': 1, 'sinonasal polyposis symptoms': 1, 'sinonasal region diseases': 1, 'sinonasal and extranasal disease': 1, 'Sinonasal obstruction': 2, 'sinonasal and cranial autonomic symptoms': 1, 'sinonasal (and other) disease': 1, 'Sinonasal inflammatory conditions': 1, 'sinonasal allergic disease': 1, 'Sinonasal and Oral Cavities': 1, 'SNP-WoAD': 1, 'SNP-': 1, 'sinonasal-symptom': 1, 'sinonasal mucosal condition': 1, 'sinonasal ALMs': 1, 'chronic pulmonary and sinonasal symptoms': 1, 'Sinonasal Manifestations': 2, 'Sinonasal relapse': 1, 'sinonasal inflammatory symptoms': 1, 'Sinonasal Epithelia': 2, 'sinonasal n-ITAC': 1, 'sinonasal inflammatory changes': 1, 'sinonasal inflammatory involvement': 1, 'sinonasal occlusion': 1, 'sinonasal sarcomas.3': 1, 'Sinonasal Bacteroma': 1, 'sinonasal YST': 1, 'sinonasal and bottle infection': 1, 'sinonasal and oral tumors': 1, 'Sinonasal teratocarcinosarcoma of the ethmoid and paranasal sinus': 1, 'non-sinonasal symptoms': 1, 'sinonasal or nasopharyngeal (i.e. sinonasal tract, SNT) lymphoid malignancies': 1, 'Sinonasal Fibrous Dysplasia': 1, 'sinonasal symptomsn': 1, 'frontal lobe TCS': 1, 'sinonasal HPC': 1, 'Sinonasal and temporal bone infections': 1, 'teratocarcinosarcoma of the thyroid gland': 1, 'primary thyroid teratocarcinosarcoma': 2, 'Teratocarcinosarcoma of the thyroid': 1, 'teratocarcinosarcoma of the thyroid': 1, 'sinonasal CAVITY': 1, 'sinonasal pressure': 1, 'Sinonasal Pressure': 1, 'Sinonasal ITACs': 1, 'naso-sinonasal lesions': 1, 'CAUSATION OF SINONASAL': 1, 'SINONASAL DISEASE': 1, 'Polypoid sinonasal cavity': 1, 'sinonasal mucosal diseases': 3, 'Sinonasal Intracranial,': 1, 'Sinonasal Intracranial': 1, 'Sinonasal haemangiopericytomas': 1, 'sinonasal diseaseH': 1, 'sinonasal inflammatory OD': 1, 'granulomatous sinonasal disorder': 1, 'Malignancies of sinonasal region': 1, 'malignancies of the sinonasal': 1, 'malignancies of the sinonasal tract': 2, 'sinonasal PMMs': 1, 'intracranial teratocarcinosarcoma': 1, 'sinonasal injuries': 1, 'airway or sinonasal disease': 1, 'sinonasal or paranasal malignancies': 1, '(sinonasal) meningioma': 1, 'Sinonasal Meningioma': 1, 'sinonasal haemangiopericytomas': 1, 'sinonasal olfactory loss': 1, 'Primary sinonasal meningioma': 1, 'primary sinonasal meningioma': 1, 'pulmonary or sinonasal infection': 1, 'sinonasal NEN': 1, 'sinonasal olfactory disorder': 1, 'Nasal Biphenotypic Sinonasal Sarcoma': 1, 'sinonasal DLBCLs': 1, 'sinonasal or ophthalmologic disorders': 1, 'Sinonasal Involvement': 1, 'sinonasal or laryngotracheal symptoms': 1, 'Sinonasal cavities': 1, 'sinonasal obstruction symptoms': 1, 'Sinonasal Meliodosis': 1, 'Sinonasal Organised Haematoma': 1, 'SOH': 1, 'Sinonasal organised haematoma': 2, 'sinonasal infection symptoms': 1, 'sinonasal disturbances': 2, 'sinonasal NET': 2, 'sHPC': 1, 'sinonasal NMCs': 2, 'sinonasal candidial infection': 1, 'sinonasal and intracranial complications': 1, 'sinonasal cancers8': 1, 'Sinonasal tract glomangiopericytoma': 1, 'and sinonasal conditions': 1, 'USD': 1, 'Unilateral sinonasal disease': 1, 'sinonasal SRBCTs': 1, 'sinonasal dysplasia': 1, 'Sinonasal Medications': 3, 'sinonasal pain2': 1, 'Sinonasal and pulmonary symptoms2': 1, 'Sinonasal 19': 1, 'sinonasal syndromes': 1, 'Sinonasal TCSs': 1, 'sinonasal maliganancies': 1, 'Sinonasal Yes': 1, 'sinonasal purulence': 1, 'sinonasal cavity haemangiomas': 1, 'sinonasal haemangiomas': 1, 'sinonasal NKSCC': 1, 'sinonasal (SN) involvement': 1, 'sinonasal infection symptom': 1, 'otoneurological and sinonasal symptoms': 1, 'sinonasal low-': 1, 'Sinonasal tract sarcomas': 1, 'sinonasal aspergilosis': 1, 'extra-sinonasal symptoms': 1, 'sinonasal mucosal abnormalities': 1, 'sinonasal mesenchymal neoplasm': 1, 'SN-HPC': 1, 'SNSs': 1, 'oral, genital or sinonasal': 1, 'sinonasal mucosal irritation': 1, 'sinonasal-related problems': 1, 'sinonasal or brain involvement': 1, 'sinonasal and oral cavity malignancies': 1, 'sinonasal fistulas': 1, 'Sinusal teratocarcinosarcoma': 1, 'Sinonasal 2': 1, 'Sinonasal 4a': 1, 'STCS': 1, 'Sinonasal Teratocarcinosarcoma- A': 1, 'Sinonasal and adjacent': 1, 'Sinonasal dysfunctions': 1, 'SNGP': 1, 'sinonasal hyperostosis': 1, 'Sinonasal myxofibrosarcoma': 1, 'benign sinonasal lesions': 1, 'sinonasal blue naevi': 1, 'sinonasal polyposis': 1, 'sinonasal ciliary dysfunction': 2, 'hypertrophic sinonasal mucosa': 1, 'Sinonasal NECs': 1, 'Sinonasal Necrotizing Infection': 1, 'Teratocarcinosarcoma of the paranasal sinuses': 1, 'ethmoidal teratocarcinosarcoma': 1, 'Sinonasal SRBCTs': 1, 'sinonasal RMSs': 1, 'Sinonasal RMSs': 1, 'sinonasal and urothelial': 1, 'sinonasal mucosal inflammatory disorders': 1, 'Sinonasal meningeoma': 1, 'SNA': 1, 'CHRONIC SINONASAL': 1, 'Sinonasal inflammatory condition': 1, 'swelling of the sinonasal mucosa': 1, 'Sinonasal undiff': 1, 'sinonasal symptoms and diseases': 1, 'sinonasal infection or': 1, 'sinonasal and vasculitic disease': 1, 'Inflammatory Sinonasal Polyposis': 1, 'sinonasal and perisinus disease': 1, 'SINONASAL DISEASES': 1, 'sinonasal IP': 1, 'sinonasal inverted papillomata': 1, 'Inflammatory sinonasal diseases': 2, 'pulmonary, sinonasal, or gastroenterological infections': 1, 'sinonasal OD': 3, 'tumor teratocarcinosarcoma': 1, 'sinonasal teratcarcinosarcoma': 1, 'sinonasal pathophysiology': 1, 'Sinonasal Inflammatory': 1, 'diseased sinonasal mucosa': 1, 'sinonasal benign lesions': 1, 'sinonasal and pulmonary': 1, 'Sinonasal menigniomas': 1, 'Sinonasal meningiomas': 1, 'sinonasal terato-carcino-sarcoma': 1, 'Sinonasal terato-carcino-sarcoma': 1, 'Sinonasal glomangiopericytomas': 1, 'sinonasal malignomas': 1, 'TCSs': 1, 'SNE': 1, 'Sinonasal sign': 1, 'Sinonasal deformity': 1, 'sinonasal deformity': 1, 'sinonasal illnesses': 1, 'BSNS lesions': 1, 'sinonasal-type teratocarcinosarcoma': 1, 'sinonasal and possibly other': 1, 'Sinonasal destructions': 1, 'sinonasal affliction': 1, 'hypertrophic polypoid nasal and sinonasal mucosa': 1, 'pulmonary and sinonasal symptoms': 1, 'Sinonasal OH': 1, 'sinonasal OH': 1, 'Sinonasal organising haematoma': 1, 'sinonasal organising haematoma': 1, 'sinonasal haemangioma': 1, 'sinonasal allergic symptoms': 1, 'Teratocarcinosarcoma of the nasal cavity': 1, 'sinonasal barrier dysfunction': 1, 'sinonasal epithelia': 1, 'sinonasal poliposis': 1, 'sinonasal and non-sinonasal malignancies': 1, 'Teratocarcinosarcoma of nasal cavity': 1, 'sinonasal meningitis': 1, 'dysfunction of the sinonasal mucosa': 1, 'oral, genital, or sinonasal': 1, 'Sinonasal true': 1, 'Sinonasal SmCCs': 1, 'auditory/vestibular and sinonasal symptoms': 1, 'bronchiopulmonary and sinonasal apergillosis': 1, 'sinonasal necroinflammatory disease': 1, 'Sinonasal Necroinflammatory Disease': 1, 'sinonasal solid malignancies': 1, 'SNSS': 1, 'sinonasal and oral inflammatory diseases': 1, 'sinonasal cavity tumor': 1, 'SN malignancies': 1, 'sinonasal flares': 1, 'Teratocarcinosarcomas of': 1, 'TCS of': 1, 'sinonasal OPs': 1, 'sinonasal comorbidity': 1, 'sinonasal QOL deficit': 1, 'sinonasal QOL': 1, 'SM': 1, 'granulomatous sinonasal disease': 1, 'sinonasal and ocular disease': 1, 'sinonasal and neurocognitive diseases': 1, 'sinonasal or intracranial abnormalities': 1, 'sinonasal cavity infection': 1, 'sinonasal malignancies.8': 1, 'SINONASAL MALIGNANCIES': 1, 'Sinonasal cavernous haemangioma': 1} | sinonasal disease |
Disease | MESH:C535702 | {'MSAD': 10, 'methyl malonic aciduria': 15, 'Malonyl-CoA decarboxylase deficiency': 10, 'malonyl-CoA decarboxylase deficiency': 33, 'MalH': 2, 'methyl malonic acidemia': 20, 'MACP': 1, 'MA': 6, 'MA-CHD': 1, 'SMAHOs': 1, 'malonyl-Coa decarboxylase': 1, 'Malonic aciduria': 20, 'malonic aciduria': 33, 'Methyl-malonic academia': 1, 'ENAMINE DERIVATIVES OF MALONIC ACID': 1, 'MaCoA': 2, 'Malonic acidemia': 7, 'MCD': 29, 'MACE': 21, 'methyl malonic academia': 2, 'ON REPEATED ADMINISTRATION OF ENDOTOXIN TREATED WITH MALONIC': 1, 'malonic acidurias': 3, 'malonyl-AT': 2, 'MCR': 2, 'methyl malonic acidaemia': 7, 'Methyl malonic acidaemia': 1, 'MAT': 2, 'MLYCD': 1, 'Malone': 2, 'MCD-/-': 1, 'malonyl-CoA decarboxylase (MCD) deficiency': 6, 'malonyl-CoA dehydrogenase deficiencies': 1, 'methyl malonicaciduria': 1, 'Methyl malonic aciduria': 5, 'MLA': 1, 'MCD deficiency': 16, 'Methyl malonic Acidemia': 1, 'MLYCD deficiency': 4, 'Malonyl-CoA decarboxylase (MLYCD, EC 4.1.1.9) deficiency': 1, 'malonyl-CoA decarboxylase-deficient': 1, 'malonic': 2, 'TEL-glc-mal': 1, 'Malone-Appendikostoma': 1, 'malonyl-coa decarboxylase deficiency': 1, 'SAD': 1, 'malonic acidemia': 11, 'Malonic Acidemia': 3, 'DEMM': 2, 'polyDEMM': 1, 'DMM': 6, 'methyl-malonyl-CoA mutase deficiency': 2, 'Malonyl-CoA decarboxylase': 3, 'Malonyl coenzyme A decarboxylase deficiency': 7, 'MALONIC ACID': 1, 'methyl-malonic acidemia': 7, 'Methyl malonic acidemia': 9, 'malonyl coenzyme A decarboxylase deficiency': 4, 'Malonyl-CoA decarboxylase (MCD) deficiency': 1, 'ethyl-malonic aciduria': 1, 'EMA': 1, 'methyl-malonic aciduria': 7, 'MLYCDD': 2, 'malonic acid': 1, 'Malonyl-CoA Decarboxylase Deficiency': 3, 'TRANSFORMATION OF MALONIC ACID DIAMIDE DERIVATIVES': 1, 'MCAT (malonyl-CoA transferase) deficiency': 1, 'MDA': 10, 'Methyl Malonic acidemia 1': 1, 'the mitochondrial enzyme malonyl-CoA synthetase': 1, 'GCD': 1, 'UTILIZATION OF MALONYL-COENZYME A': 1, 'MCR-C.': 2, 'MCR-C': 3, 'MMAB': 1, 'enzyme deficiency malonic aciduria': 1, 'Malonic Aciduria': 4, 'MCL': 1, 'Malonyl CoA decarboxylase deficiency': 2, 'methyl-malonic acidaemia': 1, 'MCD-D': 1, 'Methly-malonic academia': 1, 'OXIDATION OF MALONIC ACID': 1, 'MM': 1, 'malonyl-CoA': 2, 'MCS': 1, 'MMA': 8, 'deficiency of malonyl-CoA decarboxylase': 4, 'Fatal malonyl CoA decarboxylase deficiency': 1, 'MCR-N.': 1, 'MCR-N': 2, 'malonate': 3, 'hMCD': 1, 'neonatal malonic aciduria': 1, 'AT': 1, 'Malonyl-coenzyme A decarboxylase deficiency': 1, 'OXC': 3, 'methyl l malonic acidemia': 1, 'ethyl malonic adipic aciduria': 1, 'systemic malonic aciduria': 1, 'Malonyl coenzyme A (CoA) decarboxylase (MCD) deficiency': 1, 'malonyl-CoA decarboxylase (MCD)-deficient disease': 1, 'ethyl-malonic encephalopathy': 1, 'MCT': 1, 'MM-CoA': 1, 'OCD': 1, 'deficiency of methyl malonyl CoA.': 1, 'brain MCD deficiency': 1, 'MAL': 2, 'Ethyl Malonic Aciduria': 1, 'mitochondrial MCD': 1, 'MDC': 2, 'deficiency of methyl-malonyl-CoA mutase': 1, 'Malonyl coenzyme A (CoA) decarboxylase (EC 4.1.1.9, MCD) deficiency': 1, 'CoA decarboxylase': 1, 'Malonyl': 1, 'MCD-': 1, 'MSA': 3, 'Methyl Malonic Acidemia': 3, 'malonic acidemia/aciduria': 1, 'MMA - methyl malonic acidaemia': 1, 'ethyl malonate aciduria': 1, 'MCD-deficient': 1, 'malonyl-coenzyme A decarboxylase deficiency': 1, 'MALONYL-': 1, 'Malone-Stoma': 1, 'malonate lesioning': 1, 'Methyl-malonic aciduria': 1, 'MCD deficient': 2, 'ADENINE FROM MALONIC ESTER': 2, 'Malonic': 1, 'EFFECT OF SODIUM MALONATE': 1, 'Malonyl Coenzyme A Decarboxylase Deficiency': 1, 'malonic acid metabolism': 1, 'CONDENSATIONS OF POLYPHENOLS WITH MALONIC ESTERS': 1, 'Malone fracture': 1, 'menthyl malonic acidemia': 1, 'Methyl malonyl coenzyme A mutase deficiency': 1, 'MALONIC ACID AS AN INHIBITOR OF MAIZE ROOT RESPIRATION': 1, 'ethyl malonate encephalopathy': 1, 'deficiency of mitochondrial malonyl CoA decarboxylase': 1, 'Methyl-Malonic Acidemia': 1, 'methyl malonic aciduriab': 1, 'MCAT deficiency': 1, 'DM': 1, 'HmMCD': 1, 'neurotoxic malonate': 1, 'Malonate lesion': 1, 'Malonate lesions': 1, 'Mcr-N': 1, 'malonate hypoxydosis': 1, 'Malonylation': 1, 'malonate deficiency': 1, 'congenital MCD deficiency': 1, 'malonylation': 2, 'peroxisomal MCD': 1, 'MCAT': 1, 'deficiency of malonyl CoA decarboxylase': 1, 'DIM': 1, 'MGLI': 2, 'MDZI': 2, 'MMC': 1, 'MALONYL COENZYME A': 1, 'MALONE': 1, 'Malonic acidemia deficiency': 1, 'SODIUM MALONATE': 1, 'malonyl-Coa decarboxylase deficiency': 1, 'malonyl-CoA synthetase deficiency': 1, 'OXC-YciA': 1, 'met-mal-CoA': 1, 'methyl malonic and propionic aciduria': 1, "Malone's": 1, 'Malonyl-Coa': 1, 'Malonyl-Coa decarboxylase deficiency': 1, 'ACC': 2, 'Methyl malonic academia': 1, 'CHICK BY DIETARY MALONIC': 1, 'Malonic acidaemia': 1, 'McrCa': 1, 'malonyl CoA decarboxylase deficiency': 1, 'Perforation of Malone': 1, 'EMC': 1, 'CMMA': 1, 'Combined malonic and methyl malonic aciduria': 1, 'Malonic Esters': 1, 'MCD deficiency disorder': 1, 'LMG': 1, 'AMG': 1, 'Malonyl-CoA decarboxylase (MLYCD) deficiency': 1, 'DMPs': 1, 'EFFECT OF MALONATE ON': 1, 'malonic dyaldehide': 1, 'malonyl CoA decarboxylase (MCD) deficiency': 1, 'MCD Deficiency': 1, 'malonic and': 1, 'Methyl malonicaciduria': 1, 'EFFECT OF SODIUM MALONATE ON GASTRIC ACIDITY': 1, 'malonate lesions': 1, 'malonyl CoA decarboxylase': 1, 'methyl-malonic aciduriaMutation': 1, 'Methyl-malonic aciduria-': 1, 'MSAD-1': 1, 'MSADs': 1, 'MSAD-2': 1, 'MT': 1, 'methyl malonyl-CoA mutase deficiency': 1, 'MCM': 1, 'malonyl coenzyme A (CoA) decarboxylase deficiency': 1, 'malonic academia': 1, 'SMACE': 1, 'AA-MA': 1, 'CIMA': 1, 'NL-MALONYL-BIS-ETHYLENIMINE': 1, 'malonyl-coA decarboxylase (': 1, 'MLYCD) deficiency': 1, 'ETHYL MALONATE': 1, 'malonyl-CoA decarboxylase': 1, 'MA reflux': 1, 'MA stenosis': 1, 'MLI': 1, 'ReMCD': 1, 'MCD Disease': 1, 'CmMCD': 1, 'RpMCD': 1, 'methlymalonic and malonic aciduria': 1, 'MALONIC ACIDS': 1, 'Macedo-Malone': 1, 'Methyl-malonic acidemia': 1, 'ACCase hyperactivity': 1, 'primary malonic aciduria': 1, 'Primary malonic aciduria': 1, 'deficiency of MCD': 1} | malonyl-CoA decarboxylase deficiency |
Disease | MESH:C535703 | {'sinusoidal dilatation and congestion': 6, 'SDC': 5, 'Malouf syndrome': 20, 'dilation and congestion': 3, 'vascular dilatation and congestion': 4, 'Malouf Syndrome': 4, 'hepatic sinusoidal dilatation and congestion': 3, 'Sinusoidal dilatation and congestion': 2, 'vascular dilation and congestion': 2, 'sinusoidal congestion and dilation': 1, 'congestion and dilatation': 1, 'congestive vessel dilatation': 1, 'portal vein congestion and dilation': 1, 'sinusoidal dilation and congestion': 2, 'Dilated (congestive)': 1, 'pulmonary vascular dilatation and congestion': 1, 'vascular congestion/dilation': 1, 'congestive sinusoidal dilation': 1, 'Congestion or sinus dilatation': 1, 'dilation and congestion of glomerular capillaries and': 1, 'congestive sinusoidal dilatation': 2, 'vascular congestion and dilation': 1, 'sinusoidal dilatation with congestive central veins': 1, 'Dilated congested glomerular capillaries': 1, 'congestive dilation of the renal pelvis': 1, 'congestive dilatation of glomerular capillaries': 1, 'congestive dilated myopathy': 1, 'renal interstitial vascular dilation and congestion': 1, 'capillary dilation and congestion': 1, 'Capillary dilatation and congestion': 1, 'tubulointerstitial dilatation and congestion': 1, 'congestion of sinusoidal dilatation': 1} | Malouf syndrome |
Disease | MESH:C535704 | {'GML': 1, 'Gypsy': 80, 'gypsies': 5, 'gypsy': 87, 'Gypsies': 8, 'gypsy moth': 2, 'AGM': 9, 'JGM': 1, 'EGM': 7, 'Malpuech syndrome': 19, 'GRT': 7, 'Gypsy moths': 2, 'Carnevale, Malpuech': 1, 'GIN': 1, 'GIN2': 1, '-TE': 1, 'TE': 1, 'Malpuech': 11, 'Gypsy moth': 5, 'Kabuki and Malpuech syndromes': 1, 'Malpuech facial clefting syndrome': 4, 'Gypsy-moth-caterpillar dermatitis': 2, 'gypsy infection': 1, '3MC syndrome type 3': 1, 'Gypsy MS': 1, 'gypsie': 1, 'orofaciodigital and Malpuech syndromes': 1, 'gypsy neuropathy': 1, 'Manouche gypsy': 1, 'Gypsy long terminal repeat': 1, 'gypsy Arthropoda': 1, 'atrial septal defect Malpuech facial clefting syndrome': 1, 'Welsh gypsies': 2, 'MS': 1, 'gypsy heritage': 1, 'Rumanian gypsy': 1, 'Gypsy athila': 1, 'Roma/Gypsy': 1, 'Gypsy-Traveller': 1, 'Gypsy Roma': 1, '3MC syndromes types 1-3': 1, 'Malpuech syndromes': 2, 'Gypsy-2_CH': 1, 'Gypsy-1': 1, 'Gypsy-1_CH': 1, 'Gypsy-5_': 1, 'Gypsy-2': 1, 'Gypsy holocaust': 1, 'LGF': 1, 'Malpuech,': 1} | gypsy |
Disease | MESH:C535705 | {'mandibuloacral dysplasia with type A lipodystrophy': 7, 'MAD': 91, 'mandibuloacral dysplasia': 249, 'dysplasia associated': 8, 'Familial mandibuloacral dysplasia': 3, 'MADA': 72, 'Mandibuloacral dysplasia type A': 19, 'Mandibuloacral dysplasia': 109, 'Mandibuloacral dysplasia lipodystrophy': 1, 'Craniomandibular Dermatodysostosis': 1, 'mandibuloacral dysplasia type A': 26, 'Mandibuloacral dysplasia with type A lipodystrophy': 5, 'mandibuloacral dysplasia type A.': 4, 'type-A mandibuloacral dysplasia': 1, 'Mandibuloacral Dysplasia': 27, 'mandibuloacral dysplasia syndrome': 2, 'mandibuloacral dysplasia with type A': 1, 'Craniomandibular dermatodysostosis': 1, 'Mandibuloacral dysplasia Infections': 1, 'Mandibuloacral Dysplasia type A with Partial Lipodystrophy': 1, 'MAD syndrome': 3, 'mandibuloacral dysplasia progeroid syndrome': 2, 'associated dysplasias': 1, 'BE associated dysplasia': 1, 'mandibuloacral dysplasia (MAD) type A.': 1, 'MAD type A': 5, 'Mandibuloacral hypoplasia-associated lipodystrophy': 1, 'A mandibuloacral dysplasia': 1, 'dysplasia-associated': 4, 'MAD-A': 5, 'MAD-B': 2, 'Mandibuloacral dysplasia progeroid syndrome': 1, 'MADA deficiency': 1, 'MADA-deficient': 1, 'mandibuloacral dysplasia type a': 2, 'MADB': 1, 'mandibuloacral dysplasia type b': 1, 'Mandibuloacral Dysplasia type A': 4, 'MADA disease': 2, 'BE-associated dysplasia': 1, 'BE-associated dysplasias': 1, 'Mandibuloacral dysplasia associated with MTX2': 1, 'MADaM': 2, 'mandibuloacral dysplasia with lipodystrophy of type A': 1, 'mandibuloacral dysplasia syndromes': 1, 'Mandibuloacral Dysplasia with type A': 1, 'autosomal recessive mandibuloacral dysplasia': 2, 'mandibuloacral dysplaisa': 1, 'Atypical dysplasia': 1, 'mandibuloacral dysplasia-associated lipodystrophy': 4, 'lipodystrophic mandibuloacral dysplasia type A': 1, 'MADA-like': 1, 'mandibuloacral dysplasia, type A.': 1, 'Mandibuloacral dysplasia with': 1, 'mandibuloacral dysplaysia with type A lipodystrophy': 1, 'Mandibuloacral "dysplasia': 1, 'LLUC-associated dysplasia': 1, 'Mandibuloacral dysplasia with accelerated ageing and type A': 1, 'CH-MADA': 1, 'Mandibuloacral dysplasia type A MADA': 1, 'Mandibuloacral Dysplasia Type A': 1, 'mandibuloacral malformation': 1, 'Dysplasia associated': 1, 'UC-associated dysplasia': 4, 'craniomandibular dermatodysostosis': 1, 'mandibuloacral': 1, 'Associated dysplasia': 1, 'MAD disease': 1, 'IBD-associated dysplasia': 1, 'MADA syndrome': 1, 'mandibuloacral dysplasia Type A': 1, 'mandibuloacral dysplasia type A (MADA) syndrome': 1, 'MAD, type A': 1, 'Mandibuloacral Dysplasia with Type A Lipodystrophy': 1, 'MADA type B': 1, 'Mandibuloacral dysplasia syndrome': 1, 'Mandibuloacral dysplasia with type A': 1, 'Mandibuloacral dysplasia-type A lipodystrophy': 1, 'lipodystrophy-linked MAD': 1, '-associated dysplasia': 1, 'Mandibuloacral dysplasia I': 1, 'mandibuloacral displasia': 1, 'UCD': 1, 'Mandibuloacral dysplasia with type b lipodystrophy': 1, 'A Mandibuloacral Dysplasia with Lipodystrophy': 1, 'Lamin-A/C Type A Mandibuloacral Dysplasia': 1, 'Mandibuloacral dysplasia A type': 1, 'mandibuloacral dysplasia associated lipodystrophies': 1, 'MAD with type A lipodystrophy': 1, 'type A mandibuloacral dysplasia': 1, 'MADA associated progeria': 1, 'Mandibuloacral dysplasia type A-associated progeria': 1, 'Mandibuloacral Dysplasia with type A lipodystrophy': 1, '-ASSOCIATED DYSPLASIA': 1, 'MADs': 1, 'Mandibuloacral dysplasia syndromes': 1, 'MAD progeroid syndrome': 1, 'Mandibuloacral dysplasias': 1, 'progeroid MAD': 1, 'MandibuloAcral Dysplasia type A': 1, 'MDPS': 1, 'Mandibuloacral dysplasiaa': 1, 'A-type MandibuloAcral Dysplasia': 1, 'A MAD': 1, 'Mandibuloacral dysplasia with lipodystrophy': 1, 'mandibuloacral disease': 1, 'LMNA MAD': 1, 'DYSPLASIA-ASSOCIATED': 1, 'atypical dysplasia': 1, 'mandibuloacral dysplasia associated to MTX2': 1, 'MADaM MTX2': 1, 'MAD type A.': 1, 'MAD-B-like disorder': 1, 'MAD-B.': 1, 'MAD-B-like disease': 1} | mandibuloacral dysplasia |
Disease | MESH:C535706 | {'Type B mandibuloacral dysplasia': 1, 'type B mandibuloacral dysplasia': 5, 'mandibuloacral dysplasia with type B lipodystrophy': 7, 'MADB': 35, 'mandibuloacral dysplasia-type B': 3, 'MAD-B-like disease': 2, 'MAD-B.': 2, 'MAD-B-like disorder': 2, 'MAD-B': 13, 'Mandibuloacral dysplasia type B': 5, 'type A and type B lipodystrophy': 1, 'mandibuloacral dysplasia type B': 13, 'MAD type B': 4, 'lipodystrophy type B': 1, 'MADB disorders': 1, 'MADB-associated lipodystrophy': 1, 'Mandibuloacral Dysplasia type B': 5, 'MAD-B syndromes': 3, 'Mandibuloacral dysplasia type A and B': 1, 'mandibuloacral-dysplasia type B': 1, 'mandibuloacral dysplasia type-B': 2, 'type B lipodystrophy': 4, 'mandibuloacral dysplasias type A and B': 1, 'Mandibuloacral Dysplasia with Type B Lipodystrophy': 1, 'MAD-A/B types1, 2, 3': 1, 'autosomal recessive mandibuloacral dysplasia with type B lipodystrophy': 1, 'type A or type B MAD': 1, 'Mandibuloacral dysplasia with type B lipodystrophy': 3, 'mandibuloacral dysplasia, type B': 1, '-type B lipodystrophy': 1, 'MAD with type A and B lipodystrophy': 1, 'mandibuloacrodysplasia with type B lipodystrophy': 1, 'MADB syndrome': 1, 'mandibuloacral dysplasia type A and B': 2, 'B Mandibuloacral Dysplasia with Lipodystrophy': 1, 'MADB progeroid syndromes': 1, 'MAD with type B lipodystrophy': 1, 'lipodystrophy (type B)': 1, 'Mandibuloacral Dysplasia with type B lipodystrophy': 1, 'MADA) and B': 1, 'MAD type B.': 1, 'MandibuloAcral Dysplasia type B': 1, 'Mandibuloacral Dysplasia B': 1, 'B-type lipodystrophy': 1, 'B MAD': 1, 'A or B MAD': 1, 'Mandibuloacral dysplasia Type A lipodystrophy Type B lipodystrophy': 1, 'mandibuloacral dysplasia type B.': 1, 'MADB-106 carcinomatosis': 1} | MADB |
Disease | MESH:C535707 | {'Type 3 Treacher Collins Syndrome': 1, 'type 3 TCS': 1, 'Type 3 TCS': 1, 'Treacher Collins syndrome 3': 3, 'Treacher Collins syndrome-3': 1, 'TCS3': 9, 'Treacher-Collins 3 - Syndrome': 1, 'Treacher Collins syndromes 3': 1, 'Treacher-Collins syndrome 3': 2, 'TCS types 1, 2, and 3': 1, 'Type 3 Treacher Collins Syndrome Facial Malformation': 1, 'polr1c Type 3 TCS': 1, 'TCS type 3': 1, 'Treacher Collins syndrome (TCS) types 1-3': 1, 'TCS 3': 1} | TCS3 |
Disease | MESH:C535708 | {'heart, lung, liver, kidney,': 5, 'triphalangia of thumbs': 1, 'heart, lung, and vascular emergencies': 1, 'heart, liver, lung': 8, 'lung, heart and liver': 3, 'lung and heart anomalies': 3, 'heart and lung laterality defects': 1, 'heart and lung defects': 18, 'defects in heart and lung development': 3, 'heart and lung, liver and kidney dyfunction': 1, 'heart, lung, liver or kidney': 2, 'heart, lung, liver, kidney': 18, 'anomalies of thumb hypoplasia': 1, 'heart, lung, liver': 5, 'heart, liver, and lung': 2, 'heart, lung, liver, or kidney illness': 1, 'anomalies of face, fingers, lung, heart,': 1, 'anomalies of the kidneys, lungs, and heart': 1, 'heart, lung, skin, and gastrointestinal involvement': 1, 'liver, kidney, heart and lung': 1, 'liver, lungs, heart, kidneys, and': 1, 'heart, vascular, lung, or bone/joint problems': 5, 'heart, liver, and lung conditions': 1, 'congenital heart, and thumb anomalies': 1, 'damage to the kidneys, liver, lung, heart, or eyes': 1, 'Pulmonary aplasia and triphalangia of the thumb': 1, 'skin, articular, lung, heart, gastrointestinal involvement': 1, 'deficiency of the liver, kidney, lung, or heart': 1, 'congenital anomalies of the heart, lungs': 2, 'damage to the eyes, heart, lungs, liver, kidneys': 1, 'heart, lung, diabetes': 1, 'Heart Lungs Eyes Liver Cornea': 1, 'heart, lungs, liver': 5, 'heart, lung, urinary, and neurological problems': 1, 'lung, liver, heart': 1, 'heart, lung, kidney, and liver pathologies': 1, 'heart, lung, liver, and kidney pathologies': 1, 'lung, and heart defects': 1, 'heart, liver, lung, kidney': 3, 'heart, liver, lung, or bleeding': 1, 'skeletal, heart, and lung anomalies': 1, 'heart, kidney, liver, lung': 1, 'Triphalangia of the thumb': 1, 'lung and heart defects': 10, 'developmental defects of the heart, lungs, and': 1, 'congenital anomaly of the heart, gastrointestinal system, or lungs': 1, 'congenital anomalies of the heart, gastrointestinal system, and lungs': 1, 'heart, lung, kidney, or liver problems': 1, 'heart, lung and liver': 3, 'craniofacial, thumb, and heart anomalies': 2, 'congenital/chromosomal anomalies of the brain, spine, heart, or lungs': 1, 'heart-lung MPS': 1, 'Triphalangia': 1, 'developmental anomalies of the eye, heart, kidney, lung, skin and testes': 1, 'of the heart and lung systems': 1, 'liver, kidney, heart, lung': 4, 'heart, liver, lung and kidney': 2, 'Metastatic calcification of the heart, lungs and kidneys': 1, 'Lung or heart defects': 2, 'triphalangia': 5, 'liver, heart, lung, and renal injuries': 1, 'heart, lung, and vascular problems': 1, 'heart, lung, or genital anomalies': 1, 'heart, lung, liver, or renal function': 1, 'bone, heart, liver, lung, and kidney': 1, 'liver, lung, heart, and pancreas': 1, 'heart, liver, lung, blood, and': 1, 'heart, lung and kidney developmental defects': 1, 'heart, lung, liver,': 9, 'developmental defects in the heart and lungs': 1, 'defective heart and lung development': 2, 'lung/heart developmental anomalies': 1, 'skeletal, heart, and lung developmental anomalies': 1, 'deficiency of heart-lung qi': 2, 'craniofacial, thumb and heart anomalies': 1, 'anomalies of the throat, esophagus, heart, or lungs': 1, 'anomalies of the lung, heart': 1, 'heart, lung, renal or liver diseaseDementia': 1, 'heart, eye and lung': 1, 'heart, eye, and lung': 1, 'heart and lungs anomalies': 1, 'heart, liver, kidney, lung,': 1, 'the heart, lungs, liver and kidneys': 1, 'ailments of liver, heart, joints, and lungs': 1, 'heart, lung, liver and kidney': 2, 'heart and lung developmental defects': 1, 'heart and lung asymmetry defects': 2, 'liver, kidney, heart, or lung': 1, 'developmental anomalies of the heart and lungs': 1, 'heart, lung, and vascular overload': 1, 'liver, kidney, heart, and lung disasters': 1, 'developmental defects of the heart and lungs': 1, 'Heart and Lung Developmental Defects': 1, 'Developmental Defects of the Heart and Lungs': 1, 'developmental heart and lung defects': 1, 'to the heart, lung, liver, and kidney': 1, 'congenital heart and lung conditions': 1, 'the heart, lungs, kidney or liver': 1, 'lung, skin, eye or heart involvement': 1, 'craniofacial, heart and lung defects': 1, 'triphalangia of the thumbs': 1, 'lung, liver or heart': 1, 'heart, liver, kidney, lung': 4, 'heart, kidney, liver, lung, and eye injury': 1, 'Lung Liver Heart': 1, 'liver, kidney, lung or heart deficiency': 1, 'Heart, lung, renal, liver or': 1, 'liver, lung, kidney, or heart problems': 1, 'calcification of the kidney, aorta, heart, and lung': 1, 'heart or lungs anomalies': 1, 'congenital anomalies of the heart, lung': 1, 'defects of the heart and lungs': 1, 'lungs, heart, and liver': 1, 'liver, kidney, lung, or heart deficiency': 2, 'liver, heart and lung': 1, 'lung, heart and liver defects': 1, 'liver, heart, lung': 1, 'Heart, lung, liver, kidney': 1, 'heart and lung qi deficiency': 1, 'heart, liver, or lung problems': 1, 'heart, lung, liver or renal condition': 1, 'heart, lung, kidney, liver,': 1, 'heart, lung, liver and kidney-related': 1, 'kidney, heart, liver, lung, intestine & bladder': 1, 'heart, lung, liver, kidney, and multi-organ ailments': 1, 'renal, lung, liver, and heart injuries': 1, 'heart, lung, or systemic ailments': 1, 'of the heart, lung, liver': 1, 'lung, heart, liver, kidney': 3, 'heart, lung and liver problems': 1, 'congenital heart and lung anomalies': 1, 'congenital lung or heart conditions': 1, 'Lung Kidney Liver Heart': 1, 'heart, liver, kidneys, and lungs': 1, 'anomalies of the heart, lungs, esophagus,': 1, 'Heart Lung Liver': 1, 'lung, heart, liver': 3, 'Heart-lung 1': 1, 'triphalangia of the main thumb': 1, 'TRIPHALANGIA OF THE THUMB': 2, 'congenital heart, lung, and intestinal anomalies': 1, 'Manouvrier syndrome': 1, 'craniofacial, renal, heart and thumb defects': 1, 'congenital anomalies of the heart or lung': 1, 'heart, lung, or liver': 1, 'lung, liver, heart and kidney': 1, 'anomalies of the lungs and heart': 1, 'Heart-Lung-Muscle Anti-SAE Syndrome': 1, 'triphalangia of both thumbs': 1, 'heart, lung, liver and renal function': 1, 'NHLBI type A and B': 1, 'the heart, liver, lung, kidney': 1, 'lung, heart, joint, kidney, gastrointestinal, liver, neurological, and eye diseases': 1, 'lung, heart, gastrointestinal, liver, kidney': 1, 'heart, liver, lung,': 1, 'heart, liver, lung, kidney, pancreas': 1, 'heart, lung, liver, or kidney': 3, 'Heart, lung, kidney, and liver': 1, 'heart, lung, liver, and kidney': 2, 'heart, lung, and liver': 2, 'lung, heart, and liver problems': 1, 'heart, liver, lung, kidney, and blood system': 1, 'heart, lung, liver and kidney problems': 1, 'anomalies of the thumb and heart': 1, 'congenital anomalies of the heart or lungs': 1, 'heart, liver, kidney, and lung': 2, 'defects of the heart, lungs and diaphragm': 1, 'Syphiloma of the Heart, Lungs, and Liver': 1, 'lung, heart, liver and kidney': 1, 'heart, kidney, lung, and liver': 1, 'heart, liver, lung, and kidney': 1, 'heart, lung, renal and liver': 1, 'heart, liver, kidney, lung, nerve, mental': 1, 'heart, kidney, liver, and lung illnesses': 1, 'heart, liver, lung, and': 1, 'of the heart, lung, liver, kidneys, pancreas': 1, 'heart, liver, or lung conditions': 1, 'heart, lung, liver, kidney, blood': 1, 'liver/heart/lung/kidney problems': 1, 'heart, kidney, liver, lung, or': 1, ', heart, lung, liver and kidney': 1, 'Deficiency of the heart-lung qi': 1, 'triphalangia of the': 1, 'lungs, liver, and heart': 1, 'heart, liver, kidney or lung': 1, 'heart or lung anomalies': 1, 'triphalangia of the left thumb': 1, 'to the heart, lung, liver and kidney': 1, 'congenital anomaly of the heart, gastrointestinal system, or lung': 1, 'Defects in heart and lung development': 1, 'lungs, heart, eyes,': 1, 'deficiency of liver, kidney, lung and heart': 1, ', lung, heart and abdominal organs anomalies': 1, 'lung, heart, kidney, liver,': 1, 'heart, liver, kidney, or lung': 1, 'of the heart, lungs, liver, kidneys': 1, 'congenital anomalies affecting heart, brain and/or lungs': 1, 'situs anomaly of the heart and lung': 1, 'ailments of the heart, lung, liver, kidney': 1, 'Kidney Heart Liver Lung Pancreas': 1, 'eye, heart and lung defects': 1, 'heart, liver, lung, kidney,': 1, 'liver, heart, joint and lung ailments': 1, 'calcification of the kidneys, heart and lungs': 1, 'lung, heart, kidney, liver, or': 1, 'lung, heart, and eye and skin involvement': 1, 'developmental defects in heart and lung': 1, 'developmental defects of the lung, skeleton and heart': 1, 'the lungs, skin, liver, heart, and': 1, 'of the heart, lung, kidney, or liver': 1, 'neurological, heart and lung': 1, 'lung and heart asymmetry defects': 1, 'heart, lung, kidney and liver': 1, 'defects of the lungs, vertebrae, heart': 1, 'heart-lung syndrome': 1, 'heart, lung, kidney, liver, spinal or gastrointestinal': 1, 'heart, lung, and spine defects': 1, 'leukemia Congenital anomalies Heart, lung, vascular and tracheobronchial anomalies': 1, 'heart, lungs, kidney, or liver illness': 1, 'defects in eye, lung, heart and': 1, 'liver, heart, lung, kidney,': 1, 'heart and lung anomalies': 1, 'heart-lung deficiency': 1} | heart and lung defects |
Disease | MESH:C535709 | {'familial hypercalciuria hypomagnesemia': 1, 'FHHNC disease': 1, 'FHHNC': 2, 'FHHNC diseases': 1, 'Manz': 2, 'familial hypomagnesemia with hypercalciuria': 7, '8Familial hypomagnesemia with hypercalciuria': 1, 'Mich-aelis-Manz syndrome': 1, 'Michaelis-Manz syndrome': 2, 'Familial hypomagnesemia with hypercalciuria': 3, 'Manz syndrome': 1, 'autosomal recessive disorder familial hypomagnesemia with hypercalciuria': 1, 'hypomagnesemia hypercalciuria syndrome': 1, 'HHS': 1} | familial hypomagnesemia with hypercalciuria |
Disease | MESH:C535710 | {'type IA) MSUD': 1, 'maple syrup urine disease, type 1A': 1, 'MSUD Type IA': 1, 'MSUD type IA': 1, 'maple syrup urine disease, type 1a': 1, 'MSUD type 1a': 1, 'type IA maple syrup urine disease': 1, 'maple syrup urine disease type 1a': 1, 'Maple Syrup Urine disease type 1a': 1, 'type 1A MSUD': 1, 'IA MSUD': 1} | type IA) MSUD |
Disease | MESH:C535711 | {'MSUD Type IB': 1, 'MSUD type IB': 1, 'maple syrup urine disease type 1B': 1, 'MSUD1B': 1, 'Maple Syrup Urine Disease Type 1B': 1, 'MSUD1B.': 1, 'Type IB maple syrup urinary disease': 1, 'maple syrup urine disease 1b': 3, 'Syrup Urine Disease Type 1B': 1, 'maple syrup urine disease (MSUD) type 1B': 1, 'maple syrup urine disease type 1A/1B': 1, 'type IB MSUD': 1} | maple syrup urine disease 1b |
Disease | MESH:C535712 | {'Type II MSUD': 1, 'MSUD Type II': 1, 'MSUD.2': 1, 'MSUD syndrome.2': 1, 'MSUD type 2': 1, 'maple syrup urine disease type II': 1, 'type 2 maple syrup urine disease': 1, 'Maple syrup urine disease type 3': 1, 'MSUD type II': 1, 'maple syrup urine disease 2-hydroxyacyl CoA lyase 1': 1, 'maple syrup II': 1, 'type II MSUD': 2, 'type Ia or type Ib MSUD': 1, 'E2 transacylase-deficient (type II) maple syrup urine disease': 1, 'Maple syrup urine disease type Ib': 1, 'maple syrup urine disease type Ib': 2, 'MSUD Ib': 1, 'Maple syrup urine disease, type 2': 1, 'MSUD2': 1, 'maple syrup urine disease type 2': 1, 'Maple syrup urine disease (MSUD) type Ib': 1, 'MSUD II': 1} | type II MSUD |
Disease | MESH:C535714 | {'Congenital arthrogryposis multiplex': 3, 'arthrogryposis multiplex congenital': 57, 'arthrogryposis multiplex': 87, 'arthrogryposis multiplex syndromes': 2, 'congenital arthrogryposis multiplex': 18, 'arthrogryposis multiplex congenital and autism spectrum disorders': 1, 'arthrogryposis multiplex congentita': 2, 'congenital multiplex arthogryposis': 1, 'multiplex mono-neuropathy': 1, 'AMC': 25, 'Arthrogryposis multiplex': 19, 'Multiplex neuropathy': 1, 'Multiplex Neuropathy': 1, 'neuropathy multiplex': 1, 'Paraplegia and arthrogryposis multiplex': 1, 'arthrogryposis multiplex complex': 2, 'Arthrogryposis multiplex congenital': 21, 'Arthrogryposis Multiplex Congenital': 5, 'arthrogryposis multiplex congenital (multiple fixed joints': 1, 'multiplex neuropathy': 6, 'Arthrogryposis congenital multiplex': 1, 'mono- and multiplex neuropathy': 1, 'arthrogryposis multiplex congentia': 4, 'sensory-motor multiplex neuropathy': 1, 'congenital multiplex arthrogryposis': 2, 'Congenital non-progressive peripheral neuropathy': 1, 'Arthrogryposis multiplex congenital 114': 1, 'arthrogryposis multiplex congenital X-linked type 1': 1, 'Arthrogryposis Multiplex': 2, 'arthrogryposis multiplex congenital and congenital MD': 1, 'AM)': 1, 'AM': 1, 'arthrogryposis multiplex congenital without pulmonary hypoplasia': 1, 'arthrogryposis multiplex congenits': 1, 'developmental arthrogryposis multiplex': 1, 'mono-neuropathy multiplex': 1, 'stiffness with arthrogryposis multiplex congenital': 1, 'arthrogryposis multiplex cogenita': 1, 'non-syndromic progressive peripheral hearing loss': 1, 'Myogenic arthrogryposis multiplex congenital type 3': 1, 'Arthrogryposis multiplex complex': 1, 'Artrogryposis multiplex congenital,': 1, 'Multiple arthrogryposis multiplex': 1, 'AMC condition': 1, 'Arthrogryposis Multiplex Congenital 6': 1, 'arthrogryposis multiplex congenital disorder': 1, 'Arthrogryposis multiplex congenita2': 1, 'arthrogryposis multiplex cangenita': 1, 'Arthrogryposis multiplex congenitab': 1, 'arthrogryphosis congenital multiplex': 1, 'arthrogryposis multiplex (AM) syndrome': 1, 'Arthrogryposis multiplex congenitac': 1, 'arthrogryposis multiplex congenital syndrome': 1, 'arthrogryposis multiplex congeita': 1, 'autosomal recessive arthrogryposis multiplex congenital': 1, 'autosomal recessive arthrogryposis multiplex': 1, 'arthrogryposis congenital multiplex': 1, 'Sensory neuronopathyMononeuritis multiplex': 1, 'Arthrogryposis multiplex congenital 2': 1} | arthrogryposis multiplex |
Disease | MESH:C535715 | {'sensory-motor distal axonopathy': 5, 'distal motor neuropathy': 159, 'distal motor deficiency': 4, 'Distal motor neuropathy': 14, 'distal hereditary motor, Jerash type': 1, 'DSMA2': 2, 'DMN': 5, 'distal motor neuropathies': 5, 'distal motor and sensory impairment': 3, 'distal motor-sensory axonopathy': 2, 'distal sensory and motor impairment': 1, 'Jerash': 2, 'HMNJ': 1, 'motor distal neuropathy': 2, 'distal motor loss': 1, 'Distal Motor Neuropathy': 2, 'Distal motor neuropathies': 2, 'Spinal muscular atrophy, distal, autosomal recessive, 2': 1, 'distal motor or combined neuropathy': 1, 'distal herediatary motor neuropathy': 1, 'DML': 1, 'dHMN Jerash hereditary motor neuronopathy': 1, 'distal motor neuropathy of': 1, 'Distal spinal muscular atrophy, 2': 1, 'distal-motor neuropathy': 1, 'dSMA': 1, 'distal axonal-type motor neuropathy': 1, 'the Jerash': 2, 'sensory-motor distal axonopathies': 1, 'distal motor/sensory axonopathy': 1} | distal motor neuropathy |
Disease | MESH:C535716 | {'ENDOPAIN-4D': 1, 'EMS:4D': 1, 'CMT4D': 57, 'LOM': 209, 'SEMAPHORIN-4D': 1, '2D.4D': 1, 'IC2 LOM': 11, '2D:4D': 22, '4DS': 7, 'CMT 4D': 4, '4D.': 1, '4D syndrome': 2, '4DF': 1, 'Charcot-Marie-Tooth type 4D': 6, 'Charcot-Marie-Tooth disease type 4D': 22, 'CMT4D.': 17, 'MRSA 4D': 1, '4DP': 3, 'cSEMA4D': 1, 'Charcot-Marie-Tooth disease type 4D.': 7, 'LOM vaccine': 2, '11p15 LOM': 6, 'Jeju LOM': 2, 'M2D:4D': 4, 'SEMI-AUTOMATED 4D-': 1, 'GOLD 4D': 1, 'Brigand 4DS 4DL-4SshL': 1, 'BnSPM-4D': 1, 'BnSPD-4D': 1, 'BnDAP-4D': 1, 'Charcot-Marie Tooth Disease Type 4D': 1, '4d': 3, 'Dam1C-4D[AurB': 1, 'LARGE 4D NUCLEOFECTION': 1, '4D': 17, '4Ds - Defects': 1, '2BL.4DS': 1, 'LOM virus': 1, 'Charcot-Marie-Tooth type 4D disease': 2, 'HMSNL': 5, '4D disease': 1, 'IC1 LOM': 3, 'PDE4D deficiency': 3, '2D: 4D': 1, 'R2D: 4D': 1, 'CMT4D neuropathy': 1, 'Charcot-Marie Tooth Disease type 4D': 1, 'R2D:4D': 8, 'feminised 2D:4D': 1, 'L2D:4D': 10, 'GOLD stage - 4D 4A': 1, 'Complement 4d': 2, '-4D.1': 2, '-4D.2': 1, 'Charcot-Marie-Tooth Disease Type 4D': 2, '4Ds': 2, 'CMT type 4D': 2, 'P4D': 3, 'Charcot Marie Tooth 4D.': 1, 'Charcot Marie Tooth disease type 4D and 4G': 2, 'GEOMON-4D': 1, 'LOM LSPV': 1, 'S4D': 1, 'DDx2-4D': 1, 'CMT4D disease': 2, 'Charcot-Marie-Tooth Type 4D Disease': 1, 'LOM of IC1': 1, '4D-SZ': 1, 'A-4D': 1, 'LOM:404.453': 1, '-4D': 3, '4D problems': 1, 'UWO5-4D': 1, 'YK-4C, -4D': 1, '4DDD': 1, 'AD': 1, 'MEC-4d': 3, 'sLOM': 1, '-4DS': 2, 'Charcot-Marie tooth disease types 4D and 4': 1, 'IC2-LOM': 3, 'LOM M14': 1, 'LOM defects': 1, 'sSEMA4D': 1, 'mec-4d degeneration': 1, '3D and 4D': 1, 'CMT4d': 1, 'Charcot-Marie-Tooth disease type 4d': 1, 'Charcot-Marie-Tooth (CMT4d) disease': 1, 'rotation LOM': 1, 'Gob-4d': 1, '-BP100-4D': 1, '2-4D': 1, '4DN': 2, 'BM4D': 2, '4D-EC': 1, 'Flc-LOM': 1, 'Charcot-Marie-Tooth disease, type 4D.': 2, 'Charcot Marie Tooth type 4D': 1, 'Charcot Mary Tooth type 4D': 1, 'EtOHc-4D': 1, 'LG 4D.': 1, 'KASP-4D': 1, 'Charcot-Marie-tooth disease, type 4d': 1, 'la fosfodiesterasa 4D': 1, 'R2D:4D.': 1, 'L2D:4D.': 1, '4D condition': 1, 'Charcot-Marie-Tooth disease 4D.': 2, 'Charcot-Marie-Tooth disease 4D': 2, '-LOM': 1, 'LOM_14': 1, 'Qgns.saw-4D': 1, 'CL4DP': 1, 'Hereditary motor and sensory neuropathy, LOM': 1, 'qPH-4D-2': 1, 'QPh.sau-4D': 1, 'ROLE OF LOM': 1, 'TARGETING THE LOM': 1, 'FED': 1, 'LF2D:4D': 1, 'mec-4d': 1, 'FIRE': 1, 'Charcot Marie Tooth disease type 4D': 1, '-4d': 1, 'A2D:4D': 1, '2D : 4D': 1, 'Charcot-Marie Tooth disease (CMT) type 4D': 1, 'PRM': 1, 'GOLD stage 4D': 1, 'TaD14-4D': 1, 'CKD1-4D': 1, 'COLUMBIA-4D': 1, 'COLUMBIA-4D.': 1, "'4Ds' syndrome": 1, '2, 4D poisoning': 1, 'Charcot-Marie-Tooth disease, type 4D': 1, 'CD4D': 1, 'Fe': 1, 'Fe-deficient': 1, 'Fe deficiency': 1, 'Fe sufficiency': 1, 'CMT': 1, 'Charcot-Marie-Tooth 4D disease': 1, '4DFD': 1, 'IC5-4D': 1, 'MF': 1, 'LOM limitation of movement': 1, '4D dependence': 1, ': 4D': 1, '4D-HyCoSy': 1} | LOM |
Disease | MESH:C535718 | {'PECULIAR': 29, 'IMMUNOCHEMICAL PECULIARITIES': 1, 'Dubowitz syndrome': 196, 'Diseases peculiar': 1, 'PECULIAR ANATOMO-CLINICAL': 1, 'DS': 10, 'Dubowitz disease': 24, 'PECULIARITIES OF': 36, 'PECULIARITIES': 141, 'CLINICO-ROENTGENOLOGICAL PECULIARITIES': 1, 'Dubowitz-like syndrome': 37, 'autosomal recessive Dubowitz syndrome': 1, 'Dubowitz symdrome': 1, 'Dubowitz syndome': 1, 'VERY PECULIAR': 1, 'PECULIAR ASPECT': 1, 'peculiar facies': 7, 'Dubowitz': 20, 'dubowitz syndrome': 2, 'PPR': 1, 'FUNCTIONAL PECULIARITIES OF': 1, 'Dubowitz, Omenn and Barth syndromes': 2, 'ETHNICAL PECULIARITIES OF': 1, 'CERTAIN EPIDEMIOLOGICAL PECULIARITIES': 1, 'PECULIARITY': 8, 'Intermediate/Dubowitz Syndrome': 1, 'DEPENDING ON PECULIARITIES': 1, 'peculiar disorder': 1, 'PECULIAR HAILSTORM': 1, 'PECULIARITIES AND': 2, 'Dubowitz-like phenotype': 2, 'Dubowitz-like syndromes': 1, 'Dubowitz Syndrome': 16, 'Dubowitz myopathy': 1, 'SOME PECULIARITIES': 10, 'PECULIAR ASPECT OF': 1, 'SOME PECULIARITIES OF': 7, 'PECULIAR CLINICAL EVOLUTION': 1, 'PECULIAR VERDICT': 1, 'ON PECULIARITIES': 3, 'PECULIARITIES OF REGENERATION': 1, 'Dubowitz syndromes': 2, 'CLINICAL PECULIARITIES OF': 1, 'EEG PECULIARITIES': 1, 'PECULIAR EVOLUTION OF': 1, 'MORPHOLOGICAL PECULIARITIES OF THE THROMBOCYTES': 1, 'Dubowitz-like condition': 1, 'Dubowitz disease 3a': 1, 'peculiar': 1, 'PECULIAR HEAT PHENOMENON': 1, 'FUNCTIONAL PECULIARITIES': 1, '"Dubowitz-like" syndrome': 1, 'MORPHOFUNCTIONAL PECULIARITIES': 1, 'ME PECULIAR': 1, 'MORPHOLOGICAL PECULIARITIES OF MESENCHYMOPATHIES': 1, 'DS syndrome': 1, 'Dubowitz Disease': 1, 'ON PECULIARITIES OF': 5, 'CLINICAL PECULIARITIES': 1, 'Dubowitz and Noonan syndromes': 1, 'DubS': 1, 'Dubowitz-like" condition': 1, 'DubS.': 1, 'DubS-like syndrome': 1, 'DIFFERENTIAL DIAGNOSTIC PECULIARITIES': 1, 'EPIDEMIOLOGICAL PECULIARITIES': 1, 'ITS PECULIARITIES': 1, 'PECULIARITIES OF ALIGNER': 1, 'PECULIARITIES OF ONSETS': 1, 'BIOCHEMICAL PECULIARITIES': 1, 'ELECTROCARDIOGRAPHIC PECULIARITIES': 1, 'Dubowitz phenotype': 1, 'DS genitourinary alterations': 1, "Dubowitz and Seckel's": 1, 'PECULIAR PROBLEMS OF FUNCTIONAL REHABILITATION': 1, 'MACROARCHITECTONIC PECULIARITIES': 1, 'Dubowitz-Syndrome': 1, 'CERTAIN PECULIARITIES': 2, 'ASSESSMENT OF PECULIARITIES': 1, 'PECULIAR HAIL': 1, 'HISTOENZYMOLOGICAL PECULIARITIES OF': 1, 'MORPHOLOGICAL PECULIARITIES': 3, 'SOME EPIDEMIOLOGICAL PECULIARITIES OF': 2, 'DWS': 1, 'PECULIAR OSTEONEPHROVASCULO-INTERSTITIAL SYNDROME': 1, 'PBB': 1, 'Peculiar Diseases': 1, "Dubowitz's syndrome": 1, 'PECULIAR INTRACYTOPLASMIC': 1, 'ON CLINICO-DIAGNOSTIC PECULIARITIES': 1, 'ON TISSUE PECULIARITIES': 1, 'SOME PECULIARITIES OF ENDOSCOPIC ANATOMY': 1, 'BIOCHEMICAL PECULIARITIES OF': 1, 'PECULIAR LESIONS': 1, 'peculiar fingers': 1, 'PECULIARITIS': 1, 'HEMOPOIETIC PECULIARITIES': 1, 'DOSIMETRIC PECULIARITIES': 1, 'FAMILIAL PECULIARITY': 1, 'PECULIAR FACIES': 1, 'HISTOGENETIC PECULIARITIES OF THE REGENERATIVE PHENOMENA': 1, 'GENETIC PECULIARITIES': 1, 'Dubowitz syndrome 14q.32 deletion syndrome': 1, 'Dubowitz and chromosome 14q32 deletion syndromes': 1, "Dubowitz's disease": 1, 'PECULIARITIES OF DISTURBANCES': 1, 'OF INDIVIDUAL PECULIARITIES OF CONCEPT': 1, 'PECULIAR KIDS': 1, 'Dubowitz 2019': 1, 'PECULIAR ASPECTS': 1, 'PECULIAR PROPERTIES OF': 1, 'PECULIARITIES OF HORMONAL DISTURBANCES': 1, 'PECULIARITIES OF DIAGNOSTICS': 1, 'SOME PECULIAR': 1, 'CYTOPHYSIOLOGICAL PECULIARITY': 1, 'MORPHOLOGICAL PECULIARITIES OF': 1, 'Dubowitz-type 6': 1, 'SOME PECULIARITIES CONCERNING THE ANATOMY OF': 1, 'PECULIAR PARTICLES': 1, 'PECULIAR MUTATION OF THE PINE MARTEN': 1, 'VECTORCARDIOGRAPHIC PECULIARITIES': 1, 'ANTOMICAL PECULIARITIES OF': 1, 'THEIR PECULIARITIES': 1, 'FEW PECULIARITIES': 1, 'PPS': 1, "Dubowitz' syndrome": 1, 'congenital peculiar vascular syndrome': 1, 'THE PECULIARITIES OF': 1, 'venous peculiarities': 1, 'peculiarities': 1, 'peculiarities and disorders of': 1, 'Rett (1) Dubowitz (1) syndromes': 1, 'PECULIARITIES OF ESTIMATION': 1, 'Dubowitz-syndrome': 1, 'peculiar disease': 1, 'PECULIARITIES OF CHANGED INDICES OF': 1, 'peculiaritis': 1, 'Dubowitz, Floating-Harbour and Cockayne syndromes': 1, 'ITS PECULIARITIES IN': 1} | Dubowitz syndrome |
Disease | MESH:C535720 | {'duodenal stenosis': 1029, 'duodenal atresia': 1269, 'duodenal ulcer stenosis': 5, 'Congenital duodenal stenosis': 27, 'duodenal and ileal atresias': 1, 'Duodenal atresia': 304, 'Malignant duodenal stenosis': 3, 'familial duodenal atresia': 3, 'oesophageal and duodenal atresias': 3, 'oesophageal, duodenal and rectal atresias': 1, 'Duodenal and small intestinal stenosis': 1, 'gastric or duodenal stenosis': 9, '-duodenal peptic stenosis': 1, 'Congenital duodenal atresia': 13, 'duodenal and/or biliary stenosis': 1, 'Familial duodenal atresia': 5, 'Congenital Duodenal Atresia': 3, 'Duodenal stenosis': 175, 'duodenal atresia/stenosis': 26, 'duodenal atresia or stenosis': 35, 'DA type III': 1, 'DA': 75, 'stenosis of the duodenal bulb': 7, 'Familial aortic atresia': 1, 'duodenal stenosis in part II or': 1, 'duodenal or biliary stenosis': 2, '-duodenal stenosis': 3, 'obstructive duodenal stenosis': 1, 'stenosis of the duodenal papilla': 1, 'pyloric or duodenal stenosis': 5, 'duodenal atresias': 25, 'stenosis of the duodenal lumen': 1, 'congenital duodenal stenosis': 23, 'stenosis of the duodenal bulbs': 1, 'antral (AA) and duodenal atresias': 1, 'Duodenal Atresia': 52, 'Neonatal duodenal stenosis': 1, 'duodenal and esophageal atresia': 10, 'duodenal stenosis or atresia': 10, 'duodenal atresia and obstructions': 1, 'THERAPY OF DUODENAL ATRESIA': 1, 'Membranous duodenal stenosis': 5, 'duodenal stenosis/atresia': 10, 'esophageal and duodenal atresia': 27, 'Esophageal and or duodenal atresia': 1, 'stenosis of the great duodenal papilla': 1, 'benign duodenal stenosis': 5, 'biliary or duodenal stenosis': 3, 'ischemic duodenal stenosis': 1, 'esophageal or duodenal atresia': 11, 'non-duodenal small bowel atresia': 1, 'premature atresia of cranial sutures': 2, 'duodenal atresia) abnormalities': 1, 'MDP stenosis': 2, 'stenosis of the major duodenal papilla': 23, 'malignant duodenal stenosis': 2, 'Esophageal and duodenal atresias': 1, 'oesophageal, duodenal, and small bowel atresia or stenosis': 1, 'oesophageal/duodenal atresia': 2, 'duodenal atresia or web': 2, 'IA': 1, 'duodenal or ileocolic atresia/stenosis': 1, 'Pyloro-duodenal stenosis': 2, 'duodenal bulb stenosis': 9, 'duodenal or small bowel atresia': 1, 'duodenal ulcer and stenosis': 2, 'Duodenal/Esophageal stenosis': 1, 'duodenal atresia and stenosis': 25, 'Pyloric and duodenal stenosis': 1, 'pyloric and duodenal cicatrizing stenosis': 1, 'arterio-mesenterial duodenal stenosis': 1, 'duodenal stenosis or obstruction': 3, 'congenital duodenal atresia': 9, 'Duodenal Stenosis': 21, 'DA/PA': 1, 'duodenal and pyloric atresia': 2, 'duodenal and oesophageal atresia': 1, 'pyloric/duodenal stenosis': 1, 'Oesophageal and duodenal atresia': 2, 'duodenal and small bowel atresia': 2, 'Familial combined duodenal and jejunal atresia': 1, 'duodenal and anorectal atresia': 1, 'duodenal or bile duct stenosis': 1, 'pyloric or duodenal atresia': 8, 'Duodenal and esophageal atresia': 1, 'esophagus and duodenal stenosis': 1, 'duodenal stenosis and atresia': 4, 'bile duct or duodenal stenosis': 3, 'CASES OF DUODENAL STENOSIS': 1, 'Duodenal atresias': 6, 'duodenal atresia and web': 1, 'Familial syndromic duodenal atresia': 1, 'type III DA': 2, 'type I DA': 1, 'oesophageal or duodenal atresia': 1, 'bile duct and/or duodenal stenosis': 1, 'DUODENAL ATRESIA': 1, 'type-I DA': 1, 'duodenal and biliary stenosis': 3, 'esophageal/duodenal atresia': 8, 'Bile duct and duodenal stenosis': 1, 'Congenital Duodenal Stenosis': 4, 'and duodenal atresia': 1, 'pyloro-duodenal stenosis': 8, 'Cogenital duodenal stenosis': 1, 'Stenosis of the major duodenal papilla': 2, 'stenosis of the major duodenal stenosis': 1, 'Duodenal atresia Genetic syndromes': 1, 'stenosis of the duodenal-jejunal junction': 1, 'duodenal-jejunal stenosis': 1, 'duodenal or gastric stenosis': 1, 'stenosis of major duodenal papilla': 1, 'duodenal and gastric outlet stenosis': 1, 'Duodenal atresia/stenosis': 5, 'type III duodenal stenosis': 3, 'type I or II duodenal stenosis': 1, 'post bulbar duodenal stenosis': 1, 'esophageal, gastric or duodenal stenosis': 1, 'BDS': 1, 'Benign duodenal stenosis': 1, 'Duodenal atresia and stenosis': 9, 'Duodenal atresia or stenosis': 4, 'duodenal or esophageal atresia': 2, 'stenosis at the duodenal apex': 1, 'duodenal deformity/stenosis': 1, 'duodenal atresia with': 1, 'biliary- or duodenal atresia': 1, 'obstruction and stenosis of the duodenal papilla': 1, 'Congenital partial duodenal atresia': 1, 'idiopathic duodenal stenosis': 1, 'Stenosis of the large duodenal papilla': 1, 'biliary and duodenal stenosis': 4, 'duodenal atresia (type II': 1, 'duodenal lumen stenosis': 2, 'Esophageal, duodenal, rectoanal and biliary atresia': 1, 'duodenal atresia 2': 1, 'duodenal sub-stenosis': 2, 'atresia duodenal': 3, 'duodenal (D3) stenosis': 1, 'pyloric and duodenal stenosis': 3, 'duodenal ulceration and stenosis': 1, 'Esophageal and duodenal atresia': 4, 'duodenal or pyloric stenosis': 2, 'membranous duodenal stenosis': 4, 'duodenal stricture and atresia': 1, 'Infrapapillary duodenal stenosis': 1, 'ulcerative duodenal stenosis': 2, 'combined oesophageal and duodenal atresia': 1, 'duodenal ulcerous stenosis': 1, 'Arteriomesenteric duodenal stenosis': 1, 'combined duodenal and esophageal atresia': 1, 'Congenital duodenal atresia and stenosis': 3, 'Familial congenital duodenal atresia': 3, 'duodenal or even colic stenosis': 1, 'atresia or duodenal duplication': 1, 'duodenal (D1D2) stenosis': 1, 'Duodenal ulcer stenosis': 1, 'pyloric-duodenal stenosis': 2, 'Duodenal stenosis of the pars horizontalis inferior': 1, 'cicatricial stenosis of the major duodenal papilla': 1, 'duct and duodenal stenosis': 1, 'Duodenal diaphragm-like stenosis': 1, 'cicatricial stenosis of the MDP': 1, 'familial atresia': 1, 'Duodenal atresia-stenosis': 1, 'atresia of the second duodenal portion': 1, 'gastric antral, duodenal and ileal stenosis': 1, 'biliary and duodenal atresia': 2, 'lapDA': 1, 'duodenal luminal stenosis': 2, 'Duodenal luminal stenosis': 2, 'Congenital membranous duodenal stenosis': 1, 'type-I duodenal atresia': 2, 'type-III duodenal atresia': 1, 'biliary or duodenal atresia': 2, 'Double Duodenal Atresia': 1, 'duodenal ulcer scar stenosis': 1, 'duodenal/jejuna atresia': 2, 'Duodenal atresia 2': 2, 'type I duodenal atresia': 1, 'duodenal atresia type II': 1, 'duodenal obstruction and stenosis': 1, 'Duodenal or gastric obstruction/stenosis': 1, '3 duodenal atresia': 2, 'MDS': 2, 'bilary and duodenal stenosis': 1, 'X-RAY DIAGNOSIS OF DUODENAL STENOSIS': 1, 'CDA': 1, 'Pyloro-duodenal atresia': 1, 'pyloro-duodenal atresia': 2, 'Duodenal atresiaDuodenal atresia': 1, 'pyloric duodenal stenosis': 2, 'stenosis of major duodenal papilla sphincter': 1, 'duodenal and biliary atresia': 5, 'esophageal, duodenal, and anorectal atresias': 1, 'duodenal atresia, stenosis': 1, 'duodenal atresia at': 1, 'duodenal papilla stenosis': 4, 'duodenal or pyloric atresia': 1, 'duodenal obstruction/stenosis': 1, 'duodenal Stenosis': 2, 'LRDA': 1, 'DST': 1, 'Duodenal and biliary atresia': 2, 'Duodenal stenosis and atresia': 1, 'duodenal/ileocolic atresia or stenosis': 1, 'Obstructive duodenal stenosis': 1, 'oesophageal, duodenal, and anorectal atresias': 1, 'stenosis of MDP': 2, 'Pyloro-duodenal congenital stenosis': 1, 'III duodenal atresia': 1, 'duodenal complete atresia': 1, 'Duodenal bulb stenosis': 2, 'preampullary duodenal atresia': 1, 'CDS': 2, 'Duodenal atresia Down syndrome': 1, 'gastric or duodenal atresia': 1, 'duodenal and pyloric atresias': 1, 'duodenal outlet stenosis': 2, 'ulcerative stenosis of the duodenal bulb': 2, 'atresia duodenal or small bowel stenosis': 1, 'esophageal and/or duodenal atresia': 1, 'CONGENITAL DUODENAL STENOSIS': 2, 'functional duodenal stenosis': 1, 'duodenal tumor stenosis': 1, 'duodenal or multiple atresias': 1, 'biliary and duodenal malignant stenosis': 2, 'of the duodenal stenosis': 1, 'Pyloric duodenal stenosis': 1, 'duodenal septum stenosis': 1, 'Double duodenal atresia': 1, 'double duodenal atresia': 3, 'duodenal or papillary stenosis': 1, 'esophageal and duodenal atresias': 3, 'type 1 duodenal atresia': 1, 'gastro-duodenal stenosis': 1, 'stenosis at the duodenal papilla': 1, 'Duodenal atresia Bilateral renal hypoplasia': 1, '2 duodenal stenosis': 1, 'Congenital duodenal wall stenosis': 1, 'Gastric and duodenal stenosis': 1, 'Duodenal stenosis or atresia': 1, 'duodenal atresia type 3': 1, 'oesophageal and duodenal atresia': 2, 'duodenal, sigmoid, and rectal atresia': 1, 'esophageal or duodenal stenosis': 1, 'DS': 3, 'duodenal or choledochal stenosis': 1, 'bulbo-duodenal stenosis': 1, 'esophageal, duodenal, and small bowel atresia or stenosis': 1, 'congenital duodenal atresia/stenosis': 1, 'left renal vein and duodenal stenosis': 1, 'stenosis of the duodenal': 1, 'stenosis of the gastro-duodenal junction': 1, 'stenosis of the major duodenal': 1, 'pyloric and duodenal atresia': 1, 'Esophageal or duodenal atresia': 2, 'duodenal papillary stenosis': 1, 'duodenal atresia and membrane': 1, 'esophageal, gastric, or duodenal atresia': 1, 'esophageal, pyloric, or duodenal stenosis': 1, 'duodenal atresia type I': 1, 'Choledochal and duodenal stenosis': 1, 'duodenal "atresia': 1, 'congenital duodenal membranous stenosis': 1, 'duodenal Atresia': 1, 'Type 1 DA': 1, 'type 1 DA': 1, '3 DA': 2, 'Duodenal and Biliary Atresia': 1, 'tracheoesophageal and duodenal atresia': 1, 'Malignant gastric and duodenal stenosis': 1, 'Postbulbar duodenal stenosis': 1, 'duodenal stenosis or stricture': 1, 'Chronic duodenal stenosis': 3, 'antral and duodenal stenosis': 1, 'duodenal or a pyloric stenosis': 1, 'duodenal atresia/obstruction': 1, 'duodenal-jejunoileal atresia': 1, 'duodenal/jejunoileal atresia': 1, 'or duodenal stenosis': 1, 'duodenal deformity or stenosis': 1, 'STENOSIS OF THE DUODENAL BULB': 1, 'duodenal atresias and stenoses': 1, 'duodenal atresia type 1': 1, 'duodenal atresia type 1 to 3': 1, 'Papillary and duodenal luminal stenosis': 1, 'Duodenal membranous atresia': 1, 'DUODENAL STENOSIS': 1, 'stenosis or insufficiency at the duodenal papilla': 1, 'Tuberculous Duodenal Stenosis': 1, 'Tuberculous duodenal stenosis': 1, 'Vaterian duodenal atresia': 1, 'atresia duodenal buscar': 1, 'atresia duodenal por pancreas anular': 1, 'AD': 1, 'atresia duodenal por pancreas': 1, 'atresia duodenal combinada': 1, 'atresia duodenal e': 1, 'duodenal atresia (': 1, 'CASE OF DUODENAL STENOSIS': 1, 'and duodenal malignant stenosis': 1, 'type II bilio-duodenal stenosis': 1, 'bilio-duodenal stenosis': 1, 'duodenal malignant stenosis': 1, 'Congenital intrinsic duodenal stenosis': 1, 'duodenal atresia type III': 2, 'Duodenal atresia III': 1, 'I duodenal atresia': 2, 'stenosis of duodenal papilla': 1, 'Foetal Duodenal Atresia': 1, 'duodenal stenosis/': 1, 'Duodenal stenosis/atresia': 1, '2 DA': 1, 'type 2 DA': 1, 'type 3 DA': 1, 'stenosis of duodenal 2nd portion': 1, 'duodenal and pyloric stenosis': 1, 'Duodenal atresia 2 (4)': 1, 'duodenal membranous atresia': 1, 'Duodenal Papila Stenosis': 1, 'duodenal or jejunal stenosis': 1, 'duodenal or jejunoileal atresia': 1, 'duodenal atresia (type II)': 1, 'Stenosis of the biliary duodenal junction': 1, 'duodenal and other bowel atresia': 1, 'Duodenal Papillary Stenosis': 1, 'duodenal atresia with anular pancreas': 1, 'CONTRIBUTION TO THE KNOWLEDGE OF CONGENITAL DUODENAL ATRESIAS': 1, 'duodenal membranous stenosis': 1, 'Duodenal atresia 3': 1, 'atresia duodenal y malformacion': 1, 'duodenal atresia': 1, 'Duodenal stenosis & volvulus': 1, 'duodenal stent stenosis': 1, 'duodenal/intestinal stenosis': 1, 'duodenal inflammatory stenosis': 1, 'Duodenal Ulcer Stenosis': 1, 'CDAS': 1, 'Duodenal atresia Hypoplasia': 1, 'Gastrointestinal Duodenal atresia/': 1, 'stenosis in the duodenal luz': 1, 'Familial distal foregut atresia': 1, 'Duodenal atresia type IIIa': 1, 'duodenal dilatation or stenosis': 1, 'stenosis of duodenal bulb': 1, 'Esophageal/duodenal atresia': 2, 'neonatal diabetes duodenal atresia': 1, 'Gastrointestinal Duodenal atresia': 1, 'antral and/or duodenal stenosis': 1, 'digestive tract stenosis or atresia (esophageal, duodenal, and anal)': 1, 'Duodenal atresia/': 1, 'Familial Duodenal Somatostatinomatosis': 1, 'familial duodenal somatostatinomatosis': 1, 'pylero-duodenal-stenosis': 1, 'stenosis of bulbo-duodenal junction': 1, 'oesophageal and/or duodenal atresia': 1, 'pyloric, or duodenal stenosis': 1, 'fetal oesophageal or duodenal atresia': 1, 'type III duodenal atresia': 2, 'II duodenal atresia': 1, 'esophageal, stomach or duodenal stenosis': 1, 'duodenal/bowel atresia': 1} | duodenal atresia |
Disease | MESH:C535721 | {'hypergastrinemic': 109, 'antral G-cell hyperplasia': 11, 'Hypergastrinemic': 13, 'G-cell hyperfunction': 2, 'antral G cell hyperplasia': 14, 'antral D-cell deficiency': 1, 'Hyperfunction of G-': 1, 'Hypergastrinemic States': 1, 'antral G-cell hyperplasia syndrome': 1, 'duodenal G-cell hyperplasia': 1, 'AGCH': 4, 'hypergastrinemic conditions': 3, 'hypergastrinemic diseases': 3, 'antral G cell syndromes': 1, 'hypergastrinemic (type-A)': 1, 'Hypergastrinemic Hypersecretory': 1, 'antral G-cell hyperfunction': 1, 'hypergastrinemic syndromes': 1, 'hypergastrinemic effect': 2, 'hypergastrinemic symptoms': 1, 'hypergastrinemic reaction': 1, 'Antral G cell hyperplasia': 1, 'INS-GAS': 1, 'hypergastrinemic type 1 gNET': 1, 'hyperinsulinemic and hypergastrinemic syndromes': 1, 'Antral G cell hyperfunction': 1, 'antral G-cell syndromes': 1, 'Hyperfunction of antral': 1} | hypergastrinemic |
Disease | MESH:C535722 | {'mesentery': 185, 'mesenterial': 10, 'DM': 11, 'Mesentery': 354, 'MLN': 1, 'Mesentery of': 5, 'duodenojejunitis': 12, 'duodenojejunal': 1, 'Duodenojejunal': 1, 'mesenteriitis': 1, 'Omentum Mesentery': 2, 'MESENTERY': 1, 'mesentery of': 1, 'Hypermobile mesentery': 1, 'hypermobile mesentery': 1, 'Hypermobile Mesentery': 1, 'Mesentery defect': 1, 'Leiomyofibroma of the mesentery': 2, 'chyloma of the mesentery': 1, 'Mesentery defects': 2, 'Mesenterial angiomab': 1, 'mesentery defect': 4, 'Fibromyoangioma of the mesentery': 1, 'Peritoneum Mesentery': 1, 'mesenteri': 1, 'mesentery defects': 1, 'mesenterial ischaemia': 1, 'Chylangioma of the mesentery': 3, 'Mesentery 2018N': 1, 'congenital mesentery': 2, 'mesentery disorders': 2, 'misty mesentery': 4, 'Misty-mesentery': 1, 'Misty mesentery': 4, 'of mesentery': 2, 'of the Mesentery': 2, 'Pannicultis of the mesentery': 1, 'PEComa of mesentery': 1, 'TME': 1, 'IMT of the mesentery': 1, 'Duodenojejunitis': 1, 'Defects in the mesentery': 1, 'DJOS': 3, 'Lipogranuloma of mesentery': 1, 'Mesenterial': 2, 'the mesentery': 1, 'mesenteries': 1, 'valvulus of the mesentery': 1, 'mesentery EP': 1, 'mesentery RJ': 1, 'mesentery RN': 1, 'Mesentery EP': 1, 'Mesentery RN': 1, 'Mesentery RJ': 1, 'disorder of the mesentery': 1, 'MEsentery': 1, 'MES': 1, 'Mesenterial lymphangiolipoma': 1, 'Myolipoma of mesentery': 1, 'Myolipoma of Mesentery': 1, 'of the mesentery and': 1, 'defect of the mesentery': 1, 'duodenojejunitis regionalis': 1, '-Mesentery': 1, 'absent superior': 1, 'duodenojejunal pseudopolyposis': 1, 'lipogranuloma of the mesentery': 2, 'DJ': 1, 'Mesenterial-Tumoren': 1, 'Hepatogastric Mesentery': 1, 'Mesenterial enterocystoma': 1, 'Pleated Mesentery': 1, 'Lymphangiolipoma of the mesentery': 1, 'giarditic duodenojejunitis': 1, 'scrofulus mesentery': 1, 'mesenterial larval cestodiosis': 1, 'mesentery hyperpermeability': 1, 'ME Mesentery': 1, 'MESENTERIES': 1, 'thorotrastoma of the mesentery': 1, 'Milky Mesentery': 1, 'MM': 1, 'Location Mesentery': 1, 'MR': 1} | Mesentery |
Disease | MESH:C535723 | {'subungual hyperkeratosis': 377, 'subungual lesion': 27, 'subungual exostosis': 154, 'subungual keratosis': 56, 'subungual tumor': 42, 'subungual papule': 5, 'subungual haematoma': 13, 'subungual hemorrhage': 27, 'dyskeratotic subungual tumor': 1, 'subungual tumors': 71, 'peri-/subungual fibromas': 2, 'Benign subungual naevi': 1, 'benign subungual naevi': 1, 'pigmented subungual lesions': 3, 'subungual hemangioma': 3, 'subungual nodular tumor': 1, 'Subungual tumors': 7, 'Subungual haematomas': 3, 'subungual lesions': 26, 'Subungueal exostosis of fingers': 1, 'Subungueal exostosis': 3, 'Subungual keratosis': 3, 'subungual': 32, 'Subungual': 8, 'Subungual exostosis': 65, 'malignant degeneration of the SE': 1, 'Subungual Exostosis': 14, 'subungual exostoses': 3, 'SE': 16, 'subungual malignancies': 3, 'vascular in subungual exostosis': 1, 'protruted subungual exostosis': 1, 'protruded subungual exostosis': 1, 'Purpuric subungual hyperkeratosis': 1, "subungual (Dupuytren's) exostosis": 1, 'subungual fibromas': 25, 'subungual lesion on the': 1, 'subungual hyper-keratosis': 1, 'SUH': 3, 'subungual linear keratosis': 1, 'subungual diseases': 1, 'Subungual glomangiomyoma': 1, 'subungual glomangiomyoma': 1, 'subungual fibroma': 25, 'Periungual and subungual fibromas': 4, 'Subungual Melanocytic Lesions': 3, 'subungual melanocytic lesions': 4, 'Subungual fibroma': 4, 'subungual leiomyomatous tumors': 1, 'subungual disease': 4, 'Subungual hyperkeratosis': 32, "Dupuytren's exostosis": 4, 'Distal subungual hyperkeratosis': 1, 'distal subungual keratosis': 6, 'Hyperkeratosis of the subungual': 1, 'Subungual Exostosis on the': 1, 'subungual fibromasNeuro': 1, 'subungual ulcers': 2, 'palmoplantar and subungual lesions': 1, 'mucosal, palmoplantar and subungual lesions': 1, 'subungual tumor of the thumb': 1, 'ungual and subungual fibroma': 1, 'subungual swelling': 4, 'Subungual Malignancies': 1, 'SUM': 1, 'subungual malignancy': 2, 'Nonmelanoma subungual malignancies': 1, 'Subungueal keratosis': 2, 'subungual and periungual fibroma': 1, 'Subungual lipoma': 3, 'Ungual and subungual fibromas': 1, 'Subungual exostosis on': 1, 'subungual warty dyskeratoma': 1, 'subungual dyskeratoma': 1, 'subungual tumor of the': 2, 'benign subungual tumors': 1, 'subungual SCCs': 2, 'Subungual exostosis in': 1, 'subungual purpuric lesions': 1, 'subungual glomangiomyoma of the toe': 1, 'subungual exostosis of the first toe': 1, 'SOC': 1, 'subungual junctional nevus': 1, 'Subungual nevus': 1, 'subungual nevus': 3, 'benign subungual nevus': 1, 'periungual and subungual fibromas': 4, 'Subungual haematoma': 4, 'periungual or subungual tumors': 1, 'subungual pigmentation': 1, 'Subungual pigmentation': 2, 'subungual keratosis SCC': 1, 'subungueal exostosis': 2, 'Subungual pustulation': 1, 'Subungual exostosis of the fifth toe': 1, 'Subungual exotosis': 1, 'Subungual fibromas': 5, 'subungual fibrokeratoma': 2, 'subungual (Dupuytren) exostosis': 1, 'subungual haemangioma': 2, 'pigmented subungual lesion': 2, 'keratotic subungual tumor': 1, 'Subungual Tumor': 1, 'Subungual exostosis of the great toe': 2, 'Subungual exostosis of the toes': 1, 'subungual papule of the 4th finger': 1, 'subungual enthesitis': 1, 'bleeding subungual lesions': 1, 'subungual haematomas': 1, 'Subungual angiomyxolipoma': 1, 'mucosal and subungual lesions': 1, "Dupuytren's (subungual) exostosis": 1, 'Subungual pleomorphic fibroma': 2, 'subungual pleomorphic fibroma': 2, 'subungual necrosis': 1, 'Subungual exostosis of the finger': 3, 'subungual exostosis of the toe': 1, 'Subungual Haematoma': 2, 'Proximal subungual': 1, 'proximal subungual': 1, 'Subungual Hyperkeratosis': 1, 'subungual cysts': 1, 'subungual exostosis of the hallux': 1, 'subungual tumors of': 1, "Subungual or Dupuytren's exostosis": 1, 'cutaneous and subungual lesions': 1, 'cutaneous or subungual lesions': 1, 'SUBUNGUAL EXOSTOSIS': 2, 'subungual and nailbed abnormalities': 1, 'Subungual exotosis of the finger': 1, 'Subungual hyperkeratosisn': 1, 'subungual hyperker-atosis': 1, 'inflammatory subungual diseases': 1, 'subungual cyst': 3, 'subungual hemangiomas': 1, 'Secondchirodactyl(subungual': 1, 'Acral (volar-subungual': 1, 'Pediatric Subungual Exostosis': 1, 'Dupuytren exostosis': 3, 'subungual exostosis of the': 1, 'subungueal hyperkeratosis': 3, 'Subungual Congenital Nevus': 1, 'subungual congenital nevus': 1, 'subungual glomic tumors': 1, "Dupuytren's) exostosis": 1, "Dupuytren's subungual exostosis": 2, 'subungual hyperkertosis': 1, 'Subungual exostosis of the big toe': 2, 'subungual carcinoma': 3, 'subungual hyper keratosis': 1, 'subungual lipoma': 1, 'subungual keratotic papule': 1, 'Subungual exostosis of the toe': 1, 'subungual tumors of the foot': 1, 'Congenital subungual nevus': 2, 'para- and subungual tumors': 1, 'Benign subungual tumors': 1, 'Subungual hemorrhage': 2, 'periungual/subungual fibroma': 1, 'SUBUNGUAL': 2, 'subungual hemorrhages': 2, 'Nail subungual hyperkeratosis': 1, 'subungual keratotic tumors': 2, 'Periungual and subungual keratotic tumors': 1, 'Subungual Tumors': 1, 'subungual thumb haematoma': 1, 'subungual and periungual fibromas': 1, 'SF': 1, "subungual Dupuytren's exostosis": 1, 'Subungual carcinomas': 1, 'subungual exostosis of the thumb': 2, 'subungual hyperkeratosis of the nail': 1, 'subungual hyperkeratosis of': 1, 'subungual felon': 1, 'subungual haemangioendothelioma': 1, 'Subungual Elastofibroma': 1, 'subungual elastofibroma': 1, 'subungual SCC': 1, 'subungual and periungual tumors': 1, 'subungual/periungual tumors': 1, 'subungual warty lesions': 1, 'SOCs': 1, 'primary subungual melanoblastoma': 1, 'subungual desquamation': 1, 'periungual and subungual fibrokeratoma': 1, 'benign subungual pigmented macule': 1, 'multiple subungual fibromas': 1, 'distal lateral subungual': 1, 'subungual lesion on': 1, 'subungual keratotic tumors of the hands': 1, 'benign subungual hyperkeratosis': 1, 'subungual papules': 1, 'SH': 1, 'subungual bleedings': 1, 'excessive subungual keratosis': 1, 'Subungual fibro-osseous pseudotumour of the toe': 1, 'Subungual Exostosis of the Hand': 1, 'SE lesion': 1, 'subungual tumoral syndrome': 1, 'Hyperkeratotic Subungual Tumor': 1, 'subungual hyperkeratosis lesion': 1, 'periungual or subungual fibromas': 2, 'subungual ulcer': 1, 'congenital subungual nevus': 1, 'subungual exostosis of the big toe': 1, 'Subungual tumor': 1, 'lateral subungual': 1, 'SUBUNGUAL lesions': 1, 'or subungual fibromas': 1, 'subungual tissue sclerosis': 1, 'Subungual Leiyomyoma': 1, 'nail apparatus/subungual in situ': 1, 'subungual tumor of the ring finger': 1, 'subungual dyskeratotic tumors': 1, 'subungual calcification': 1, 'Dystrophic subungual calcification': 1, 'subungual nodular lesions': 1, "Dupuytren's SE": 2, 'SE lesions': 1, 'subungual infection': 1, 'subungual hand tumors': 1, 'subungual warty tumors': 1, 'Subungual lesions': 1, 'subungual red lesion': 1, 'red subungual lesions': 1, 'SSH': 1, 'subungual tumor of': 1, 'Subungual splinter hemorrhage': 1, 'subungueal tumors': 1, 'subungual erythemas': 1, 'subungual erythema': 1, 'subungual pterygia': 1, 'Familial subungual pterygias': 1, 'Non-pigmented subungual malignancies': 1, 'Subungual fibroma 1': 1, 'subungual tumoral lesions': 1, 'Subungual exostosis of a': 1, 'Subungual hyperkeratosis 2': 1, 'subungual exostosis of the great toe': 1, 'subungual osteochrondroma': 1, 'subungual exostosis on the great toe': 1, 'pigmented subungual SCCis': 1, 'subungual anomalies': 1} | subungual hyperkeratosis |
Disease | MESH:C535724 | {'muscle and joint stiffness': 43, 'joint stiffness': 5863, 'stiffness of joints': 160, 'stiff and contracted joints': 3, 'joint swelling and stiffness': 18, 'Joint stiffness': 372, 'Joint Stiffness': 15, 'stiff joints': 282, 'Joint stiffness and': 1, 'stiffness of the subtaloid joint': 1, 'stiffness in the joint': 24, 'stiffness of the joints': 117, 'multiple joints stiffness': 2, 'radiocarpal joint stiffness': 1, 'Radiocarpal joint stiffness': 1, 'RJS': 1, 'Postoperative radiocarpal joint stiffness': 1, 'metatarsophalangeal joint stiffness': 7, 'PIP joint stiffness': 7, 'joints stiffness': 34, 'facet joint stiffness': 3, 'multiple joint stiffness': 8, 'hip joint stiffness': 29, 'stiffness in the hip joint': 2, 'stiffness in joints': 54, 'increased joint stiffness': 3, 'joint quasi-stiffness': 2, 'rheumatoid or joint fracture or stiffness': 1, 'stiff temperomandibular joints': 1, 'first MTPJ quasi-stiffness': 1, 'stiffness of finger joints': 6, 'foot joint stiffness': 1, 'stiff joint': 29, 'stiffness around the joints': 2, 'stiffness in the joints': 51, 'stiffness of the first MTP joint': 2, 'postoperative joint stiffness': 33, 'stiffness of adjacent joints': 8, 'stiffness of the joint': 84, 'hand joint stiffness': 5, 'stiffness of multiple joints': 7, 'posttraumatic joint stiffness': 8, 'PTJS': 2, 'posttraumatic and postoperative joint stiffness': 1, 'joint stiffness and deformity': 3, 'stiff joint syndrome': 12, 'muscle-joint stiffness': 2, 'stiffness of the back and peripheral joints': 1, 'stiffness of joint': 20, 'stiffness of peripheral joints': 2, 'stiffness of the hip joint': 11, 'muscle or joint stiffness': 14, 'joint and ocular abnormalities': 1, 'stiffness in muscles or joints': 8, 'reduced joint stiffness': 7, 'stiffness of body parts and joints': 1, 'post-stroke joint stiffness': 2, 'joint (hand) stiffness': 2, 'stiffness of the joints and spine': 2, 'peripheral joint stiffness': 3, 'joint effusion and stiffness': 1, 'DJS': 5, 'decreased joint stiffness': 3, 'stiffness of the thoracolumbar joint': 1, 'joint-stiffness': 5, 'Intervertebral joint stiffness': 1, 'Stiff joints': 9, 'abnormal spinal joint stiffness': 1, 'subtalar joint stiffness': 17, 'muscle\\joint stiffness': 1, 'stiffness of the metatarsophalangeal joint': 7, 'stiffness in muscles and joints': 11, 'stiffness in multiple joints': 6, 'stiffness of fracture joint': 1, 'MCPJ stiffness': 1, 'Spine joint stiffness': 1, 'spine joint stiffness': 1, 'stiffness in muscles/joints': 3, 'stiffness in muscles and/or joints': 2, 'postraumatic joint-stiffness': 1, 'posttraumatic joint-stiffness': 1, 'stiff finger joints': 2, 'Subtalar joint stiffness': 2, 'stiffness of the first metatarsophalangeal joint': 5, 'stiffness joint swelling': 1, 'swelling and stiffness of the joints': 2, 'joint enlargement and stiffness': 1, 'stiffness of the subtalar joint': 2, 'joint stiffness reduction': 1, 'stiffness of affected joints': 2, 'JS': 4, 'joint/muscle stiffness': 4, 'joint /muscle stiffness': 1, 'VSJ': 1, 'joint stiffness of': 2, 'stiffness of the upper extremity joints': 1, 'stiffness in peripheral joints': 1, 'stiffness in muscle and joints': 2, 'or joint stiffness': 2, 'stiffness of zygapophyseal joint': 1, 'joint-related stiffness': 2, 'stiffness in joints and muscles': 3, 'tissue deformity joint stiffness': 1, 'stiffness of multiple hand joints': 1, 'aches or stiffness in the joints': 3, 'joint stiffness and dysfunction': 7, 'joints stiffness and disability': 1, 'aches and stiff joints': 4, 'spine or joint stiffness': 1, 'stiff/swollen joints': 7, 'deformed and stiff joints': 1, 'Joint stiffness or': 2, 'joint, aching or stiffness': 1, 'joint adhesion and stiffness': 2, 'effusion and stiffness in the joint': 1, 'stiffness of the MTPJ': 1, 'MTPJ stiffness': 1, 'stiffness of the affected joints': 1, 'spinal joint stiffness': 3, 'Foot joint stiffness': 1, 'muscle/joint stiffness': 6, 'or stiffness in muscles and joints': 3, 'upper extremities joint stiffness': 1, 'stiffness in the body joints': 1, 'MCP joint stiffness': 1, 'finger joint stiffness': 20, 'AC joint stiffness': 1, 'stiffness of the right hip joint': 1, 'stiffness of small joints in': 1, 'CMC joint stiffness': 1, 'metacarpophalangeal joint stiffness': 13, 'stiffness of large and small joints': 1, 'abnormal joint stiffness': 2, 'joint stiffness': 1, 'tension and/or stiffness in joints and muscles': 2, 'post-fracture joint stiffness': 1, 'stiffness of subtalar joints': 1, 'joint stiffness reduced range': 1, 'joint stiffness of upper extremity': 1, 'upper extremity joint stiffness': 1, 'stiffness of hip joint': 5, 'joint swelling stiffness': 1, 'multi-joint stiffness': 1, 'stiffness of back and joints': 2, 'stiffness of joints and muscles': 2, 'Thoracolumbar joint stiffness': 1, 'thoracolumbar joint stiffness': 1, 'stiffness of major joints': 3, 'stiff joints with': 1, 'joint stiffnesses': 3, 'stiffness in joint': 3, 'multiple congenital joint stiffness': 2, 'aches/stiffness in joints': 6, 'stiffness of joints and fingers': 1, 'joint stiff': 2, 'arterial and joint stiffness': 2, 'joint swell and stiffness': 1, 'reduction in joint stiffness': 3, 'swollen and stiff joints': 3, 'swollen/stiff joints': 2, 'Stiff Joints': 2, 'Manipulation of stiff joints': 1, 'stiffness of facet joints': 1, 'lower extremity joint stiffness': 2, 'aches or stiff joints': 1, 'ocular and joint symptoms': 2, 'dynamic joint stiffness': 2, 'limitation of joint stiffness and movement': 1, 'Skeletal abnormalities Joint stiffness': 1, 'impaired joint stiffness': 1, 'facet joint or spinal stiffness': 1, 'joint and muscular stiffness': 2, 'stiffness of the hip-joint': 1, 'stiffness within the hip joint': 1, 'stiff and sore joints': 2, 'stiffness of a joint': 4, 'joints swelling or stiffness': 1, 'stiffness of muscles and/or joints': 1, 'stiffness of joints of the hand': 1, 'stiffness in hand joints': 1, 'stiffness in the muscles or joints': 1, 'joint and muscle stiffness': 7, 'Metacarpophalangeal joint stiffness': 2, 'stiff and lax joints': 1, 'aches and stiffness in joints': 1, 'stiffness in the articular joints': 1, 'stiffness in or around a joint': 1, 'aches or stiffness in joints': 6, 'stiffness of the metacarpophalangeal joint': 2, 'stiffness of the spine and hip joints': 2, 'tibiofemoral joint stiffness': 1, 'Joint stiffness:32': 1, 'swelling and stiffness in joints': 1, 'joint stiffness discomfort': 1, 'intervertebral joint stiffness': 1, 'stiffness of the hand joints': 1, 'stiffness of metatarsophalangeal joints': 1, 'muscle joint stiffness': 1, 'Muscle/joint stiffness': 2, 'first tarsometatarsal joint stiffness': 2, 'stiff and torqued joints': 1, 'extremity joint stiffness': 2, 'stiffness of the small joints': 1, 'stiffness of the finger joints': 1, 'first MTP joint stiffness': 2, 'First MTP joint stiffness': 1, 'MTP joint stiffness': 5, 'first metatarsophalangeal (MTP) joint stiffness': 1, 'muscular and joint stiffness': 1, 'STIFF JOINTS': 1, 'joint stiffness in': 1, 'stiffness of the joints and muscles': 1, 'swollen or stiff joints': 1, 'stiffness in my joints': 1, 'Spinal joint stiffness': 1, 'PO joint stiffness': 1, 'muscle and joint stiffness or': 1, 'Aches and stiff joints': 2, 'stiffness of involved joints': 1, 'joint stiffness of the hip': 1, 'stiffness at hand joints': 1, 'Dynamic joint stiffness': 1, 'stiffness in or around the joint': 1, 'Stiffness in the joint': 1, 'stiffness in the spine and joints': 1, 'Stiffness of joints': 1, 'stiffness around joints': 2, 'or stiffness in muscles or joints': 2, 'stiff/swollen joint': 1, 'and joint stiffness': 3, 'extremities joint stiffness': 1, 'stiff and swollen joints': 4, 'stiffness of the distal joints': 1, 'stiffness to the joints': 1, 'joint stiffness or abnormalities': 1, 'stiffness of the spine joints': 1, 'Hip joint stiffness': 3, 'of joint stiffness': 1, 'stiffness of the joint and muscles with limited': 1, 'swelling of joints and stiffness': 1, 'stiff joint conditions': 1, 'joint stiffness and deficits': 1, 'stiffness of MCP': 1, 'joint stiffness and': 1, 'scapulothoracic joint stiffness': 1, 'stiffness in the finger joints': 1, 'stiff or sore joints': 2, 'stiffness of muscles and joints': 5, 'increased stiffness of the joints': 1, 'finger joints stiffness': 1, 'Muscle or joint stiffness': 2, 'Postoperative joint stiffness': 2, 'JS joint stiffness': 1, 'back and joint stiffness': 2, 'back, and joint stiffness': 1, 'Back and joint stiffness': 1, 'stiffness of major and small joints': 1, 'QJS': 1, 'stiffness of entire joint': 1, 'stiffness of the MTP joint': 3, 'stiffness of their joints': 1, 'hip joint deformity and stiffness': 1, 'joint stiffness, aching or': 1, 'Muscle and Joint Stiffness': 1, 'stiffness of the hip joints': 2, 'joint stiffness at': 1, 'MP joint stiffness': 1, 'stiff and achy joints': 1, 'joint and leg stiffness': 1, 'PJS': 1, 'Joint and limb stiffness': 1, 'stiffness of finger joint': 1, 'joint or regional stiffness': 1, 'AM joint stiffness': 2, 'spastic joint stiffness': 1, 'Small joint stiffness': 1, 'Stiffness in joints': 3, 'chronic joint stiffness': 1, 'multiple stiff joints': 1, 'Moore-Federman syndrome': 4, 'disc joint stiffness': 1, 'ocular stiffness': 3, 'stiffness in the enlarged joints': 1, 'Stiffness of the fourth metatarsophalangeal joint': 1, 'stiffness of the metatarsophalangeal joints': 1, 'multiple joint swelling and stiffness': 1, 'feet joints stiffness': 1, 'stiff hand joints': 2, 'stiffness and disability of the joint': 1, 'stiffness of the muscles and joints': 1, 'stiffness of both hip joints': 1, 'Disabling joint stiffness': 1, 'LE joint stiffness': 1, 'joint stiffness and less': 1, 'ocular and joints defects': 1, 'joint stiffness or deformity': 1, 'stiffness of small joints': 2, 'stiffness of joints in the': 1, 'stiffness within the muscles or joints': 1, 'Generalised joint stiffness': 1, 'anterior joint stiffness': 1, 'stiffness at the hip joint': 1, 'stiffness in hand joint': 1, 'stiff joint disability': 1, 'joint stiffness;History': 1, 'stiffness in a hip joint': 1, 'stiffness joints': 1, 'ocular and joint': 1, 'stiffness of the PIP joints': 1, 'abnormalities of aortic stiffness': 2, 'abnormal aortic stiffness': 1, 'joint stiffness problems': 1, 'hip/joint stiffness': 2, 'joint aches/stiffness': 1, 'Stiff joint syndrome': 2, 'SJS': 2, 'joint or leg stiffness': 1, 'leg and joint stiffness': 1, 'Leg and joint stiffness': 1, 'MPJ 1 stiffness': 1, 'aortic stiffness abnormalities': 2, 'stiffness of joints after injury': 1, 'stiff/contracted joints': 1, 'stiffness in the subtalar joint': 1, 'aching/stiff joints': 2, 'stiffness in or around joints or back': 1, 'adjacent joint stiffness': 1, 'joint stiffness of the hands': 1, 'stiffness of the affected joint': 2, 'stiffness at the joint': 3, 'joints stiff': 2, 'stiffness and deterioration of joints': 1, 'arthropathy with stiff joints': 1, 'stiffness of the PIP joint': 1, 'stiffness of subtalar joint': 2, 'joint stiffness dysregulation': 1, 'MPJ stiffness': 1, 'stiffness of metacarpal joints': 1, 'stiffness of the adjacent joints': 4, 'reduction of joint stiffness': 1, 'stiff metacarpophalangeal joint': 1, 'asymmetrical joint stiffness': 1, 'Vertebral joint stiffness': 1, 'first metatarsophalangeal joint stiffness': 1, 'STJ stiffness': 2, 'lower-extremity joint stiffness': 1, 'Moore Federman syndrome': 1, 'MFS': 1, 'stiffness of adjacent joint': 2, 'ocular, dental, or joint abnormalities': 1, 'Muscle and joint stiffness': 3, 'metatarsalphalangeal joint stiffness': 1, 'back &joint stiffness': 1, 'back & joint stiffness': 1, 'joint flexion/stiffness': 1, 'joint swelling or stiffness': 2, 'stiffness in muscle or joints': 1, 'Posttraumatic joint stiffness': 2, 'stiffness in your joints': 2, 'peritalar joint stiffness': 1, 'joints swelling and stiffness': 1, 'joint aches and stiffness': 2, 'joint stiffness and swelling': 2, 'Reduced joint stiffness': 1, 'joint dysfunction and stiffness': 1, 'ocular, hearing, and joint and bone abnormalities': 2, 'joint accessory movement stiffness': 1, 'stiffness in hands, joints, or body': 1, 'stiffness in hands, joints, or': 1, 'stiffness joint': 1, 'JOINT STIFFNESS': 1, 'stiff/hypomobile joints': 1, 'stiffness of joints of the': 1, 'stiff feet joints': 1, 'upper extremity (UE) joint stiffness': 1, 'stiffness of the spine and joints': 1, 'leg joint stiffness': 1, 'abnormalities in aortic stiffness': 1, 'abnormal stiffness of joints': 1, 'stiffness of MTP joint': 1, 'swelling or stiffness in joints': 1, 'stiffness of the feet joints': 1, 'stiffness of a finger joint': 1, 'stiffness of the metatarsophalangeal (MTP) joint': 1, 'stiffness at the MTP joint': 1, 'stiff hip joint': 1, 'stiffness in your hip joints or muscles': 1, 'Metatarso-phalangeal joint (MTP1) stiffness': 1, 'and stiff joints': 1, 'stiffness of the involved joint': 1, 'stiffness in the limbs and joints': 1, 'stiffness of both joints': 1, 'muscles and joints stiffness': 1, 'PJTS': 1, 'joint swelling/stiffness': 1, 'joint stiffness Ectopialentis syndrome': 1, 'systemic joint stiffness': 1, 'Multiple joint stiffness': 1, '-extremity joint stiffness': 1, 'Finger joint stiffness': 1, 'loss of stiffness of the intervertebral joint': 1, 'hypermobile or stiff joints': 1, 'stiffness of small hand joints': 1, 'joint rotational stiffness': 1, 'abnormalities in joint stiffness': 1, 'rotatory joint stiffness': 1, 'stiffness at the hallux MTP joint': 1, 'ACJ stiffness': 1, 'stiffness of hip joints': 1, 'stiffness of the MP joint': 1, 'digital joint stiffness': 1, 'joint or back stiffness': 1, 'joint deformation and stiffness': 1, 'stiff joints.4': 1, 'stiffness of muscle and joint': 1, 'stiffness in joints of extremities': 1, 'metacarpophalangeal joint) stiffness': 1, 'stiffness and impaired joint function': 1, 'stiffness in or around joints': 1, 'joint stiffness/abnormalities': 1, 'abnormal systemic arterial stiffness': 1} | joint stiffness |
Disease | MESH:C535725 | {'tall fescue': 22, 'disproportionate face': 1, 'disproportionate dwarfism': 59, 'Fibrous Tree Tall': 1, 'Tall': 57, 'disproportionate skeletal dysplasia': 2, 'short or tall stature': 35, 'tall or short stature syndromes': 2, 'NFTS': 1, 'non-familial tall stature': 1, 'tall': 15, 'Tall girl': 1, 'Disproportionate antecollis': 4, 'POPULATIONS DISPROPORTIONATELY': 1, 'short/tall stature': 1, 'short and tall stature': 18, 'TF': 6, 'Tallness': 4, 'craniofacial disproportionality': 3, 'Disproportionate': 1, 'short and tall statures': 1, 'Tall Poppy Syndrome': 1, 'tall fescue leafspot disease': 1, 'Disproportionate disability 15': 1, 'Body disproportionality': 1, 'body disproportionality': 1, 'disproportionality': 8, 'disproportionate overgrowth of limbs': 1, 'Disproportionate dwarfism': 10, 'tall poppy syndrome': 12, 'DPA': 9, 'disproportionate': 4, 'Tall shrubs': 1, 'Tall Utah': 1, 'Tall fescue': 6, 'SDEvS': 1, 'SDEvC': 1, 'SDE': 7, 'CHINA DISPROPORTIONABLY': 1, 'facial disproportionality': 6, 'short-trunk disproportionate dwarfism': 3, 'TALLs': 7, 'short limbed disproportionate dwarfism': 1, 'disproportionate extremities': 1, 'Rhizomatous tall fescue': 4, 'shortness and tallness': 1, 'Tall-': 1, 'MTLD TALLED': 1, 'tALL': 2, 'TR': 1, 'Disproportionality': 1, 'TOFA': 1, 'Disproportionate chondrodysplasia': 1, 'disproportionate chondrodysplasia': 1, 'Disproportionate Syndromes': 1, 'HBD': 3, 'tall and short stature': 1, 'Short or tall stature': 1, 'ST': 1, 'Congenital disproportionate dwarfism': 1, 'Tall tussock': 1, 'abnormal tallness': 1, 'Hainan Tall': 3, 'HT': 2, 'short vertebra': 3, 'short vertebrae': 2, 'aSV': 2, 'Acquired short vertebra': 1, 'SV': 1, 'Disproportionate Dwarfism': 4, 'Tall Fescue': 3, 'disproportionate anterocollis': 2, 'short-limbed, disproportionate dwarfism': 1, 'LE': 1, 'Stand Tall': 1, 'Acquired short vertebrae': 1, 'Tall Kneeling Rainbows': 1, 'Short-limbed disproportionate dwarfism': 1, 'Tallness or shortness': 1, 'tall morningglory': 3, 'Tall Morningglory': 1, 'ETHNIC DISPROPORTIONALITY': 1, 'HD': 1, 'Familial Tall': 1, 'Disproportionate Overgrowth': 1, 'Endophyte Tall Fescue': 1, 'endophyte tall fescue': 1, 'DAs': 1, 'Tall fibrillinopathies': 1, 'asymmetrical and disproportionate skeletal overgrowth': 1, 'FDD': 1, 'Feline disproportionate dwarfism': 1, 'Feline Disproportionate Dwarfism': 1, 'feline disproportionate dwarfism': 1, 'FDD humeri': 1, 'TO': 2, 'Tall WT': 1, 'TD': 1, 'Tall gastrodia': 1, 'Disproportionate anterocollis': 3, 'Disproportionate hyperproinsulinaemia': 1, 'disproportionate hyperproinsulinaemia': 1, 'HB': 3, 'carcinoma of the HB': 1, 'Tall poppies': 1, 'PDR': 1, 'DA': 1, 'tall or short stature': 1, 'idiopathic short and tall stature': 1, 'TSA': 1, 'disproportionate hyposomia': 1, 'Leibung-tharam Tall herb': 1, 'Tall spongyHerb': 1, 'Lok-lei Tall': 1, 'tall fescue staggers': 1, 'congenital disproportionate dwarfism': 1, 'autosomal recessive skeletal disproportionate dwarfism disorder': 1, 'Tall mangroves': 1, 'DSS': 1, 'Tall grass': 2, 'tall grass': 1, 'DPMs': 1, 'tall staturef': 1, 'tall palate': 1, 'Short and tall stature': 2, 'DHM': 1, 'Hainan tall': 1, 'fractures of vertebrae and extremitiesBone deformityShort stature': 1, 'Tall statureb': 1, 'DISP': 1, 'tall-poppy-syndrome': 1, 'Disproportionate perspiration': 1, 'Tall goldenrod': 1, 'CTO': 1, 'Tall staturea': 1, 'disproportionate body stature': 1, 'tall abnormalities': 1, 'tall poppy': 1, 'Skeletal Tall statureb': 1, 'TCC': 1, 'disproportionate antecollis': 3, 'Disproportionately': 1, 'high body': 1, 'HAT': 1, 'DT': 1, 'tall nightshade': 1, 'Tall ceil': 1, 'TS': 1, 'Short-limb disproportionate dwarfism': 1, 'short-limbed disproportionate dwarfism': 1, 'asymmetric disproportionate overgrowth': 1, 'inherited disproportionate dwarfism': 1, 'disproportionate craniofacial anatomy': 1, 'Tall neogastropod': 1, 'disproportionate digit lengths': 1, 'disproportionate limb overgrowth': 1, 'Tall pebblesnail': 1, 'Tall lush': 1, 'HF-BF': 1, 'retardation with disproportionate verbal delay': 1, 'DPP': 1, 'shortness of vertebra': 1, 'tall fescue toxicity': 1, 'disproportionate loss': 1} | disproportionate dwarfism |
Disease | MESH:C535726 | {'Dyggve-Melchior-Clausen (DMC) syndrome': 14, 'DMC': 781, 'DMC syndrome': 19, 'Dyggve-Melchior-Clausen syndrome': 82, 'DMC Diseases of the nervous system': 1, 'Dyggve-Melchior-Clausen disease': 8, 'Dyggve-Melchior-Clausen (DMC) dysplasia': 2, 'A-DMC': 3, 'NRICM 95-DMC-2': 1, '-DMC-2': 1, 'Dyggve-Melchior-Clausen Syndrome': 8, 'RUN-DMC': 2, 'Dyggve-Melchior-Clausen syndrome without mental retardation': 1, 'Dyggve-Melchior-Claussen syndrome': 1, '-DMC': 12, 'DMCS': 5, 'Dyggve-Melchior Claussen (DMC) syndrome': 1, 'Dyggve- Melchior Claussen (DMC) syndrome': 1, 'Dyggve-Melchior Claussen syndrome': 2, 'DMC & H': 1, 'DMC-2': 4, 'DMC-T.': 3, 'DMC-T': 2, 'Dyggve-Melchior-Clausen dysplasia': 10, 'Dyggyve-Melchior-Clausen dysplasia': 1, 'Dyggve-Melchior-Clausen syndrome (type II)': 1, 'C-DMC': 1, 'DMC) syndrome': 1, 'Dyggve Melchior Clausen (': 1, 'MEU-DMC': 4, 'DMC-': 4, 'X-linked Dyggve-Melchior-Clausen syndrome': 2, 'DMC dwarfism': 2, 'clausenal': 1, 'Duggve-Melchior-Clausen dysplasia': 1, '-Melchior-Clausen dysplasia': 1, 'E-DMC': 1, 'DM': 2, 'Dygvve-Melchior-Clausen': 1, 'Dyggve Melchior Claussen syndrome': 1, 'Dyggve melchior clausen syndrome': 2, 'Dyggve-Melchior- Clausen syndrome': 1, 'DMC-II': 1, 'DMC III': 1, 'DMC disease': 1, 'Dyggve-Melchoir-Clausen syndrome': 3, 'Dyggve-Melchior-Clausen': 3, 'DMC dysplasia': 1, 'Melchior-Clausen Syndrome': 1, 'DMC syndromes': 2, 'ERC-DMC': 2, 'DMC-syndrome': 1, 'Dyygve-Melchior-Clausen syndrome': 1, 'OC-DMC': 1, 'Dyggve disease': 1, 'TSC-DMC': 1, 'DMC-OA': 1, 'Dyggve--Melchior--Clausen syndrome': 1, 'Clausen': 2, 'Dyggve-Melchiore-Clausen dysplasia': 1, 'Dyggve-Melchiore-Clausen (DMC) syndrome': 1, 'Dyggve-Melchio-Clausen syndrome': 1, 'CTD DMC': 1, 'dyggve-melchior-clausen syndrome': 1, 'Dyggve-melchior-clausen disease': 1, "Dyggve-Melchior-Clausen's syndrome": 1, "Dyggve-melchior-clausen's syndrome": 1, 'Dyggve-Melchior': 1, 'CHG-DMC': 1, 'DMC-3369-': 1, 'Dyggye-Melchior-Clausen dysplasia': 1, 'Dyggve-Melchior-Clausen dwarfism': 2, 'Melchior 2': 1, 'Melchior 4': 1, 'Dyggve Melchior Clausen syndrome': 2, '-Melchior-Clausen': 1, 'DMC-H': 1, 'DMC-27b': 1, 'DMC OMIM 223800': 1, "Melchior's paradental ostitis": 1} | DMC |
Disease | MESH:C535727 | {'hepatosplenomegaly': 19272, 'Hepatosplenomegaly': 1568, 'Dyke-Davidoff-Masson syndrome': 124, 'Dyke-Davidoff Masson syndrome': 3, 'DDMS': 63, 'Dyke Davidoff- Masson syndrome': 1, 'HSM': 30, 'Dyke Davidoff Masson Syndrome': 2, 'Dyke davidoff masson syndrome': 1, 'hepatosplenomegalie': 33, 'Dyke-Davidoff syndrome': 2, 'Dyke': 2, 'Hepatosplenomegalie': 35, 'Dyke-Davidoff-Masson (DDMS) syndrome': 1, 'chronic hepatosplenomegaly': 1, 'congenital DDMS': 3, 'hepatosplenomegaly lymphadenopathy': 1, 'HS': 1, 'Dyke-Davidoff-Masson Syndrome': 37, 'hepatosplenomegalies': 8, 'Chronic hepatosplenomegaly': 2, 'Lymphoid hepatosplenomegaly': 1, 'Dyke-Davidoff-Masson-like syndrome': 1, 'Dyke-davidoff-masson syndrome': 2, 'HEPATOSPLENOMEGALY': 2, 'MBVD': 6, 'bilharzial hepatosplenomegaly': 3, 'foetal hepatosplenomegaly': 1, 'dyke-davidoff-masson syndrome': 1, 'Dyke-Davidoff-Masson malformation': 1, 'Huge hepatosplenomegaly': 1, '- or hepatosplenomegaly': 1, 'spleno- or hepatosplenomegaly': 3, 'BVD': 5, 'hepatosplenomegaly.2': 1, 'HSM hepatosplenomegaly': 4, 'nephrogenic hepatosplenomegaly': 1, 'hypoechoic hepatosplenomegaly': 1, 'Dykes': 2, 'CAUSE OF HEPATOSPLENOMEGALY': 1, 'Dyke crop': 1, 'dyke crop': 1, 'DDMS pattern III': 2, 'Dyke - Davidoff - Masson syndrome': 1, 'DDM syndrome': 1, 'Dyke-Davidoff-Masson (DDM) syndrome': 2, 'hepatosplenomegaly;CT': 1, 'hepatosplenic and hepatosplenomegaly': 1, 'Davidoff-Dyke-Masson syndrome': 2, 'Dyke Davidoff Masson syndrome': 4, 'hepatosplenomegaly disease': 1, 'Davidoff-Dyke-Masson Syndrome': 1, 'Nephrogenic hepatosplenomegaly': 1, 'lympho-hepatosplenomegaly': 1, 'Sidney Dyke': 1, 'Congenital DDMS': 1, 'NADIA': 1, 'hepatosplenomegaly syndrome': 2, 'une hepatosplenomegalie': 1, 'DMMS': 1, 'aplite dykes': 1, 'Great Dyke': 1, 'adeno- and hepatosplenomegaly': 1, 'Chronic Hepatosplenomegaly': 1, 'Visceral Hepatosplenomegaly': 1, 'Dyke-Davidoff-Masson anomaly': 1, 'nephrogenous hepatosplenomegaly': 2, 'Nodular hepatosplenomegaly': 1, 'DDSM': 1, 'Dyke-Davidoff-Masson': 1, 'Hepatosplenomegaly Lymphadenopathies': 1, 'BHD': 1, 'febrile hepatosplenomegaly': 1, 'dyke': 1, 'HSMG': 1, 'Granulomatous hepatosplenomegaly': 1, 'diffuse hepatosplenomegaly': 1, 'DDMS syndrome': 1} | hepatosplenomegaly |
Disease | MESH:C535729 | {'RAD': 398, 'DSH': 457, 'brachial cutaneous dyschromatosis': 7, 'congenital dyschromatosis': 2, 'Dyschromatosis symmetrica hereditaria': 91, 'dyschromatosis symmetrica hereditaria': 208, 'Dyschromatosis Symmetrica Hereditaria': 19, 'reticulate acropigmentation of Dohi': 23, 'serpens endocrania symmetrica': 7, 'AI-RAD': 1, '-RAD': 9, 'symmetric dyschromatosis of the extremities': 4, 'dyschromatosis': 45, 'Mollisonia symmetrica': 1, 'Dyschromatosis Symmetrica': 5, 'acropigmentation of Dohi': 17, 'DSH Hyperpigmented macules': 1, 'BI-RAD 3 lesion': 1, 'DSH scars': 1, 'skin disease Dyschromatosis symmetrica hereditaria 1': 1, 'DSH1': 5, 'Autosomal dominant dyschromatosis': 1, 'Reticulate acropigmentation of Dohi': 13, 'Reticulate acropigmentation of dohi': 3, 'RAD II': 1, 'PI-RAD 4 or 5': 1, 'inherited skin disorder dyschromatosis symmetrica hereditaria': 1, 'RAD.P': 1, 'Dyschromatosis': 6, 'LI-RAD 5': 3, 'RAD-P': 1, 'SHIM-RAD': 1, 'SHIMA-RAD': 1, 'RAD-': 4, 'RAD-EGJOO': 3, 'CH(2)DSH': 1, 'dyschromatosis symmetrica': 3, 'dyschromatosis symmetrica hereditaria 1': 1, 'Acropigmentation of Dohi': 3, 'Bathyactis symmetrica': 1, 'BI-RAD': 4, 'dyschromatrosis symmetrica hereditaria': 1, 'Dyschromatosis symmetrica': 2, 'APD': 1, 'Reticulate Acropigmentation of Dohi': 2, 'RAPD': 4, 'RAD symptoms': 1, 'RAD reactive airways disease': 1, 'symmetric extremity paralysis': 1, 'RAD-AID': 4, 'OMIM DSH; 127400': 1, 'SES': 2, 'A DSH': 1, 'LI-RAD': 3, 'skin disorder Dyschromatosis Symmetrica Hereditaria': 2, 'DSH IPD': 1, 'dyschromatosis symmetrica hereditaria (DSH) 1': 1, 'Brachial Cutaneous Dyschromatosis': 4, 'symmetrical dyschromatosis of the extremities': 1, 'dyschromatosis symmetrica heterditaria': 1, 'RAD +': 1, 'CO-RAD': 1, 'heterotopica symmetrica': 1, 'PI-RAD 3': 1, 'OR-RAD': 1, 'Serpens endocrania symmetrica': 1, 'Dohi': 5, 'RAD-COVID 2': 1, 'RAD-COVID 3': 1, 'RAD-COVID 1': 1, 'RAD-FVT': 1, 'dyschromatosis symmetrica hereditiaria': 1, 'RAD-SCoV': 1, 'ADAR dyschromatosis symmetrica hereditaria': 1, 'symmetrical swelling of the lower extremities': 1, 'cDSH': 1, 'dyschromatosis symmetrica hereditearia': 1, 'c-RAD': 1, 'CAD-RAD': 2, 'type B DSH': 1, 'reticulated acropigmentation of Dohi': 1, 'PI-RAD': 2, 'RAD tumors': 1, 'LI-RAD-4': 1, 'Fenestrae parietalis symmetricae': 1, 'symmetrical acropigmentation of Dohi': 2, 'familial reticulated dystrophy': 1, 'Lipomatosis benigna symmetrica--syndrome': 1, 'P-RAD': 1, 'Sino-RAD': 4, 'X-RAD': 1, 'AWC-DSH': 1, 'Familial reticulate acropigmentation of Dohi': 2, 'dyschomatosis symmetrica hereditaria': 1, 'DSH skin manifestations': 1, 'DSH Disease': 1, 'hypopigmented DSH macules': 1, 'DSH skin lesions': 1, 'TI-RAD 5': 1, 'T-RAD': 1, 'RAD-SEQ': 1, 'RAD-M': 1, 'dyschromatosis symmetrica hereditarian': 2, 'AP RAD': 1, 'Lung-RAD': 1, 'Dyschromatosis Symmetrica Herediteria': 1, 'RAD-ON01': 1, 'RAD 51D': 1, 'Dohi Genetic Dyschromatosis symmetrica hereditaria': 1, 'DSH-': 2, 'RAD@miR': 1, 'LI-RAD 3': 1, 'LI-RAD 4 and 5': 1, 'symmetrical lower extremity neuropathy': 1, 'RAD- IATION SICKNESS': 1, 'RAD-R.': 1, 'RAD-R': 1, 'Contractura symmetrica': 1, 'dyschromatosis of the extremities': 1, 'RAD-T.': 1, 'symmetrica': 1, 'PI-RAD 5': 1, 'PI-RAD 4': 1, 'dyschromatosis disorder': 3, 'Symmetrospora symmetrica': 2, 'RAD 4': 1, 'RAD 2': 1, 'Co-RAD 6': 1, 'ASD RAD': 1, 'symmetrical extremity defects': 1, '-RAD 3': 2, 'Quadrulella symmetrica': 1, 'autosomal-dominant dyschromatosis': 1, 'acropigmentation of dohi': 1, 'VQA-RAD': 1, 'Acropigmentation of dohi': 2, 'MM RAD': 1, 'FTF RAD': 1, 'RAD (radiation sensitivity abnormal': 1, 'RAD-inhibited': 1, 'RAD-54 deficiency': 1, 'skin disorder dyschromatosis symmetrica hereditaria': 1, 'PI-RAD 3-5': 1, 'dyschromatosis symmetrica herediteria': 1, 'Lipomatosis symmetrica benigna': 1, 'RAD reactive airway disease': 2, 'DSH;OMIM': 1, 'Dyscrhromatosus Symmetrica Hereditaria': 1, 'Dyschromatosis symmetrica herediaria': 1, 'dyschromatosis ptychotropica': 1, 'Dyschromatosis ptychotropica': 1, 'upper extremity symmetric spasms': 1, 'RAD-FRS': 1, 'skin disease dyschromatosis symmetrica hereditaria': 1, 'RAD- IATION INJURY': 1, 'DSH deliberate self-harm': 1, 'CO-RAD 6': 1, 'RAD deficiency': 1, 'multiple dyschromatosis': 1, 'DSH%': 1, 'RAD_HGP': 1, '-RAD IV': 1, 'RAD V': 1, 'RAD-Injury': 1, 'Dyschromatosis Symmetrica Hereditaria 1': 1, 'DSH s.n': 1, 'poikilodermatous dyschromatosis': 1, 'dominant dyschromatosis symmetrica hereditaria': 1, 'Dyschromatosis symmetricaAD': 1, 'Sanionia symmetrica': 1, 'RAD-COVID': 1, 'RAD-Covid': 1, 'SYMMETRICA PROFUNDA': 1, 'hereditary dyschromatosis symmetrica hereditaria': 1, 'fenestrae parietales symmetricae': 1, 'dyschromia symmetrica hereditaria': 1, 'RAD-BOARD LEAD SHIELDS': 1, 'symmetric aneurysms of the extremities': 1, 'inherited skin disease dyschromatosis symmetrica hereditaria': 1, 'leg dyschromatosis': 1, 'tonsilla lingualis heterotopica symmetrica': 1, 'Fenestrae parietales symmetricae': 1, 'LI-RAD 4B': 1, 'RAD_R': 1, 'RAD-IH': 1, 'FACT-HN-RAD': 1} | DSH |
Disease | MESH:C535730 | {'degeneratio hyaloideoretinalis hereditaria': 1, 'Autosomal Dominant Dyschromatosis Universalis Hereditaria': 1, 'autosomal dominant dyschromatosis universalis hereditaria': 1, 'DUH': 58, 'Dyschromatosis universalis hereditaria': 62, 'amiloidosis hereditaria': 2, 'polineuropatia hereditaria': 1, 'dyschromatosis universalis hereditaria': 84, 'dyschromatosis universalis': 8, 'Dyschromatosis Universalis': 7, 'DUH lesions': 1, 'Hereditaria': 13, 'DUH Hyperpigmented macules': 1, 'hipoacusia hereditaria': 1, 'trombofilia hereditaria': 4, 'esferocitosis hereditaria': 2, 'syndromeDyschromatosis universalis hereditaria': 1, 'hereditaria': 17, 'trombofilias hereditarias': 2, 'Trombofilias hereditarias': 1, 'predisposicion hereditaria': 2, 'hereditarias': 4, 'degeneratio labyrinthi acustici (DLA) congenita hereditaria': 1, 'miocardiopatias hereditarias': 2, 'HEREDITARIA': 2, 'Sporadic Dyschromatosis Universalis Hereditaria': 2, 'doencas hereditarias': 2, 'Dyscromatosis universalis hereditaria': 1, 'paraplejia espastica hereditaria': 1, 'Dyschromatosis Universalis Hereditaria': 6, 'dyschromatosis symmetrical hereditaria': 6, 'Degeneratio hyaloideo-retinalis hereditaria': 1, 'arritmias hereditarias': 2, 'Hereditarias': 1, 'polineuropatia amiloide hereditaria': 1, 'hemofilia hereditaria': 1, 'hemorragica hereditaria': 2, 'patologia hereditaria': 1, 'pigmentary DUH': 1, 'hemocromatose hereditaria': 1, 'algumas doencas hereditarias': 1, 'Dyschromatosis universalis': 4, 'etiologia hereditaria': 1, 'acroqueratodermia papulotranslucida hereditaria': 1, 'Dyschromatosis symmetric hereditaria': 1, 'dyschromatosis symmetric hereditaria': 1, 'Myoclonia hereditaria musculi mentalis': 1, 'dyschromia universalis hereditaria': 1, 'cardiaca hereditaria': 2, 'Dyschromatosis universalis hereditaria Skin disorder': 1, 'DUH lesion': 2, 'canalopatia hereditaria': 2, 'lesiones blancas hereditarias': 1, 'porphyria and dyschromatosis universalis hereditaria': 1, 'mutacoes hereditarias': 1, 'neuropatia hereditaria': 2, 'EH': 1, 'EH leve': 1, 'cardiomiopatias hereditarias': 1, 'dyschromatosis universalis hereditarian': 3, 'alteracion retiniana hereditaria': 1, 'DDD-DUH': 1, 'DUH-like pigmentation': 2, 'inmnosudeficiencia hereditaria': 1, 'malformaciones hereditarias': 1, 'DSH': 4, 'Chondrodysplasia hereditaria deformans': 1, 'hereditaria, idiopathica with pachydermias': 1, 'dysstasia areflexica hereditaria': 1, 'Hipoacusias hereditarias': 1, 'amiloidose hereditaria': 1, 'forma hereditaria': 1, 'Dyschromatosis hereditaria': 1, 'universalis dyschromatosis': 1, 'Universalis dyschromatosis': 1, 'Teleangiectasia haemorrhagica hereditaria': 2, 'miocardiopatia hereditaria': 2, 'doenca hereditaria': 3, 'Epidermolysis bulosa hereditaria': 1, 'dyschromatosis hereditaria': 1, 'Dyschromatosis symetrica hereditaria': 1, 'hyperpigmentation of dyschromatosis universalis hereditaria': 1, 'Degeneratio hyaloretinalis hereditaria': 1, 'LHH hereditaria': 1, 'enfermedades hereditarias de': 1, 'Dyschromatosis universalis hereditaria mottled pigmentation': 1, 'neurometabolicas hereditarias': 1, 'ATTR hereditaria': 1, 'ATTRh': 1, 'diferencias hereditarias': 1, 'teleangiectasia hereditaria haemorrhagica': 1, 'enfermedad hereditaria': 1, 'DUH-like': 2, 'DUH-': 1, 'musculares hereditarias': 1, 'transtirretina hereditaria': 1, 'enfermedad cardiaca hereditaria': 1, 'dyschormatosis universalis hereditaria': 1, 'Dyschromatosis-universalis': 1, 'DU': 1, 'anoftalmia hereditarias': 1, 'doencas metabolicas hereditarias': 1, 'anomalias dentarias hereditarias': 1} | dyschromatosis universalis hereditaria |
Disease | MESH:C535731 | {'cHS': 10, 'cerebellar hypoplasia Dysequilibrium': 1, 'VLDLR-related disequilibrium syndrome': 2, 'Ch': 167, 'CHs': 436, 'DES': 483, '-DES': 13, 'dysequilibrium': 212, 'alveolar simplification': 111, 'nonprogressive motor impairment syndromes': 1, 'Ch-CV': 1, 'dysequilibrium syndrome': 1, "-Ch'ing": 4, 'quadrupedalism': 20, 'PUBLIQUE DES HOPITAUX DE MARSEILLE': 1, 'AP-HM': 1, 'simplification': 77, 'ch': 21, 'cerebellar ataxia with mental retardation': 2, 'CHs degeneration': 2, 'Ch-A-T^': 1, 'Dysequilibrium': 12, 'DES carcinoma': 1, 'Ch-MDH': 1, 'SMS-NAC-ch': 1, 'nonprogressive disorders': 6, 'ch-ronic diarrhea': 1, 'Dysequilibrium syndrome': 13, 'cerebellar ataxia, mental retardation, and dysequilibrium syndrome 1': 1, 'dysequilibrium syndrome': 58, 'CAMRQ1': 4, 'dysequilibrium syndromes': 2, 'autisme.ch': 4, 'Autisme': 1, 'cH': 16, 'alveolar simpliFIcation': 1, 'DD Ch': 1, 'sarcoatlas.scicore.unibas.ch': 4, 'dysequilibrium syndrome-2': 2, 'DES.DE': 3, 'DEFICIT PARTIELLE RECIDIVE DES SYMPTOMES': 1, 'synaptic simplification': 1, 'LA FAIBLESSE DES OUTILS THERAPEUTIQUES': 1, 'Ch-021': 1, 'Ch-R': 1, 'Ch-S': 2, 'Ch-S.': 1, 'cerebellar ataxia, mental retardation and disequilibrium syndrome 4': 1, 'dysequilibrium spells': 1, 'EINZELELEMENTEN DES ENDOPLASMATISCHEN RETIKULUMS': 1, 'ATLAS': 1, 'ch - cheliphore': 1, 'IPCC': 1, 'DES CONSTRUCTIONS SCOLAIRES': 1, 'Ch-L': 1, 'Ch-RM': 2, '-Ch': 12, 'autosomal recessive nonprogressive neurodevelopmental disorder': 1, 'Ch-EVAR': 1, '-nervosa.ch': 1, 'Chs': 4, 'Ch-e tumors': 1, 'Ch + Dia': 1, 'Ch-Z': 1, 'Ch-Go': 1, 'SIMPLIFICATION OF ADVERSE': 1, 'Ch ef de Menage': 1, 'CHs 6 or 10': 1, 'CHs 6 and 10': 1, 'Vldlr deficiency': 2, 'gyral simplification': 8, 'ch.capillaris': 1, 'dysequilibrium syndrome type 3': 1, 'cerebellar ataxia and mental retardation': 1, 'emotional dysequilibrium': 1, 'ChS': 10, 'ChS.': 2, 'Ch-choroid': 1, 'SOME SIMPLIFICATION OF': 1, 'tuberculist.epfl.ch': 6, 'Dialysis dysequilibrium syndrome': 4, 'Chs c': 1, 'DES-II dissociation': 1, 'Ch-036': 1, 'Ch chondroid': 1, 'frontal dysequilibrium': 2, 'dysequilibrium of the gait': 1, "Ch'orti": 1, 'ChS III': 1, 'dialysis dysequilibrium': 1, 'quadrupedism': 1, "D'EVALUATION DES CAUCHEMARS TRAUMATIQUES": 1, 'SE Ch': 1, 'Ch.agilis': 1, 'Ch.agilis 2': 1, 'DES-II': 3, 'Ch.trachomatis infections': 1, 'SarcoAtlas': 2, 'cerebral gyral simplification': 2, 'SYNDROME DES ANTIPHOSPHOLIPIES': 1, 'quadrupedal galloping': 3, 'DES syndrome': 8, 'Class Ch Misch-Judy': 1, 'Ch-SM': 1, 'Alveolar simplification': 7, 'PDPCCU': 1, 'quadrupedal locomotion': 11, 'strabismic sensorimotor dysequilibrium': 1, 'Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 4': 1, 'QM': 1, 'cH&P': 1, 'ch.g.': 1, 'Ind-Ch': 1, 'ch.t.': 1, 'CONTINUUM DES PHASES PREVENTIVES': 1, 'DES POPULATIONS VULNERABLES': 1, 'DES STRATEGIES PREVENTIVES': 1, 'DES STRUCTURES PREVENTIVES DISPARATES': 1, '-base dysequilibrium': 1, 'locomotor dysequilibrium': 2, 'DPS-Ch': 1, 'Pe-ch': 1, 'nonprogressive motor disorder': 1, 'cH & G': 1, 'quadrupedal locomotion type 1': 1, 'cerebellar ataxia mental retardation': 3, 'MCP-Ch': 2, 'Ch.t.': 1, 'De-ch': 1, 'dysequilibrium symptoms': 2, 'Mt-Ch': 1, 'Ch-19': 1, 'LAMIVUDINE SIMPLIFICATION STUDY': 1, 'SIMPLIFICATION': 5, 'quadrupedal locomotion, speech and thinking impairments': 1, 'quadrupedal disorder': 1, 'CAMRQ': 8, 'claudia.daubenberger@unibas.ch': 1, 'Familial dysequilibrium-diplegia': 1, 'Gilmour': 1, "Ch'ixi": 1, 'cH.': 2, 'VALIDATION DES CRITERES': 1, 'Ch-TGC': 2, 'CAMRQ syndrome': 1, 'cerebellar ataxia, mental retardation and disequilibrium (CAMRQ) syndrome': 1, 'V. ch': 1, 'UNITE DES INTERACTIONS': 1, 'DESL': 1, 'DES-T': 2, 'Ch 22': 1, 'OUTPUT OF MINAS': 1, 'Social impairment DES': 1, 'Ch.': 10, 'Kuehni claudia.kuehni@ispm.unibe.ch': 1, 'Ch-LC': 2, 'HUI-Ch': 1, 'renal_ch': 1, 'Myopathy Ch': 1, 'Leod Autoimmune Ch': 1, 'Leod Ch': 1, 'SENA_DES': 1, 'cortical simplification': 1, 'Ch RMs': 1, 'Ch RhM': 1, 'FAB-Ch': 1, 'Ch.h.': 1, 'cH. odoe': 1, 'Arboreal quadrupedalism': 1, 'inherited disorder of quadrupedal locomotion': 1, 'CAMRQ4': 4, 'Cerebellar ataxia, mental retardation and disequilibrium syndrome 4': 1, 'STP': 1, 'CINeMA': 2, 'GCCLCC': 1, 'Ch.T.': 1, "Ch'oge": 1, 'recessive quadrupedalism': 1, 'gyral hypoplasia': 3, 'SA-Ch': 1, 'Ch-NA': 1, 'ChS-AP': 1, 'Dysequilibrium Syndrome': 5, 'Cerebellar ataxia, mental retardation and dysequilibrium syndrome 1': 1, 'Non-progressive cerebellar ataxia with mental retardation': 1, 'DES-related myopathy': 1, 'dysequilibrium and related disorders': 1, 'dysequilibrium disorders': 2, 'Dysequilibrium disorders': 1, 'TERRE DES MERVEILLES': 1, 'nonprogressive motor disorders': 1, 'Ch-': 4, 'DES.Patients': 1, 'nonprogressive disorders of the': 1, 'paroxysmal dysequilibrium': 1, 'PRP': 1, 'SIMPLIFICATION ATTEMPTS': 1, "Ch'ng": 1, 'Ch-E': 1, 'cH L': 2, 'LD': 1, 'CHs 1 and 2': 2, 'DES-': 2, 'gyral simplification in the cortex': 1, 'DES SCIENCES': 1, 'calcium dysequilibrium': 1, 'SIMPLIFICATION OF EXTRACORPOREAL CIRCULATION': 2, 'DES ENFANTS MALADES': 1, 'Ch-P': 2, 'DES disequilibrium syndrome': 1, 'PAM-Ch': 1, 'LS': 1, 'MUSS': 1, 'TS': 1, 'P&Ch': 1, 'OFFICE INTERNATIONAL DES EPIZOOTIES': 1, 'OIE': 1, 'EPD': 1, 'formonosomy of Ch': 1, 'ch emodectoma': 1, "Ch'oe": 1, 'DES ARYENS': 1, 'Ch suffr': 1, 'Cerebellar ataxia, non-progressive, with mental retardation': 1, 'tuberculist@epfl.ch': 1, 'cerebellar, gyral, cortical defects': 1, 'CHs 22 and 32': 1, 'DES descensus': 1, 'CX3D': 2, 'PROTECTION DES ANIMAUX DU CRCHUM': 1, 'CHs 1-3': 1, 'Dysequilibrium of aging': 2, 'dysequilibrium syndrome 2': 2, 'Ch hepatitis': 1, 'CHIMIOTACTIQUE DES CELLULES GERMINALES': 1, 'ch-': 1, 'CAMRQ4) syndrome': 1, 'mental retardation, and dysequilibrium syndrome type 4': 1, 'CAMRQ type 4': 1, 'dysequilibrium syndrome type 4': 2, 'mental retardation, and dysequilibrium syndrome type 4 (': 1, 'CAMRQ4 syndrome': 2, 'cerebellar ataxia, mental retardation, and dysequilibrium 4': 1, 'AQ': 1, 'Ch-PY': 1, 'cerebral gyral anomalies': 1, 'VLDLR': 1, 'nonprogressive disorder': 7, 'COMITE DE PROTECTION DES PERSONNES EST-IV': 1, 'Ch-PH1': 1, 'Ch&B': 1, 'cerebellar ataxia, mental retardation, disequilibrium syndrome': 1, '1dV-Ch': 1, 'En-Nv-Ch': 1, 'Ch.R.': 1, 'C-Ch': 1, 'SIMPLIFICATION OF (A*A)-1': 1, "Ch'an Su": 1, 'QL': 4, 'X-ch disomy': 1, 'CAMRQ1)': 1, 'vertiginous dysequilibrium': 1, 'PPN-ch': 1, "Ch'aku Q'ara": 1, "Ch'aku": 1, 'MEDECINE DES HOPITAUX': 1, "rahil ch'ool": 1, 'infection of Ch': 2, 'Ch choroid': 1, 'Ch.lu': 1, 'Cerebellar Ataxia, Mental Retardation, and Disequilibrium Syndrome': 1, 'Cerebellar ataxia, mental retardation, and disequilibrium syndrome': 1, 'Cerebellar ataxia, mental retardation, and disequilibrium syndrome type 4': 1, 'OPITAL DES': 1, 'cerebellar ataxia, mental retardation, and disequilibrium syndrome': 1, 'VLDLR-associated disease': 2, 'DES) 15, 16, 17': 1, "Ch'ase": 1, 'CHs of skull': 1, 'Intracranial CHs': 1, 'gyral and cerebral dominance abnormalities': 1, 'A-Ch': 1, 'CHs 26, 28, and 37': 1, 'Ch&A': 1, 'MAISON DES ALIENES': 1, 'Ch-Cj': 1, 'NATIONAL DES SHIGELLA': 1, '23_Ch': 1, '240_Ch': 1, 'claudia.weidensteiner@unibas.ch': 2, '-rna-and-disease.ch': 1, 'metabolic dysequilibrium': 3, 'cH. parasuis': 1, 'hearing impairment and dysequilibrium': 1, 'Ch 7, 16': 1, 'DES Tecnica Veracruz': 2, 'CHs 3': 1, 'Upright quadrupedalism': 1, '-DES-SF-10': 1, 'CYTOPHOTOMETRIQUE DES': 1, 'autosomal recessive, nonprogressive cerebellar disorder': 1, 'MV DES': 1, 'dysequilibrium syndrome (CAMRQ)2': 1, 'Ch&B.': 1, 'Quadrupedalism': 1, 'DES VUS': 1, 'dialysis dysequilibrium syndrome': 3, 'Necrotroph Ch': 1, 'CPP': 1, 'DE PROTECTION DES PERSONNES': 1, 'H.Ch.': 2, 'nonvestibular dysequilibrium': 1, "ch'exori": 1, 'autosomal recessive cerebellar ataxia with mental retardation': 1, 'Ch-HLH': 2, 'DES-H': 1, 'EVOLUTION OF QUADRUPEDALISM': 1, 'DES-H.': 1, 'DES.TCR': 1, 'hyper-Ch': 1, 'Ch Abnormality': 2, 'CHs II': 1, 'CHs II, III, IV, and V': 1, 'CHs IV and V': 1, 'Nonprogressive Disorders': 1, 'ch icue ni': 1, 'Dialysis dysequilibrium': 1, 'OPITAL DES ENFANTS-MALADES': 1, 'APPARENT SIMPLIFICATION OF': 1, "COMITE D'EVALUATION DES PROTOCOLES DE": 1, 'Nonprogressive cerebellar disorder': 1, 'Ch/R': 1, 'haemato-oncological disease Ch': 1, 'pulmonary simplification': 1, 'Ch-CH': 1, 'Ch-EVAS': 2, 'acid-base dysequilibrium': 4, 'nonprogressive motor neuropathy': 1, "ch'illa": 1, 'geriatric dysequilibrium': 1, 'Ch.Ab.': 1, 'Q-HARP': 1, "ch'arki": 1, 'postoperative dysequilibrium': 2, 'Pi ch': 1, 'Pi Ch': 1, 'ch.c.p.': 1, 'Ch-TAA': 1, 'Ch /': 1, 'VLDLR deficiency': 1, 'Ch suffr S-Stenomedit': 1, 'Ch suffr Endem': 1, 'simplification of the': 1, 'SIMPLIFICATION GENERATIONS': 1, 'SysNDD': 1, 'dysequilibrium of ageing': 1, 'Dysequilibrium of ageing': 1, 'primary dysequilibrium of ageing': 1, 'quadrupedal ataxia': 1, 'Ch.glomerulonephritis': 1, 'ch.r.f.': 1, 'graviportal quadrupedalism': 1, 'mitochondrial metabolism Dysequilibrium syndrome': 1, 'PROTECTION DES': 1, 'APPARENT SIMPLIFICATION': 1, 'ch-SG occlusion': 1, 'ch-SG occlusions': 1, 'Ch-H-R': 1, 'E.ch': 1, 'Gyral simplification': 1, 'CooS-V Ch': 1, 'Ch-No': 1, 'aDMCHs': 1, 'FROM DES MOINES': 1, 'COMITE DE PROTECTION DES': 1, 'chronic dysequilibrium': 1, 'Chs-A': 1, 'ATS': 1, 'COLLECTE DES DONNEES': 1, 'Cerebral gyral dysplasias': 1, 'dysequilibrium of aging': 1, 'SWE-DES-23': 1, 'LISTE DES ABREVIATIONS': 1, 'dysequilibrium of central disorder': 1, 'DES BOVINS': 1, 'quadrupedal locomotion syndrome': 2, 'Ch-C': 1, 'P-Ch C': 2, 'P-Ch B': 1, 'GREAT SIMPLIFICATION OF THE SPLENOPORTOGRAPHIC TECHNIC': 1, 'visual field nonprogression': 1, 'ChOLE-Ch': 1, "Ch'ol": 1, 'DES-Amyloidoses': 1, 'cerebral gyral abnormalities': 1, 'ch- ronic alcoholism': 1, 'Ch-GTPI': 1, 'cH&E': 1, 'DES typeb': 1, 'nicolas.ray@unige.ch': 1, 'Carr-Ch': 1, 'RESOLUTION OF DES-A-STEROID ANALOGUES BY': 1, 'Ch-IP': 1, 'ISR': 1, 'ROYAL DES INVALIDES': 1, 'P. ch.': 1, 'subclass dysequilibrium syndrome type 1': 1, 'ChS subtype 3': 1, 'ChS subtype 1': 1, 'ChS subtype 2': 1, 'cerebellar dysequilibrium': 1, 'On/Ch tumors': 1, 'Ch tumors': 1, 'COMITE DE PROTECTION DES PERSONNES SUD MEDITERRANEE': 1, 'DES related anomaly': 1, 'ChS of the': 1, 'Laryngeal ChS': 1, 'CHs 27, 29, 31,': 1, 'DIFFERENCIATION DES CARACTERES SEXUELS SOMATIQUES DE': 1, 'cerebellar ataxia, mental retardation and disequilibrium syndrome': 1, "ch'uan": 1, "Ch'a-chaak": 1, 'BFS': 1, 'nonprogressive movement disorder syndrome': 1, 'cerebellar and gyral anomalies': 1, 'cerebellar of gyral anomalies': 1, 'Ch-hyperplane': 1, "Sluder's CHs": 1, 'cerebral and cerebellar gyral abnormalities': 1, 'B.Ch.': 1, 'X-linked DES': 1, 'Ch-CDS': 1, 'dysequilibrium syndrome type 2': 1, 'LARGUIER DES BANCELS': 1, 'Renal CHs': 1, 'favre@unige.ch': 1, 'DES.DesignData': 1, 'Ch-1': 1, 'nonprogressive disorder of movement': 1, 'Ch-Ac': 1, 'SIMPLIFICATION OF SORTING AND': 1, 'ataxia/dysequilibrium': 1, 'CHs disability': 1, 'SIMPLIFICATION OF THE PBI TEST': 1, 'DES-Zurich BVS': 1, 'DES - Zurich BVS-type': 1, 'DES ASSURANCES': 1, 'nonprogressive neuropathy': 1, 'Ch-En': 1, 'TMA DES': 1, 'DES MOINES': 1, 'covidtracker.ch': 1, 'Ch-Sz': 1, 'DES II': 1, 'HALFTE DES GANZEN': 1, 'claudia.kuehni@unibe.ch': 1, 'ch.b.': 1, 'N&CHs': 1, 'Ch Hyperlipidaemia': 1, 'Nonprogressive cerebellar malformations': 1, 'pervye 24-48 ch posle operatsii': 1, 'and pulmonary vascular simplification': 1, 'cH. werneckii': 1, 'DES Desequilibrium syndrome': 1, 'P-Ch A-C': 1, 'MECON': 1, 'SIMPLIFED TECHNIC': 1, 'ch nochi': 1, 'ID with or without quadrupedal locomotion 1': 1, 'cerebellar ataxia, mental retardation and disequilibrium syndrome types 1': 1, 'Quadrupedal locomotion': 1, "Ch'ing": 1, 'SCH': 1, 'Nonprogressive disorder': 1, 'Cerebellar ataxia, mental retardation, and disequilibrium syndrome 4': 1, 'Cerebellar Ataxia, Mental Retardation, and Disequilibrium Syndrome 4': 1, 'Nonprogressive mental retardation': 1, 'Dysequilibrium/gait dysfunction': 1, 'CAMRQ2)': 1} | DES |
Disease | MESH:C535733 | {'toxicity.22': 8, 't(11;14': 156, 'der dunklen': 1, 't(4;11': 80, 't(4;14': 107, 'der fruhen': 1, 't(9;11': 34, 't(11; 14': 5, 't(6;11': 18, 't(6;11)': 28, 't(9;22': 106, 'Der(16)': 1, '22': 309, 'Vorteile der': 1, 'CC 22': 1, 'RDDGs': 1, 'DACHS': 24, 'Emanuel syndrome': 100, 't(10;11': 11, 't(10; 11)': 1, 'coeliac disease.22': 1, 'deliciosa:22': 1, 'supernumerary der(22) syndrome': 5, 'supernumerary der(22),t(11;22) syndrome': 1, 'r(22) syndrome': 4, 'r(22)': 11, 'cerebral hypoperfusion,22': 1, 'DVSV': 1, 't(11;14)': 182, 'Fragebogen erlebter Defizite der Aufmerksamkeit': 2, 't(9;11)': 50, 'der(': 9, 'Heredity 22': 1, 'diseases.22': 1, '-22': 81, 't(2;11)': 1, 't(4;11)': 93, 'der(22)t(8;22) syndrome': 2, 'der(22)t(11;22)': 5, 'supernumerary der(22)t(8;22) syndrome': 1, 'Der(22) syndrome': 3, 'Derivative 22 (der[22]) syndrome': 1, 'der(22) syndrome': 21, 'ALS,22': 1, 't (11; 19)': 1, 'Deletion 22 Syndrome': 1, 'der': 104, 't(4;11)2': 1, 't(9;22)': 169, 'Hauptlast der': 1, 'der(14)t': 2, 't(4;14)': 106, 't(11;19)': 18, 'der hage': 1, 'Erhebung der': 3, 't (11;14': 7, 'Diskussion der Ergebnisse': 4, 'S-22': 2, 'AD-MSC': 1, '22.q.11 deletion syndrome': 1, 't(11;22': 9, 'Praparation der': 2, 'CNS 22': 1, 'SGA:22': 1, 'Variabilitat der Daten': 1, 'UPD 22': 3, 'CN 22': 1, 'Mitglied der DIVI': 1, 'col 22': 1, 'Der Meskalinrausch': 1, 'N22': 2, 'NR CR 22': 1, 't(4;14) abnormalities': 1, '22 q 11.2 deletion syndrome': 1, 'stiffness.22': 1, 'SARS2-22': 1, 'SNOMED 1,22,222': 1, 'TKI.22': 1, 't(8;11': 1, 'lymphadenopathy:22': 1, 't(11,14': 4, 'SED1-22': 1, 'der (22)': 3, '1;22': 5, 't (6;11)': 4, ')t(11;16': 1, 'hepatocarcinoma 22': 14, 'Ursachen der Hypothyreose': 1, '18;22': 1, 'Der kwe harem': 1, 'BDC': 3, 'Von der Schizophrenie zur': 1, 'hand anomalies.22': 1, 'Bestimmung der Albuminurie': 1, 'neuronal loss.22': 1, 'seizures.22': 5, 'SF-GG-22': 1, 'NKLM': 1, 'CH 22': 3, 'IR4630-22': 1, ', der (14; 22)': 1, 'DKA': 1, 'Der f 1': 3, 'AWMF': 25, '22)': 2, 't(11;17)': 26, 't(11;17': 8, 'Nephropathy 22': 1, 'patientsDomain I:22': 1, 'Rahmen der': 3, 'GENES DERIVING FROM THE SUSHI-ICHI-RELATED RETROTRANSPOSON': 1, 'Emanuel Syndrome': 19, 'sexual IPV:22': 1, 'macroangiopathy.22': 1, 'CR-22-114-L': 1, 'der Interviewausschnitte': 1, 't(2;11': 2, 'Der': 15, 'Phanomen der Rezirkulation': 1, 'VUSC-018-1-22': 1, 'OC (22)': 1, 'Der Datenschutz': 3, 'ZUF': 1, 't(6;11) RCCs': 4, 'hIAPP': 1, 'atherosclerosis21, 22': 1, 't(7;11)': 7, '(22': 9, 'MdE-Einschatzung': 1, 'MdE-Bewertung': 1, 'Handbuch der plastischen': 1, 'neuroinflammation,22': 1, '22 deletion syndrome': 1, 'epilepsy.22': 3, 'c. STO 22': 1, 'EF.22': 1, 'Rahmen der 5': 1, 'SARA': 1, 'mitomap 22': 1, 'der Hornhautfaden': 1, 'ACPs 22': 1, 'SMDF': 5, 'TSOA[22': 1, 'der Muslime': 1, 'ZMD': 1, 'BC.22': 1, 'der Plas': 1, 'Rahmen der 1': 3, 'der Fallzahlen': 1, 't (11;14)': 13, 'der Bauchlage': 1, 'Allmacht der Naturzuchtung': 1, 'of 22': 1, '22long-covid%22%20OR%20%22long%20covid%22': 1, 'hypoplasia of tooth 22': 1, 'Der/die': 4, 'of interest.22': 1, 'PIMUZ': 2, 't(11;22)': 29, 'Daten gemass der Verordnung': 2, 'lidA': 5, 'Dauer der Reanimation': 2, 'Bestimmung der Lungenfunktion': 2, 'Limnophyes 22': 1, 't(11;14) abnormality': 4, 'SEC-22': 1, 't(6,11)': 1, 'endothelial dysfunction.22': 3, 'disor ders': 1, 'Zeitpunkt der Defibrillation': 1, 'MT-IPMN20-22': 1, 't(9,22)': 6, 'ORMES-22': 1, 'ED.22': 1, '14;22': 1, 'AIAB': 1, 'NAIMI.22': 1, 't(18;22)': 1, 'LUM.22': 1, 'P3 Inv22': 1, 'P1 Inv22': 1, 'P6 Inv22': 1, 'P5 Inv22': 1, 'Gruppe der Schizophrenien': 2, 'MACE15.22': 1, 't(11;18)': 13, 'CAM- 22': 1, 'Idiopathisches multiples Pigmentsarkom der Haut': 2, 'Bestimmung der': 1, 'CMOC 22': 1, 'supernumerary derivative 22 syndrome': 3, 't(11;16)': 7, 't(9,22': 2, 't(19;22': 1, 'ectodermic derivates abnormalities': 1, 'centroblastic/-cytic 22': 1, '20p11.22': 1, 'SNOT-22': 13, 'PGBD5 deficiency syndrome': 1, 'REARRANGEMENT OF ETHOXYCARBONYLHYDANTOIN DERIVATIVES': 1, 'der 31': 1, 't(7;11': 15, 'REARRANGEMENT OF 3-ACYLHYDANTOIN DERIVATIVES': 1, 't (4;14)': 5, 'Hemmung der': 1, 'der Helm': 2, 'movement disorders,22': 1, 'SIP': 1, 't (11;14) myeloma': 1, 'Lokalisation der Metastasen': 1, 'Zunahme der hypochromen Retikulozyten': 1, 'Risiken der Neutropenie': 1, 'der Erythropoese': 1, 'CLuD:22': 1, "jealous monomania'.22": 1, 'CPRI': 1, 'deficiency of the IL-22': 1, 'disor-ders': 3, 'Der Klooster': 1, 'renal AL deposition': 1, 't(6;11) carcinoma': 2, 't(6;11) carcinomas': 1, 'Biphasic t(6;11)': 1, 'JM 22': 1, 'Erhohung der Viruslast': 1, 'trisomic in der(22) syndrome': 1, 'CC-22': 3, 'Der laryngopharyngeale Reflux': 2, 'UTI 22': 1, 'arthroparthies.22': 1, 'EDI': 2, 'MRL1-22': 1, 'Cytotoxicity 22': 1, 'MLVA type 22': 1, 'FESV': 1, 'WA2.22': 1, 't (4;11)': 2, 'Der-moscopy': 1, 'BVA': 2, 'Myelodysplasia with der': 1, 't(1;11': 2, 'gnomAD': 1, 'der Literaturwissenschaft': 1, 't(9; 22; 14)': 2, 'CMale,22': 1, 't(3;22)': 1, 'thrombi.22': 2, 't(11;18': 16, 'bleeding.22': 7, '+der': 1, 'Supernumerary der[22]t[11;22': 1, 'lutea.22': 1, 'weigh loss.22': 1, '22)t': 3, 'myocardial injury.22': 1, 'Der(X)': 1, 'der(X)': 1, '22S-HC': 1, 'necrotic myocardial tissue.22': 1, 'PAC': 6, 'Der Werf': 1, 'Hydroiden der Deutschen Sudpolar': 1, 't(11;11;22': 1, 'Lymphknoten betrug 22': 1, 'Der Familienstatus': 1, 'HTM-N22': 1, 'of tooth 22': 1, '(22)t(11;22) syndrome': 1, 'HY-22': 1, 'Varianten der': 1, 'HT-22 Ferroptosis': 1, 'HT-22': 2, 'monogenic diseases.22': 1, 'Ders konularini': 1, 'ders konularini': 1, 'L:22': 1, 'cytotoxicity.22': 2, 'racism.22': 1, 'microalbuminuria.22': 1, 'V-22': 1, 't (4;11': 2, 'ADIPOSE-DERIVED MESENCHYMAL STEM/': 1, 'CA-der': 1, 'CA-der.': 1, 'I-der': 1, 'A-der.': 1, 'I-der.': 1, 'L-der.': 1, 'der Meer': 1, 'motor function.22': 1, '-DAC-22': 1, 't(11;20)': 2, 't(11;14) MM': 1, 't(11;14) myeloma': 18, 't(11;16': 5, 'der(22)t(11;22) syndrome': 5, 'ST22': 1, 'ST22-': 1, 'ESVIM-P-22': 1, 'PH#22': 1, 'domestic violence.22': 1, 'FEDA': 2, 'pulse type 22': 1, 'Kolonisation der': 1, 't(11;19': 15, 'hindlimb ischaemia.22': 1, 'ON 22': 1, "'s disease.22": 1, 'ASCEMS': 2, 't(11; 14)': 2, 'NETosis 22': 1, 't (11, 19)': 1, 'OAR 22': 1, 'JDI-22': 1, 'CF Der Motor': 1, 'TF:22': 1, 'JS-22': 1, 'Riesenzelltumor der Sehnenscheide': 1, 'der Spoel': 5, 'CHF-CA-22': 1, '(14/22': 1, 'AN-22': 2, 'LEADING:22': 4, 'Limited cutaneous 22': 1, 'HD:22': 1, 'HCFC-22': 2, 'neurodegeneration.22': 2, 'Der-Cherng Tarng': 2, 't(4;11) translocation': 1, 'ON:22': 1, 'Emanuel': 5, 't(4; 11)': 1, 'FIII.22': 1, '22:6n3 deficiency': 1, 'Frakturen der': 2, 't (4;14': 3, 'Der p.': 1, 'cSEMS 22': 1, 'der Heijde': 2, 't(1;11)': 3, 'MDS19-22': 1, 'SCC 22': 1, '-22 of': 1, 'OH-22 POS': 1, 'TTD-22': 2, 'TD': 1, 'der Hautkrankheiten': 1, 'AOLG': 1, 'der Pol': 4, 'PID-22': 1, 'IDIOT) syndrome': 1, 'Internet Derived Obstructing Treatment (IDIOT) syndrome': 1, 'Internet Derived Information Obstruction Treatment (IDIOT) Syndrome': 1, 'IDIOT syndrome': 1, 't(10;11)': 6, 'and 22': 5, 'Pulmonary 22': 2, 'CSM21, 22': 1, 'Schwarzbuntes Milchrind der DDR': 1, 'SMR': 1, 'MPG': 1, 'microdont 22': 1, 't (4; 14)': 2, 'CDS-22': 1, 'Comfort:22': 1, 'Ursachen der': 1, 'von der Leyen': 1, 'der (1;14)': 1, 'der Steuergruppe': 2, 'som der': 1, 'pigen som der kysser': 1, 't(7;11) abnormality': 1, 'movement disorders.22': 1, 'fatigue21,22': 1, 'PNT-22': 1, 'grief.22': 1, 'Pravalenz der Riesenzellarteriitis': 1, 't(9;21;22) Ph': 1, '22-A': 1, '22-P': 1, 'MdE': 1, 'PHH:22': 1, 'sexual assault:22': 1, 't (11; 14': 4, '22.network': 1, 'N2': 2, 'OADs.22': 1, 'DVV': 2, 'Th17/22': 1, 'RIPC.22': 1, 'gallblad-der carcinoma': 1, 't(X;11': 1, 'OCCC_22': 1, 'ZBI-22': 8, 'Erhebung der Emotionsregulation': 3, 't(9; 22)': 3, 't (11;19)': 2, 't (11; 14)': 1, 'Lymphocutaneous 22': 1, 'Von der lippe': 1, 'AISC 360-22': 1, 't (6;11': 1, '22-FDHA': 1, 'Der Gaag': 1, 't(17;22)': 4, 'DQDM/22': 1, 'GSC-22': 1, '22-03502R1': 1, 'ES': 14, 'type II (22': 1, 'BRONJ.22': 1, 'Franceschetti, Mobius and Emanuel syndrome': 1, 'glaucomatous abnormality.22': 1, 't (11,14)': 1, 'MSSA-22': 1, 'ROLE OF INTERLEUKIN-22': 1, 'OVERVIEW OF INTERLEUKIN-22': 1, 't(22;22)': 1, 't (9; 22)': 3, '-CT:22': 1, '-compulsive syndromeNeurological syndrome 22': 1, 't(12;22)': 7, 't(17;22': 1, 'Varianz der Einleitungsdauer': 1, '-V-22': 1, '22-15242Tuberculosis': 1, 'Idiopathic 22': 2, 'nephropathy.22': 2, 'OS#22': 1, 'allergies.22': 1, '22) disorder': 1, 'apathy.22': 1, 'AWMF-Leitlinie': 1, 'der(11)': 1, 'BAH': 1, 'supernumerary der(22)t(11;22)': 1, 'supernumerary der(22)t(11;22) syndrome': 4, 'depression21, 22': 1, 'PTB.22': 1, 'KSU-SE-22': 3, '--22,der': 1, 'Zunahme der Dyspnoe': 1, 'A70.22': 1, 'CR-22-': 1, 'Liveborn 22': 1, 'hHiPS': 1, 'BVDD': 3, 'der(22)': 6, 't(4; 14': 2, 'UPN 22': 1, 'der(16)': 2, 'or 22': 2, '(14;22': 3, 't(11;14) myelomas': 1, 'der-matofibrosarcoma protuberans': 1, 'supernumerary der(22)t(8;22)-syndrome': 1, '(14 or 22': 1, 'Derivative 22 syndrome': 2, 't(11,14)': 4, '1,22': 1, 'disasters.22': 1, 'Abnahme der Myopie': 1, 'Supernumerary der(22': 1, 'Stabilitat der Fraktur': 1, 'Disorders of joint 22': 1, 'PMP 22': 1, 'Der Augeninnendruck': 2, 'HFrEF.22': 1, 'Emanuel- syndrome': 1, 't(11;22;14': 1, 'OAGB-22': 1, 'der (': 1, 'der 22': 1, 'Fragebogen zur Erhebung der Emotionsregulation': 2, 'SYNOVIUM-DERIVED MESENCHYMAL': 1, 't(4;11) abnormality': 1, 'glan-ders': 1, 'Vor der': 3, 'dPatient 22': 1, 'ALS.22': 1, 'der Ploeg and Defares': 1, 'OLD:22': 1, 'delivery,22': 1, 'CI-22': 1, 'KM-MRT der': 1, 'mit der': 1, 'I-22,': 1, 'DKU-22-028': 1, 'der(5) abnormalities': 1, 'Dorr 22': 1, 'RN_22': 1, 'muscle-derived abnormalities': 1, 'LEP': 2, 'der (22) t (11;22) syndrome': 2, 'derivative 11;22 syndrome': 3, 'derivative 22 syndrome': 4, 'Der(22)': 1, 'der (22) t (': 1, '(22)': 8, 'myocardial ischemia.22': 1, 'ISCAID - P - 22': 1, 'disor- ders': 1, 'sex hormone-dependent tRNA-derived RNAs': 1, 'SHOT-RNAs': 1, 'disease.22': 1, 'Heredodegeneration der Makula': 1, 'der Makula': 1, 't(4; 14)': 5, 'Der Prozess betr': 2, 'dyslipidaemia,22': 1, 't(11;20': 1, 'WILD': 1, 'Ursache der Hirnstammenzephalitis': 1, 'N-22': 1, 'Der f': 6, 'HT-22 injury': 1, 'LBP-22': 1, 'ADSC': 1, 'IRD 22': 1, 'Hodentumor der Kleinsten': 1, 'TIMI 22': 4, 'OPUS-22': 1, 't(5;11)': 2, 't (9;22)': 1, 'hepatotoxicity.22': 1, 'der(14': 1, 'der 22 - derivative': 1, 'supernumerary-der(22) syndrome': 1, 'derivative 22 chromosome syndrome': 1, 'FS406-22': 2, 'Zeiten der Pandemie': 1, 'AugUR': 3, 'AugUR-1': 1, '22-': 5, 'function.22': 1, 't (9; 22': 1, 'PERP-428CC': 1, 't(7,11)': 1, 'Derivative 22 [der(22)] syndrome': 1, 'Hemmung der Zytokin-Synthese': 1, 'Dauer der': 1, 'Pt-22': 1, 't (11;14) abnormality': 1, 'leukemic t(11;17)': 1, 'Der haufigste': 2, 'GES-22': 1, 'primary hyperpara t': 1, 'der Elst': 2, 't(9;22;11': 1, 'CME-ORL 22': 1, 'neuronal disorders.22': 1, "PAM-22'.mp": 1, 'emanuel': 1, 'disor-der': 1, 'Emanuel- or': 1, 'der(22)t(11;22)-] syndrome': 1, 'Emanuel or derivative chromosome 22': 1, 'der(22)t(11;22': 2, 'Der Gerinnungsstatus': 1, 't(9,11)': 1, 'Emanuel-syndrome': 2, 'Feedback der Peers': 1, 'Der-Chong': 1, 'iECM': 1, 'number 22': 2, 'tooth number 22': 1, 'microleakage.22': 1, 'Seltene genitale Fehlbildungen der Frau': 1, 't (11, 22)': 1, 'Rahmen der 4': 1, 'PID 22': 7, 'Heterogenie der': 1, 'A(16-22)': 1, 'betao thalassaemia 22': 1, 'intracranial injury.22': 1, 't(11;19) tumors': 1, 'VdPB': 1, 't[6,11] translocation': 1, '(11)t': 1, 'der Werf': 1, 'childlessness.22': 1, 'Cn 22': 1, 'CIN1 22': 2, 'TSEBT': 1, 'Variabilitat der Inanspruchnahmeraten': 1, 'neurodevelopmental disor ders': 1, 'Ca9-22': 2, 'deletion 22': 1, 't(4, 11)': 1, 'supernumerary der(22), t(11;22) syndrome': 1, 'bleeding,22': 2, 'Gart der Gesundheit': 1, 'Epilepsy.22': 1, 't(9:22': 1, 'myocardial disor-der': 1, 't(11; 22) TL': 1, 't(11;22) TL': 1, 'Fragebogen erlebter Defizite der Aufmerkzamkeit': 1, '22Aura%20OMI%22': 1, '17 Emanuel syndrome Chromosome': 1, 'CJ:22,3d': 1, '22-00526Diabetes': 1, 'MO:22': 1, 'CN-22': 1, 'Syllabus der Pflanzennamen': 3, 'HC:22': 2, 'NSCLC.22': 1, 'NSCLC LM,22': 1, 't(9; 22) anomaly': 1, '-22-linked disease': 1, 'Leser der LRO': 5, 'climate disasters.22': 1, 'premalignant lesions.22': 1, 'Neonatal der(22)': 1, 'MI,22': 2, 'AZDEX-22': 1, 'der(18)t': 1, '; 22': 1, 'myolysis,22': 1, 'Stammbaum oder der': 1, 'Stammbaum der': 1, 'Stammbaum der echinoderms': 1, 't(x;11': 1, 'ME-22 1': 1, 'der Mila': 1, 't(9;11;19': 1, 'NM2-22': 1, 'BOP:22': 1, 'HC 22': 1, 'CRANAD-22': 1, 'Von der Leyen': 1, 'Neurological Disor ders': 1, 'KEYNOTE-22': 1, 'Der Plas': 1, 'COMPLEMENT-DERIVED': 1, 't(11;14) t': 1, 'der(22)-syndrome': 1, 'area 22': 1, 't(11:14)': 1, 'myeloid-derived cell dysfunction': 1, 'cat-eye- and Emanuel-syndrome': 1, 'HM.22': 1, 'features.22': 1, 'der- matosis': 1, 'MFLU 22-0043': 1, 'MFLU 22-0040': 1, 'COVA1-22': 1, 'supernumary digit': 1, 'CH1-22': 1, 'Goldenhar and Emanuel syndromes': 1, 'Synechie der Stimmlippen': 1, 'Der Weiden': 1, 'Cat-Eye/Emanuel syndrome': 1, 'Der p': 3, 't (11;14) genetic abnormality': 1, 'Fragebogen zur Beurteilung der Behandlung': 1, 'Rahmen der Literaturrecherche': 1, 'der Maas': 1, 'ORANGE 22': 1, 'loss of 22': 1, 't(11;14) abnormalities': 1, 'cerebral injury.22': 1, 'bleeding:22': 1, 'Der-p-': 1, 'dying,22': 1, 'Enteropathy-type 22': 1, 'ANHL-22': 1, 'IDA': 2, 'PID_22': 1, 'Komplikation der Schilddrusenchirurgie': 1, 't(11; 16': 1, 'HSN': 1, 'multimorbidity,22': 1, 'scab 22': 1, 'hermaphrodism.22': 1, 'BiKeR': 1, 'der(16)t': 2, 'Der(16)t': 1, 'hypoglycaemia.22': 4, 'CHDs.22': 1, 'MI,22,XY': 1, 'HC,22': 1, 't(4;11) pro-B': 1, 't(4;11) Pro-B': 1, 't(1;22)': 3, 't[11;14': 2, '22coronavirus%22': 1, 'TURP': 3, 'CA-22': 2, 'supernumerary derivative (22) chromosome syndrome': 2, 'supernumerary der(22)': 2, 'der(22) t(11;22)': 1, '22 (': 1, ', 22, or': 1, 't(9, 22)': 2, '22 deletion': 1, '22 - EDNOS': 1, 'FESS': 1, '22cirrhosis%22': 1, 'lesions.22': 1, 'der (22)t(11;22) syndrome': 1, 'Derivative 11;22 (emanuel) syndrome': 1, 'Derivative 11;22 (Emanuel) Syndrome': 1, 'der (22q) syndrome': 1, 'der (22) syndromes': 1, 'Conduct Disor der': 1, 'dnia 22 lipca': 1, 'seizures,22': 1, 't(5; 9; 22)': 1, 'OMO-22': 1, 't(6;9;22)': 1, 't(6;9;22': 1, 'ITEM:22.1': 1, 'KORA': 10, 'MM:22': 1, 'dcSSc 22': 1, 'mit der 18': 1, 'Pigmentary Der- Matosis': 1, 'Osteoblastic 22': 4, 'neuropathy21,22': 1, 'Ostrogengehalt der Hormonspirale': 1, 't(9; 11': 1, 'Mit der 11': 1, 'ST-22': 2, 'ICb 22': 1, 'REARRANGEMENT OF SULFONAMIDE DERIVATIVES': 4, 't(4:14': 1, 'EBS': 1, 't(9;11)-': 1, 'medicine.22': 1, 'Wesen der Osteopathie': 1, 'IVAII 22': 1, 't (11; 18': 1, 'Fuhren in der Dermatologie': 1, 'DDA': 1, 'Dislokation der Implantatelemente': 1, 'Bildgebung der Wirbelsaule': 1, 'Thesaurus der Medizin': 1, 'TdM': 1, 'MPN 22': 1, 'IS-22': 1, 'AMWF': 1, 'cardiomyocyte injury.22': 1, 'Bestimmung der Kolontransitzeit': 1, 'Vor der Darmentleerung': 1, 'DY-125-22-QY-18': 1, 'NT-22': 1, 'vom 22': 1, 'HUMAN INDUCED PLURIPOTENT STEM CELL-DERIVED': 1, 'H22': 1, 'IMC-22': 1, 'MDK': 1, '47,der(22)t(11;22; ES': 1, 'Bill 22': 1, 'MJF 22': 1, '-NWR-0260-22': 1, 'Der Mee-Marquet': 1, '22.2ADHD': 1, 'der Wahrnehmung': 1, 'Konvulsionstherapie der Schizophrenie': 1, 'RF-22': 1, 'N1 22': 1, 't(11;14) disease': 1, 'Der Turm': 1, 'Zentrum der': 1, 'spinosi der Lendenwirbelsaule': 1, 'PFDGS': 1, 't(1;22': 4, 'Anfang der Blumen': 1, 't(11;16;19)': 1, 'injury.22': 2, 't(10, 11)': 1, 'IMMUNOCHEMICAL STUDIES OF 22S PROTEIN': 1, 'Fragile X and Emanuel syndrome': 1, 'Sp-22': 1, '22;22': 1, ')t(11;22) syndrome': 1, 'maternally derived inflammatory syndrome': 1, 'disability pension 22': 1, 'WAGO-type 22': 1, 'Behandlung der': 1, 'pals-22': 1, 't (11;17)': 1, '22.q2 deletion syndrome': 1, 'CRIRS1-22': 1, 'fomulas:22': 1, 'X/22': 1, '/22': 2, 'AO/OTA 22': 1, 'Frage der Zeit': 1, 'EAP 22': 1, '-22-': 1, 'der Klink': 1, 'FIV/22': 1, 'DGKP': 1, 'obstructive CAD.22': 1, 'tooth 22': 5, 'Trisonomi 22': 1, '(22)t(11;22)': 1, 'der PA': 1, 'NGN2iSN': 1, 'zukunftskonzepte-der-fruehen-klinischen-pruefung-1.html': 1, 'PONE-D-22-08200R1Metabolic syndrome': 1, 'PONE-D-22-08200Metabolic syndrome': 1, 'der Wees': 1, 'BAG n. 22': 1, 'sarcopenic.22': 1, 'ALI.22': 1, 'der Aa': 1, 'Praxisnahe der Vorgaben': 1, 't[9;11': 2, '10q11.22 deletion': 1, 'MEAN 22': 1, 'AS-22': 1, 'RRMM 22': 1, 't(11; 19)': 2, 'CH_22': 1, 'der alexandrinischen': 1, 't (9; 11)': 2, 'bvFTD': 2, 'bvFTD-': 1, 'Supernumerary Derivative 22 syndrome': 1, '22 syndrome': 1, 'dystrophy.22': 1, 'artery stiffness.22': 1, 'Der f 4': 1, 't(6:11) carcinomas': 1, 't(4;11) and': 1, 'Parainfluenzaviren der Typen 1-3': 1, 'HPS': 1, 'MDD': 3, 'ischaemia.22': 1, 'MES-N': 1, 'PYR,22': 1, 'OSC.22': 1, 'DGSVO': 1, 'Emanuel syndromes': 1, 't(11;14) AL': 2, 'AGC 22': 1, 't(20;22': 1, 'SYMPTOM DERIVATIVES': 1, 'tumourigenesis.22': 1, 'WMH.22': 1, 'CEF-22': 1, 'SMO:22': 1, 't (6; 11': 2, 't(6:11)': 1, 'Ergebnisse der 1': 1, 'THCA:22': 1, '22-HDHA': 2, 'depigmentation.22': 1, 'cut7-22': 1, 'abnormalities of embryonic ectodermal derivatives': 1, 'Erhebung der Lebensqualitat': 1, 'EDC dysfunction': 1, 'contraction.22': 1, 'Vorteile der VB': 1, 'Mucocutaneous 22': 1, 'UC,22': 1, 'PVD,22': 1, 'Lubecker Skala der Basis-Mobilitat': 1, 'LSBM': 1, 'DDD': 1, 'MR:22': 1, 'Shoul-der': 2, 'cerebral ischaemia.22': 1, 'Vor der Op': 2, 'NRGs': 1, 't(4;14) abnormality': 2, 'Ph+ t(9;22)': 1, 'pals-22 deficiency': 1, '6q21-22 deletion syndrome': 1, 'BND-22': 1, 'Der p 1': 1, 'der AD': 1, 'Der Hofstadt': 1, 'T1:22': 1, '22-YEAR-OLD': 1, 't (9;22': 4, 'GT3.22': 1, 'sensitisation 22': 1, 'TISSUE-DERIVED MESENCHYMAL': 1, 'MRONJ:22': 1, 't(7;22)': 1, 'Der Zeitschrift Fur': 1, '22-HC': 1, 'PB-22': 1, 'ER-22': 1, 'diabetic21, 22': 1, 'der Hormone': 1, 'der Wulp': 1, 'Von der symptomatischen': 1, 'Dimensionen der': 1, 't(4;11)-positive': 1, 'ONFH 22': 1, 'UPN 22-04': 1, 't (11': 1, 'CVD21,22': 1, 'bodies.22': 1, 't(4,14': 1, 'CORRESPONDING ARTICLE ON PAGE 22': 1, 'Variablen der Subskala': 1, 'antidiarrhea,22': 1, 'mOS:22': 1, 'der(16': 1, 'bothToxicity:22': 1, 'GC#22': 1, 'pangastritis.22': 1, 'Der.f.': 1, 'TEAE.22': 1, 'P3.22': 1, 'der Worp': 2, 'laminitis.22': 1, 'Hustenreiz verneinte der': 1, 'Der Spiegel': 1, 'Nada 22': 1, 'Ligatur der Arterie': 1, 'CA 22': 1, 'syn 22': 1, 'Massnahmen der Atemhygiene': 1, 'superior medullary velum syndrome.22': 1, 'VGPR,22': 1, 'abnormalities of ectoderm-derived tissue': 1, 'Von der': 1, 'SZ-22': 2, 'Hand der Ursache': 1, 'von der Maase': 1, 'T2DM.22': 1, 't (12; 22)': 1, 'supernumerary-der(22)t(11;22) syndrome': 1, 'dyssynchrony.22': 1, 'ASIA-22': 1, 'PCaS 22': 1, 'xenophobia.22': 1, 'helper 22': 1, 't(11;21)': 1, 'IPV.22': 1, 'ectodermal derivates abnormalities': 1, 'Hyperlordose der Lendenwirbelsaule': 1, 'RRMM.22': 1, '22.q syndrome': 1, '22.q.11.ds': 1, 'endocervix 22': 1, 'MDRS-22': 2, 'r(22) or 22q deletion syndrome': 1, 'r(22': 2, 'PAD,22': 1, 'der(6)t': 1, 'Dauer der Behandlung': 1, 'Messung der Patientenzufriedenheit': 1, 'Stomachache 22': 1, 'MCI': 1, 'supernumeracy derivative 22 syndrome': 1, 'systole.22': 1, 'cytotoxic complex 22': 1, 'AdH': 1, 'DIANA': 1, 'DL': 1, 'hyperglycemiaE11.22': 1, 'hypoglycemiaE10.22': 1, 'Traumatic 22': 1, 'ZD': 1, 'Puls der Zeit': 1, 'ADIPOSE-DERIVED MESENCHYMAL': 1, 'agenesis of 22': 1, 'Faden in der Hand': 1, 'LU:-22': 1, 'Der amerikanische': 1, 'polysomy 22': 1, 'MESs': 1, 'sleep,22': 1, 'I50.22': 1, 'adipose-derived mesenchymal': 1, 'TARGETING OF IL-22': 1, 'VUS.22': 1, 't(2;5;11': 1, '22 deletions': 1, 'Von der Haeve syndrome': 1, 'AECSU2015-22': 1, 'ARMS:22': 1, 'Ursache der Krankheit': 1, 'Vorstand der II': 1, 'INTERRELATIONSHIPS 22': 1, 'self-harm;[22': 1, 'l. 22-': 1, 't(7;11)-': 1, 'Wurzel der pteris': 1, 'der Byl stilboidea': 1, 'c)-22': 1, 'supernumerary der (22)t(11;': 1, 'ES20-22': 1, 'Plattenosteosynthese der Rippen gestellt': 1, 'Bisattelited supernumary chromosomes': 1, 'uroperitoneum,22': 1, 'uroperitoneum.22': 1, 'with supernumary microtubules': 1, 'pt.22': 1, 't(7; 11)': 1, 'DSM-IV 22': 1, 'Low Emanuel syndrome': 1, 'erythrodermic 22': 1, 'GED.22': 1, 'Themen der Hypertonie': 1, 'Hilfe der 4': 1, 'SNOT- 22': 1, 'PVC:22': 1, 'Von der 5': 1, 'NMP- 22': 1, 'Der Aa': 1, 'KABS': 1, 'No 22': 1, 't(4;11) SEM': 2, 'teract with either coactivators or corepressors to cause gene activation or repression. In t(4;11': 1, 'KINDL': 1, 't (9, 22)': 1, 't(9;22) abnormalities': 1, 'GBMs.22': 1, 'Swelling in legs 22': 1, 'supernumerary der(8)': 1, '6N2_22': 1, 'NLD-22': 1, 'EMANUELE MARZETTI': 1, 'non-syndromic cleft2,9,22': 1, 'overgrowth syndromes 22': 1, 'der Sar': 1, 'monosomia 22': 1, 'ITL-22': 1, 'Arthropathie der Wirbelsaule': 1, 'DIC.22': 1, 'malformation.22': 1, 'nephrotoxicity.22': 1, 't(11; 22)': 1, 'PLA (22)': 1, 'OPTIONS 22': 1, 't[4:14': 1, 't(8:11': 1, 'emanuel syndrome': 1, 'loss of libido.22': 1, 'GEMATIK': 1, 'JBCRG-22': 1, ') t(9,22)': 1, 'CVDs.22': 1, 'HCS01/22': 1, 'Frage der Mentalitat': 1, '22 srutis': 1, 't (9,11)': 1, 'Varianz der Pradiktion': 1, 'PAR#22': 1, 'immune abnormality.22': 1, 'CM.22': 1, 'der Apraxie': 1, 'NEHI': 1, 'Neuroendokrine Zellhyperplasie der Kindheit': 1, 'IL-22 deficiency': 1, 'CMN-22': 1, 't (11; 14) myeloma': 1, '2020-22': 1, '-22,der': 1, 'Der vorliegende ist': 1, 'Ursache der pulmonalen': 1, 't (11; 22)': 1, '22-02768R4': 1, 'Cg-22': 1, 'N-THAILAND/ 22': 1, 'trisome 22': 1, 'hAdiPS': 1, 'Dauer der Granulozytopenie': 1, 'Geltungszeitraum der': 1, 'Adipose-derived mesenchymal': 1, 'PTS.22': 1, 'r(22) anomaly': 1, 't(6;11) translocation carcinomas': 1, 'Hauptursache der': 1, 'CMP9,22': 1, 'polypharmacy,22': 1, 'CT-FFR': 1, 'DERIVED VARIABLES': 2, 'embryonaler Fibroblasten der Maus': 1, 't(4;9;22': 1, 'CU - 22': 1, 'der Rezidive': 1, 't (11;14) abnormality.8': 1, 'VRPKS-I-22': 1, 'der Ham': 1, '22.8ab 22.3ab 22.1b 22.7ab 22.8ab 22.8ab': 1, 'Der retropharyngeale Raum': 1, 'der retropharyngeale Raum': 1, 'type 22': 1, 'MCH 22': 1, '22-04026R1': 1, 'FM 22': 1, 't(11;14) malignancies': 1, 'prostatecancer 22': 1, 'Familial translocation t(17;22': 1, 'ischaemic condition 22': 1, '22-02948Lipid abnormalities': 1, 'ED 22': 1, '22.1': 2, 'HEADCROP:22': 1, 'JM': 1, "sensitivity'.22": 1, 'steile Gipshange der Kattenburg': 1, 'Fettgehalt der Milch': 1, 'der faserigen': 1, 't(11;12)': 2, 'DD': 1, 'derivative dependency': 1, 'Krankenhauses der': 1, 'Familial t(1;11)': 1, 't(11;14) MTC': 1, 'Fragen der Extremitatentransplantation': 1, 'HFpEF,22': 1, 'HFpEF.22': 1, 'supernumerary der (22) syndrome': 1, 'Der Eecken': 1, 'EMANUEL': 2, 'OX.22': 1, 'L 22-': 1, 'MMSCs': 1, 'Medizinische Gutachtensituation in der Schweiz': 1, 'ocular 22 diseases': 1, 'KHSIRB-22-010': 1, 'der(10)t': 1, 'der(22) syndrome.18': 1, 'Der Weg des Virus': 1, 'RVO.22': 1, 'reaction.22': 1, 'Grad der Spondylarthrose': 1, 'IGWH-22': 1, 'Nachweis der Viruslast': 1, 'V.22': 1, 'CH 09-22': 1, 'Adenomenukleation der Prostata': 1, 'Lasionen der Schilddruse': 1, 'AIGS': 1, 'Nierenzellenkarzinomen.22': 1, 'MCI.22': 1, 't(11;19)+': 1, 'EM 22': 1, 't (11; 22) syndrome': 1, 'der(22) t(11; 22) syndrome': 1, 'problems.22': 1, 'SRM': 1, 'der ate': 1, 'adipose-derived mesenchymal stromal': 1, 't (9; 11': 1, 'DiGeorge and Emanuel Syndromes': 1, 'Ergebnis der am': 1, 'Emanuel or supernumerary der(22)t(11;22) syndrome': 1, 'DKU-22-003': 1, 'SYNU-22': 1, '22-0069': 1, 'precancer lesion.22': 1, 'neuroinflammation.22': 1, 'joint injury.22': 1, '22-03069R3': 1, 'epilepsy syndrome.22': 1, 'WTD#22': 1, '22-27369Multi': 1, 'ventricular arrhythmias21, 22': 1, 'Syndrom der inadaquaten ADH-Sekretion': 1, 'SIADH': 1, "MLA'22": 2, 'ELN-22': 1, 'zahl-der-syrien-fluechtlinge-': 1, 't(9, 22': 1, 'Tepary 22': 1, 'Von der Weid': 1, 'cancer21,22': 1, 'joblessness,22': 1, 'IDOL': 1, '22Haematobia%20irritans%22[porgn': 1, 'ADAM22 deficiency': 1, 't(6; 11)': 1, 'holoprosencephaly21, 22': 1, 'disabilities.22': 1, 't[4;14': 2, 'SDS': 1, 'Pionier der Sozialpadiatrie': 1, '22-01021R4': 1, 'SMCs derived from chromosome 5': 1, 'SMC5': 1, "SMC5's": 1, 'Oberrand der Rima': 1, 'RELATED FACTORS 22': 1, 'trisomic 22': 1, 'GERDA': 1, 'WAV-22': 1, 'Cutaneous 22': 1, 'DFNB 22': 1, 'Loss of 22': 1, 'Hemmung der Ovulation': 1, '14-22': 1, 'IGPP': 1, 'MED_22': 1, 'CZS_22': 1, 'LBP4.22': 1, 'LBP2.22': 1, 'inflammation21,22': 1, 'der(22)t': 1, 'der(22)t(8;22': 1, '19-U-15 der(18)t(18;21 or 22': 1, 'MRC 22': 1, 'der Dinge': 1, 'der Psyche': 1, 'Arteriovenose Malformation der Orbita': 1, 'CC22': 1, 'Derivative chromosome 15': 1, 'T1DM,22': 1, 'MRT der Prostata': 1, '14/22': 1, 'bvFTLD': 1, 'behaviorale Variante der FTLD': 1, 'PmE': 1, 'fractures.22': 1, 'der Merwe': 1, 'TRAP:22': 1, 't(4,14)': 1, '22-03635R3': 1, 'Lupusnephritis der Klasse': 1, 'GSC line 22': 1, 'Abbruch der Behandlung': 1, 'Gruppe der crassicostata': 1, 'Gruppe der septemplicata': 1, 'ptau,22': 1, 'der() syndrome': 1, 'SOME CONSIDERATIONS AFTER 22': 1, 'Nierenschutz aus der Kaffeetasse': 1, '14, 22': 1, 'TMG-22': 1, 'der(1)(t;16': 1, 'Nach Abschluss der': 1, 't (4; 11)': 2, 'NINCDS-ADRDA 22': 1, 'USES': 1, 't(11;19) abnormalities': 1, "WISA'22": 1, 'Mit der': 1, 'von der': 1, 'shoul-der dislocation': 1, 'Runter mit der Nachlast': 1, 'der Nachlast': 1, 't(1,22)': 1, 'A-22-09': 1, '14Monosomy 22, 16': 1, 'dysmenorrhoea3,22': 1, 'DIMCA:22': 1, 'INTERLEUKIN-22': 1, 'FMA -22': 1, 'P.22': 1, 'dyspnoea.22': 1, 'FEEL-KJ': 1, 'hyperalgesia21,22': 1, 'fibrocartilage.22': 1, ')t(9;22)': 1, 'CIN2 lesions{22': 1, '22Cachexia%22&rank': 1, '22Sarcopenia%;22': 1, '22Cachexia%22': 1, 'CancerCAN-22': 1, 'Der Chirurg': 1, 'Der Meulen': 1, 'voles.22': 1, 'ectodermal derivate abnormalities': 1, 'SI-joint 22': 1, '22.5Gastrinoma': 1, 'disability.22': 1, 'SCC 1-22': 1, 'der Carcinomzelle': 1, 'der (17) t': 1, 'natriuresis.22': 1, 'ARDS': 1, 'DERs': 1, 'Von der saisonalen': 1, 'hypervolaemia,22': 1, 'OCC-22': 1, 'Bestimmung der Viruslast': 1, 'Homoopathie innerhalb der Naturheilkunde': 1, 'sexual assault,22': 1, 'NAS.22': 1, 'der 14': 1, 'Zwischen der': 1, 'Ab der 22': 1, 'Ende der 11': 1, 'HIV': 1, 'Castalagin der': 1, 'OS.22': 1, 'GLP': 1, 'supernumerary derivative (22) chromosome abnormality': 1, 'PANCO-22': 1, 'Osteome der Nasennebenhohlen': 1, 'SDE': 1, 'Gesamtskala SDE': 1, 'Der-Avakian': 1, 'axonopathy.22': 1, 't(11;14) IGH::CCND1': 1, 'Verhalten der Paka': 1, 'Der Hemispasmus facialis': 1, 'der Kategorie 1': 1, 't(4,11': 1, 'GHs': 1, 'EMANUEL B.': 1, 't(9;22) and -': 1, 'gallblad-der': 1, 'Non-syndromic neurodevelopmental 22': 1, 'der Vecht': 1, 'UI:22': 1, 'ES syndrome': 1, 'Feind der Menschheit': 1, 'neurological disor-ders': 1, 'perkutane Plattenosteosynthese der': 1, 'LepIMR 22': 1, 't(22;22': 1, 'der(14;22': 1, 'FWF': 1, 'TMEC 22-016': 1, 'ME,22': 1, 'cortical defects,22': 1, 't(6,11) translocation': 1, 'AIN3 lesions.22': 1, 'GN 22': 1, 'Oligoarticular 22': 1, 'isthmocele derived syndrome': 1, 'STH2-22': 1, 'Supernumerary derivative (22) syndrome': 1, 'supernumerary derivative (22) syndrome': 1, 'breathlessness21,22': 1, 'der(22) t(11;22) syndrome': 1, 'ESWT': 1, 'UC 22': 1, 'SSDI.22': 1, 'der Ween and Willebrands': 1, 'nephropathy:22': 1, 'ADH21/22': 1, 'CCC': 1, 'motor difficulties.22': 1, 'Einfluss der Ringdruse': 1, 'epilepsy,22': 1, '/P-22': 1, 'crater 22': 1, 'Ta0.46C0.32N0.22': 1, '22nHA': 1, 'hiPS-CM': 1, 'AS': 1, 'Flussdiagramm der Literaturrecherche': 1, 'Congenital Supernumary Puncta': 1, 'supernumary puncta': 1, 'WDU': 1, 'Querschnittthemen der': 1, 'Frage der Identitat': 1, 'MEQ 22': 1, 'MMS22L': 1, 'ST 22': 1, 'CAYC 22': 1, 'Der Sanden': 1, 'MRT der': 1, 'Der Velden': 1, 'CRCs.22': 1, 'Su-NAM': 1, 'Mendelian disorders.22': 1, 'c KT-22': 1, 'Enttauschung der Familie': 1, 'NaTx-22': 1, 'WIP': 1, 'der Bij': 1, 'violence.22': 1, 'anger': 1, 'hemorrhages3.22': 1, 't(6;22) sarcoma': 1, '22-25F-I': 1, 'PKI': 1, 'AMI 22': 1, 'PRO-22': 1, 'myelomalacia.22': 1, 'NR der': 1, 'NR _ NR der': 1, 'NR _ NR NR der': 1, 't(6,11) RCCs': 1, 'BC:22': 1, 'type 22 PTPs': 1, 'Emanuel-, cat-eye- or i(18p)- syndrome': 1, 'Epilepsy,22': 1, 'LED*22': 1, 't(1;9;11)': 1, 'pandacostat 22': 1, 'nodal disease.22': 1, 'Tooth 22': 1, 'GC 22': 1, "ODF'22": 1, 't(6;11) translocation': 1, 't(11;22),-22': 1, 'hematotoxicity.22': 1, 'Der Vorst JR': 1} | 22 |
Disease | MESH:C535735 | {'congenital lobar emphysema': 499, 'Acquired lobar emphysema': 2, 'ALE': 3, 'Congenital lobar emphysema': 237, 'CLE': 151, 'Congenital Lobar Emphysema': 39, 'infantile lobar emphysema': 23, 'Infantile lobar emphysema': 5, 'congenital lobar overinflation': 31, 'Lobar emphysema': 46, 'lobar emphysema': 75, 'CLE congenital lobar emphysema': 1, 'Congenital Lobar Hyperinflation': 1, 'interstitial or congenital lobar emphysema': 1, 'pulmonary lobar emphysema': 4, 'CLH': 3, 'Congenital lobar hyperinflation': 3, 'Congenital lobar overinflation': 15, 'CLO': 13, 'Giant lobar emphysema': 12, 'left upper lobar emphysema': 2, 'inborn lobar emphysema': 2, 'CLE lesions': 2, 'Bilateral congenital lobar emphysema': 2, 'bilateral congenital lobar emphysema': 1, 'congenital lobar emphysemas': 6, 'Congenital Lobar Overinflation': 4, 'congenital lobar and segmental emphysema': 1, 'Lobar obstructive bullous emphysema': 1, 'congenital (infantile) lobar emphysema': 1, 'Obstructive lobar emphysema': 4, 'congenital lobar pulmonary emphysema': 9, 'CLE of the left upper lobe': 1, 'Lobar bullous emphysema': 1, 'congenital lobar emphysema of the': 1, 'Lobar Emphysema': 5, 'CLE of the': 1, 'APLE': 1, 'acquired lobar emphysema': 2, 'ILE': 4, 'congenital lobar hyperinflation': 9, 'RUL CLE': 1, 'upper lobe (RUL) CLE': 1, 'Congenital lobar emphysema of': 1, 'Congenital giant lobar emphysema': 1, 'Congenital lobar obstructive emphysema': 2, 'Congenital segmental lobar emphysema': 1, 'Idiopathic lobar emphysema': 1, 'bilateral congenital lobar overinflation': 1, 'Bilateral congenital lobar overinflation': 1, 'LER': 1, 'Hypertrophic lobar emphysema': 1, 'Hydrocephalus Respiratory Congenital lobar emphysema': 1, 'extensive lobar emphysema': 1, 'Congenital localized (lobar) emphysema': 1, 'pan lobar emphysema': 1, 'infantile (congenital) lobar emphysema': 3, 'congenial lobar emphysema': 1, 'Congenital lobar emphysema Inflammatory': 1, 'bilateral CLE': 1, 'Congenital lobar pulmonary emphysema': 2, 'congenital lobar emphysema of the lung': 1, 'congenital lobar emphysema of the left': 1, 'CLE 3': 1, 'ring congenital lobar emphysema': 1, 'congenital lobar obstruction': 1, 'Congenital lobar': 1, 'CONGENITAL LOBAR EMPHYSEMA': 3, 'Acquired lobar "emphysema': 1, 'Lobar emphysema of inferior': 1, 'Congenital Lobar emphysema': 1, 'Giant congenital lobar emphysema': 1, 'CLFO': 1, 'congenital lobar fluid overload': 1, 'Giant lobar emphysema of the lung': 1, 'Lobar or multilobar emphysema': 1, 'Pulmonary lobar emphysema': 1, 'Congenital lobar emphysema of left upper': 1, 'giant lobar emphysema': 2, 'congenital lobar emphysema CLE': 1, 'LE': 2, 'Congenital lobar emphysema of the lung': 1, 'lobar and unilateral emphysema': 1, 'Inborn lobar emphysema': 1, 'congenital lobar emphysema/obstruction': 1, 'bullous lobar emphysema': 1, 'Congenital lobar Overinflation': 1, 'CONGENITAL LOBAR PULMONARY EMPHYSEMA': 2, 'congenital segmental or lobar overinflation': 1, 'obstructive lobar emphysema': 1, 'ALPE': 1, 'LPE': 1, 'Congential lobar emphysema': 1, 'Congenital obstructive (lobar) emphysema': 1, 'Congenital obstructive lobar emphysema': 1, 'Congenital hypertrophic lobar emphysema': 1, 'Diffuse lobar emphysema': 1, 'congenital lobar hyperinfilation': 1, 'Congenital lobar emphysemaRespiratory distressOver': 1, 'infant lobar emphysema': 1, 'Lobar congenital emphysema': 1, 'CLOI': 1} | congenital lobar emphysema |
Disease | MESH:C535736 | {'encephalocraniocutaneous lipomatosis': 142, 'Encephalocraniocutaneous lipomatosis': 112, 'Fishman syndrome': 27, 'ECCL': 101, 'Encephalocraniocutaneous Lipomatosis': 26, "Fishman's syndrome": 4, 'OES-ECCL': 1, 'Oculoectodermal Syndrome-Encephalocraniocutaneous Lipomatosis': 1, 'ECCL syndrome': 4, 'Fishman phenotype 1': 1, 'Fishman phenotype 2': 1, 'Haberland or Fishman syndrome': 4, 'Fishman': 5, 'Fishman I': 1, 'Fishman phenotype II and III': 1, 'Fishman phenotype I': 2, 'Fishman or Haberland syndrome': 2, 'encephalocraniocutaneous lipomatous syndrome': 1, 'ECL': 2, 'Oculoectodermal Syndrome - Encephalocraniocutaneous Lipomatosis': 1, 'encephalocraniocutanous lipomatosis': 1, 'Fishman RP': 1, 'Encephalocraniocutaneous lipoma': 1, 'Fishman stage IV': 1, 'Fishman stage I': 1, 'Fishman class 2': 1, 'Fishman class 4': 1, 'Fishman class 3': 1, 'Fishman class 1': 1, 'encephalocraniocutaneous lipomatosis syndrome': 3, 'Encephalocraniocutaneous Lipomatosis Syndrome': 2, 'encephalocraniocutaneous': 1, 'Fishman phenotype III': 1, 'Fishman phenotype II': 1, 'Encephalocraniocutaneous lipomatosis syndrome': 1, 'HWMF': 1, 'fishman': 1, 'Fishman I/II/III': 1, 'Oculocerebrocutaneous and encephalocraniocutaneous lipomatosis syndromes': 1, 'ENCEPHALOCRANIOCUTANEOUS LIPOMATOSIS': 1, 'stage 1 FC': 1, 'FC': 1, 'Fishman stage II disease': 1, 'encephalocraniocutaneous lipoma tosis': 1, 'Haberlund Encephalocraniocutaneous Lipomatosis': 1, 'Fishman or Heberland syndrome': 1, 'Fishman stage 4': 1, "Fishman's": 1, 'ECCL;[MIM:613001': 1, 'ECCL tumors': 1, 'ECCL-': 1, 'encephalocraniocutaneous syndrome': 1, 'Delleman syndrome': 1} | encephalocraniocutaneous lipomatosis |
Disease | MESH:C535737 | {'ethylmalonic encephalopathy': 202, 'Ethylmalonic encephalopathy': 83, 'EE': 72, 'ethylmalonic encephalopathy disease': 2, 'ethylmalonic': 2, 'ethylmalonic encepathopathy': 1, 'Ethylmalonic Encephalopathy': 19, 'EMA': 2, 'EE disease': 1, 'ethylmalonic acidemia': 4, 'ethylmalonic syndrome': 1, 'ethylmalonic acid syndrome': 1, 'ETHE': 2, 'ethylmalonate encephalopathy': 1, 'EPEMA': 1, 'ethylmalonic encephalopathy syndrome': 1, 'ETHYLMALONIC ENCEPHALOPATHY PROTEIN1': 1, 'ethylmalonic encephalopathy encephalopathy': 1, 'Ethylmalonic aciduriaLeigh syndrome': 1, 'Ethylmalonic Acidemia': 1, 'ethylmalonic encephalopathy 1': 1, 'autosomal recessive ethylmalonic encephalopathy': 1, 'ethylmalonic encephalopathy-1': 1, 'Ethylmalonic Encephalopathy syndrome': 1, 'ethylmalonic acidaemia': 1, 'EMA encephalopathy': 1, 'ETHE1 deficiency': 2, 'Ethylmalonic encephalopathy 602473': 1, 'ethylmalonic academia': 1, 'wth ethylmalonic encephalopathy': 1, 'Ethylmalonic aciduria encephalopathy': 1, 'EE syndrome': 1} | ethylmalonic encephalopathy |
Disease | MESH:C535738 | {'erythrokeratodermia': 74, 'erythrokeratodermias': 14, 'Erythrokeratodermias': 3, 'erythrokeratodermia varibilis': 2, 'Erythrokeratodermia': 15, 'congenital erythrokeratodermia': 4, 'erythrokeratodermia cardiomyopathy syndrome': 1, 'erythrokeratodermia-cardiomyopathy (EKC) syndrome': 2, 'erythrokeratodermia-cardiomyopathy syndrome': 6, 'EKC syndrome': 2, "Barbeau's": 1, 'Congenital erythrokeratodermia': 2, 'erythrokeratodermia variablis': 1, 'Barbeau': 4, 'EKC': 2, 'Barbeau D': 2, 'Barbeau type D': 4, 'psoriasiform erythrokeratodermia': 1, 'Barbeau type D.': 2, 'Barbeau type A': 1, 'Barbeau type B.': 1, 'Barbeau type C': 1, 'Erythrokeratodermia extremitatum symmetrica': 1, 'erythrokeratodermias disorders': 1, 'ichthyosiform erythrokeratodermia': 1, 'Erythrokeratodermia progressivum symmetricum': 1, 'Barbeau Movement Disorder': 1, 'Erythrokeratodermia veriabilis': 1, 'Erythrokeratodermia anularis migrans': 1, 'erythrokeratodermia annularis migrans': 1, 'erythrokeratodermia with ataxia': 1, 'erythrokeratodermia-cardiomyopathy': 1, "Barbeau's type A/B": 1, 'spinocerebellar ataxia 34 with erythrokeratodermia': 1, 'EK': 1, 'Ataxia with erythrokeratodermia': 1} | erythrokeratodermia |
Disease | MESH:C535739 | {'Ia': 485, 'X-linked CDGS Type 1a': 1, 'Congenital disorder of glycosylation Type 1a': 2, 'IAs': 595, 'congenital disorder of glycosylation type Ia': 24, 'CDG-Ia.': 28, 'congenital disorders of glycosylation Ia.': 2, 'PMM2-CDG': 222, 'PMM2': 52, 'CDG-Ia': 116, 'Congenital disorders of glycosylation type Ia': 5, 'PMM2-': 103, 'Carbohydrate-deficient glycoprotein syndrome (CDGS) 1a': 1, 'Phosphomannomutase 2 deficiency': 19, 'Clavien Ia': 1, 'Ia?i': 1, 'PMM-deficient': 5, 'type IA': 1, 'type I are phosphomannomutase deficient': 1, 'CDG syndrome type IA': 1, 'phosphomannomutase-deficiency': 3, 'PMM-deficiency': 1, 'CDGS type Ia': 3, 'phosphomannomutase (PMM) deficiency': 11, 'Forrest Ia': 18, "dlia zdorov'ia": 1, 'Hinchey Ia/b': 1, 'congenital disorder of glycosylation Ia.': 1, 'Ia/': 6, 'Phosphomannomutase 2': 3, 'Phosphomannomutase 2 (PMM2) deficiency': 3, 'Phosphomannomutase 2 Deficiency': 6, 'CDG type Ia': 19, 'PMM2 deficiency': 31, 'Congenital disorder of glycosylation type 1a': 9, 'CDG-1a': 11, 'congenital disorder of glycosylation type 1a': 23, 'PMM2 deficiencies': 2, 'Jaeken syndrome': 17, 'congenital disorders of glycosylation type 1a': 7, 'Ia to': 9, 'phosphomannomutase 2 deficiency': 32, 'Dja-ia': 1, 'congenital disorder of glycosylation type 1A': 3, 'phosphomannomutase': 2, 'phosphomannomutase deficiency': 42, 'SN Ia.': 2, 'CDG Ia': 18, 'Congenital disorder of glycosylation type Ia': 16, 'Congenital disorder of Glycosylation type Ia': 2, 'CDG1A': 12, 'Congenital disorder of glycosylation type 1A': 2, 'CDG1a': 6, 'Congenital disorder of Glycosylation Ia': 1, 'Congenital disorders of Glycosylation type 1a': 1, 'CDGIa': 4, 'deficiency of the phosphomannomutase (PMM': 1, 'Congenital Disorder of Glycosylation, type Ia': 1, 'ISM variant Ia': 1, 'casiopeina III-ia': 1, ', Ia': 1, 'phosphomannomutase-2 deficiency': 8, 'iA': 6, 'Ia CDBDs': 1, 'congenital disorder of glycosylation-1a': 1, 'PMM2 gene deficiency': 1, 'Congenital disorder of glycosylation Ia': 6, 'IAs.14': 1, 'IAs.5': 1, 'CDGS Ia': 2, 'carbohydrate-deficient glycoprotein syndrome Ia': 1, 'pStage Ia': 4, 'PH-Ia': 1, 'deficiency of phosphomannomutase': 10, 'UIAs': 2, 'Phosphomannomutase-2 deficiency': 1, 'deficiency of the phosphomannomutase enzyme': 1, 'congenital disorder of glycosylation Ia': 11, 'GDS Ia': 2, 'Ia injuries': 1, 'PMM': 29, 'CDGS type 1a': 1, 'deficiency of phosphomannomutase or phosphomannose isomerase': 1, 'IaINs': 12, 'Lenke Ia': 1, 'LOE Ia': 4, 'Ia-Ii': 1, 'Congenital disorders of glycosylation type Ia and Ib': 1, 'DD-Ia': 1, 'Ia and': 8, 'phosphomannomutase 2-deficiencey': 1, 'PMM2-HIPKD': 1, 'PMM2-CGD': 2, 'PMM2-related disease': 1, 'PMM2-HIPKD-': 1, 'T1N0M0 Ia': 1, ', Ia, and': 1, 'congenital disorders of glycosylation type 1A': 1, 'PI-Ia': 1, 'Congenital Disorder of Glycosylation Ia.': 1, 'congenital disorder of glycosylation ia': 1, 'Congenital Disorder of Glycosylation Ia': 3, 'PMM2-CDG disease': 4, 'deficiency of the PMM2': 2, 'Ia ELs': 1, 'congenital disorder of glycosylation-phosphomannomutase-2 deficiency': 1, 'CR-Ia': 1, 'PMM2 -CDG type 1a': 1, 'Congenital disorder of glycosylation (CDG) type Ia': 3, 'PMM2 -CDG': 1, 'PMM2 -CDG type Ia.': 1, 'PMM2 -CDG) type Ia.': 1, "zdorov'ia": 3, 'Deficiency of the enzyme phosphomannomutase 2': 1, 'PMM2 enzyme insufficiency': 1, 'type Ia disorder': 1, 'deficiency in the cytosolic enzyme phosphomannomutase 2': 1, 'phosphomannomutase 2-congenital disorders of glycosylation': 1, 'Forrest Ia/b': 2, '-Ia': 6, "okhrana zdorov'ia": 1, 'congenital disorders of glycosylation type Ia.': 6, 'congenital disorders of glycosylation type Ia': 10, 'Castellvi Ia': 1, 'congenital disorder of glycosylation type-1a': 1, 'PMM2-CDG-Ia': 1, 'Ia.': 6, "Zven'ia": 1, 'ALIGN-Ia': 1, 'Ia "gutter"': 1, 'IKD Morp': 1, 'IDR': 1, 'IKD': 1, 'SN Ia': 7, 'congenital disorder of glycosylation type Ia.': 14, 'PMM2 deficient': 2, 'phosphomannomutase-2 (PMM2)': 1, 'CDG type Ia.': 6, 'Congenital Disorder of Glycosylation type Ia': 2, 'ia': 12, 'Congenital disorders of glycosylation type Ia Complex': 1, 'Ia-c': 8, 'OMIM#212065)-Ia': 1, 'Ia-': 6, 'GSDI subtype Ia': 1, 'PMM2-congenital disorders of glycosylation': 1, 'NBSS Ia': 1, 'Hinchey Ia': 12, 'Hinchey Ia.': 2, 'PMM2-CDG Syndrome': 1, 'pT1aN0M0, Ia': 1, 'Severin Ia': 2, 'Ia Poverty': 1, 'deficiency in phosphomannomutase': 1, 'inborn error in metabolism - congenital disorder of glycosylation type-1a': 1, 'Deficiencies in PMM2': 1, 'deficiencies in PMM2': 2, 'H2-IAs': 1, 'FMA-Ia': 1, '-ia': 1, 'carbohydrate-deficient glycoprotein syndrome type Ia': 6, 'carbohydrate-deficient glycoprotein syndrome type -Ia': 1, 'Carbohydrate-deficient glycoprotein syndrome type Ia': 4, 'deficiency of phosphomannomutase 2': 2, 'FIGO Ia': 6, 'Adeno Ia': 1, 'ROBINS-Ia': 1, 'S-iA': 1, 'Ia and III': 4, 'Phosphomannomutase Deficiency': 2, 'Ia or': 1, 'Ia -': 2, 'N-glycosylation and phosphomannomutase (PMM) deficiency': 1, 'PMM2- deficient': 1, 'THERAPY FOR PHOSPHOMANNOMUTASE 2': 1, 'PMM2- deficiency': 1, 'PMM2-deficient': 3, 'PMM2-DEFICIENT': 1, 'sporadic IAs': 3, 'autosomal recessive phosphomannomutase 2-congenital disorder of glycosylation': 1, 'congenital disorder of glycosylation, type Ia': 2, 'SI IS IaS': 1, 'paroxysmal tachyarrhythm-ias': 1, 'congenital disorders of glycosylation-Ia.': 3, 'congenital disorder of glycosylation types Ia and': 1, 'CDGS type Ia, type Ic': 1, 'CDG-type Ia': 1, 'CDG Ia.': 5, 'em)ia': 1, 'Ia supernovae': 8, 'congenital disorder of the glycosylation type Ia': 1, 'congenital disorder of the glycosylation type Ia.': 2, 'Congenital disorders of glycosylation type 1a': 1, 'carbohydrate-deficient glycoprotein syndrome type 1A.': 2, 'CDGS1A': 1, 'Carbohydrate-deficient glycoprotein syndrome type 1A': 2, 'Congenital disorders of glycosylation type-Ia': 1, 'ATXL': 1, 'intracranial (IAs)': 1, 'EL Ia': 2, 'EL Ia.': 1, 'carbohydrate-deficient glycoprotein syndrome type 1a': 3, 'Congenital disorder of glycosylation type Ia 1': 1, 'PMM deficiency': 9, 'PMM2_': 1, 'Deficiency of PMM2': 1, 'ILAE class Ia': 1, 'CDG-Ia Congenital disorders of glycosylation type Ia': 1, 'congenital disorder of glycosylation (CDG) type 1A': 2, 'CDG type 1A.': 1, 'CDG 1a': 2, 'Phosphomannomutase deficiency': 10, 'CDG1A.': 1, 'NANDA-Ia': 1, 'EL-Ia': 1, 'Ia - III': 1, 'Congenital disorder of glycosylation, type Ia': 3, 'congenital disorder of glycosylation syndrome type 1a': 1, 'CDG 1a syndrome': 1, 'AA-Ia-O-S': 1, 'AA-Ia': 1, 'Forrest Ia.': 3, 'Ia carcinoma': 1, 'pmm2 deficiency': 2, 'UIs': 1, 'SNe Ia': 10, 'Ia-CSM': 1, 'Ia SN': 4, 'Intracranial IAs': 1, 'Congenital Disorder of Glycosylation Type Ia': 3, 'Forrest-Ia bleeding': 1, 'PMM2-deficiency': 3, 'Congenital Disorder of Glycosylation 1a PMM2': 1, 'Congenital Disorder of Glycosylation (CDG) type Ia': 1, 'phosphomannomutase 2 dysfunction': 1, 'Deficiency of phosphomannomutase (PMM)-2': 1, 'CDG-Ia syndrome': 1, 'microinvasive carcinoma (Ia)': 1, ')-Ia': 2, "Shi'ia": 1, "Tret'ia sila": 1, 'serotype Ia': 1, 'Congenital Disorders of Glycosylation Type 1a': 1, 'Congenital disorders of glycosylation Type 1a': 1, 'ischem ia': 1, 'PMM2-CDG.A': 1, 'KAND': 1, 'KIF1A-associated neuronal disorder': 1, 'congenital glycosilation disorder 1a': 1, 'Ia and V': 1, 'congenital disorder of glycosylation type ia': 1, 'Ia/b': 2, 'Ia:18': 1, 'PMM2-3': 1, 'PMM2-2': 1, 'Congenital disorder of glycosylation type 1a early': 1, 'Ia,': 5, 'CGI-Ia': 1, 'carbohydrate-deficient glycoprotein syndrome type 1A': 2, 'Kategorie-Ia-Kontakte': 1, 'MIAs': 1, 'multiple IAs': 1, "Jaeken's syndrome": 2, 'carbohydrate-deficient glycoprotein syndrome Type 1a': 1, 'Carbohydrate-deficient glycoprotein syndrome Type 1a': 1, 'carbohydrate deficient glycoprotein syndrome type 1a': 1, 'PMM-2': 1, 'carbohydrate-deficient glycoprotein syndrome (CDGS)-Ia.': 1, 'BCME Ia': 1, 'congenital disorders of glycosylation 1a, 1c, and 1q': 1, 'phosphomannomutase 2 congenital disorder of glycosylation': 1, 'PMM2 type I CDGs': 1, 'congenital disorders of glycosylation (CDG) Ia': 1, 'CDG': 2, 'PMM2-Congenital Disorder of Glycosylation (CDG) 49': 1, 'Forrest class Ia': 1, 'Ia, III, and': 1, 'Deficiency in the phosphomannomutase 2': 1, 'Ia supernova': 2, 'dys-what-ia?': 1, 'Congenital disorders of glycosylation type I PMM2': 1, 'torsin-1A dysfunction': 1, 'Ia celiomesenteric': 1, 'ia-Thrombolysis': 1, 'Congenital disorder of glycosylation type 1a ACTB related dystonia': 1, 'deficiency of phosphomannomutase (PMM)8': 1, 'stadium Ia': 1, 'Ia +': 1, 'FIGO Ia/b': 1, 'Ia leak': 3, 'Phosphomannomutase deficiency.5': 1, 'Subzone Ia': 1, 'congenital disorder of glycosylation (CDG) type Ia': 2, 'CTCl Ia': 1, 'Renshaw and Ia IN': 1, 'serotype Ia and V': 1, 'ST-Ia': 1, 'ST-Ia.': 1, 'group 1a-c disorders': 1, 'Unruptured IAs': 1, 'unruptured IAs': 1, 'phosphomannomutase (PMM) deficiency (type A': 1, 'Ia, b': 1, 'CDG-PMM2': 1, 'carbohydrate-deficient glycoprotein syndrome type Ia.': 2, 'Ia, Ia/c': 1, 'phosphomannomutase-2 congenital disorder of glycosylation': 1, 'PMM2-deficient congenital disorder of glycosylation': 1, 'Ia/b.': 1, 'CDG Type Ia.': 1, 'CDG Type Ia': 1, 'IASLC Ia.': 1, 'Ia, III, and V': 1, 'TNM Ia-': 1, 'CDG1a syndrome': 1, 'congenital disorders of glycosylation, type 1a': 1, 'phosphomannomutase-2-congenital disorders of glycosylation': 1, 'PMM2-HI': 1, 'phosphomannomutase 2 hyperinsulinism': 1, 'Dysfunctions of coil 1a': 1, 'class Ia': 1, 'PMM2 type I CDG': 1, 'Ia SNe': 3, 'congenital disorder of glycosylation-Ia.': 1, 'Ia. MALYKIN': 1, 'dement ia': 1, 'PMM2-glycosylation': 1, 'GDS-Ia.': 1, 'Congenital disorder of glycosylation (type 1a)': 1, 'A.Ia': 1, 'A-Ia': 1, 'congenital disorder of glycosylation 1a': 1, 'Ia fracture': 1, 'Ia;': 1, 'Ia or less': 1, 'Ia-6T': 1, 'Ia-5T': 1, 'Ia-3T': 1, 'Ia-IT': 1, 'withPHP-Ia': 1, 'Ia-PN': 1, 'deficient phosphomannomutase': 1, 'Jaeken disease': 2, 'PMM2_CDG': 1, 'CDG syndrome type Ia': 2, 'PMM2-CDG deficiency': 2, 'UIA': 1, 'Ia fractures': 2, 'type Ia CDG': 1, 'IaS': 1, ', Ia;': 1, 'CM-Ia': 1, 'deficiency of phosphomannomutase in type I': 1, 'arrhyth-ias': 1, 'PHP-Ia': 2, 'Ia-VII and': 1, 'PMM2 congenital disorder of glycosylation': 3, 'PMM2 Deficiency': 1, 'Forrest Ia bleeding': 4, 'glenoid Ideberg Ia fracture': 1, 'deficiency of the enzyme phosphomannomutase': 1, 'Infans Ia': 1, 'Congenital Disorder of Glycosylation-Ia': 2, 'Phosphomannomutase 2 (': 2, 'Ia lamellarins': 1, 'Hinchey >Ia.': 1, 'Hinchey >Ia': 1, 'PMM2-congenital disorder of glycosylation': 1, 'congenital disorder of glycosylation (CDG) Ia': 1, 'PMM2 deficits': 1, 'Ia CO': 1, 'Subtypes Ia and': 1, 'subtypes Ia and': 1, 'Congenital Disorder of Glycosylation-Ia.': 1, 'congenital disorder of CDG-Ia.': 1, 'Congenital disorder of glycosylation-Ia': 2, 'Congenital Disorder of Glycosylation Type 1a': 2, 'Tc Ia': 1, 'autosomal recessive defect of phosphomannomutase 2': 1, 'Jaeken Syndrome': 2, 'III FIGO Ia': 1, 'CDG type 1a': 3, 'deficiency of PMM2': 2, 'congenital disorder of glycosylation, type 1a': 1, 'cT1bN0M0, Ia': 1, 'congenital disorder of glycosylation (CDG) Ia or Ib': 1, '/Ia': 1, 'phosphomannomutase deficient': 1, 'deficiency of PMM': 1, 'carbohydrate-deficient glycoprotein syndrome Type 1A': 1, 'Congenital disorders of glycosylation type Ia and IIa': 1, 'Phosphomannomutase 2 (PMM2) enzyme deficiency': 1, 'non-phosphomannomutase 2 N-linked congenital disorders of glycosylation': 1, 'SNe Ia.': 3, 'Ia AspATs': 1, 'PMM2 (phosphomannomutase 2) deficiency': 1, 'phosphomannomutase-2': 1, 'THE COLICIN Ia': 1, 'COLICIN Ia': 1, 'phosphomannomutase (': 1, 'PMM2) deficiency': 2, 'congenital disorder of glycosylation-Ia': 3, 'TNM Ia': 1, 'UA and Ia': 1, 'Ia:': 1, 'Ias': 1, 'JaCalIVE': 1, 'PMM2-CDG-II': 1, 'PMM2-CDG-I': 1, 'goitre Ia': 1, 'Carbohydrate-deficient glycoprotein syndrome type 1a': 1, 'phosphomannomutase 2-congenital disorder of glycosylation': 2, 'Sarcopen.ia': 1, 'clinical Ia': 1, 'Clinical Ia': 1, 'akines ia': 1, 'developmental disorder 1a': 1, 'deficiency of phosphomannomutase activity': 1, 'CDG-1A': 2, 'SCC Ia-III': 1, 'Deficiency of phosphomannomutase': 1, 'Ia CAPV': 1, 'PMM2 dysfunction': 1, 'Ia endoleakage': 1, 'TMD Ia and Ib': 1, 'TMD Ia': 1, 'Ia of this': 1, 'Congenital disorder of glycosylation 1a': 2, 'myo,ia': 1, 'Beat-Ia and': 1, 'Congenital Disorder of Glycosylation-1a': 1, 'CDG syndrome Ia.': 1, 'CDG syndrome Ia': 1, 'ICCC3 Ia': 1, 'CDGIA syndrome': 1, 'CDGIA': 1, 'Type Ia congenital disorder of glycosylation': 1, 'hypomorphic phosphomannomutase 2': 2, 'Ia-s': 1, 'Todani Ia': 1, "sfere okhrany zdorov'ia": 1, 'PMM2 Congenital Disorder of Glycosylation': 1, 'congenital disorders of glycosylation Type 1A': 1, 'Congenital Disorders of Glycosylation Type 1A': 1, 'deficiency of the metabolic enzyme phosphomannomutase 2': 1, 'phosphomannomutase 2': 1, 'movement Ia': 1, 'ODP-Ia': 1, 'congenital disorders of glycosylation-Ia': 2, 'Congenital disorders of glycosylation-Ia': 1, 'congenital disorders of glycosylation-Ia syndrome': 1, 'EP S-Ia': 1, 'S-Ia': 1, 'Forrest Ia bleed': 1, 'Ia SCM': 1, 'CDG Ia syndrome': 1, 'Congenital disorder of type Ia protein glycosylation': 1, 'defect in phosphomannomutase 2': 1, 't-IAs': 1, 'Norman-Jaeken ataxia or': 1, 'PMM2 deficit': 1, 'Ia-III': 1, 'cN+ Ia': 1, 'CG-Ia': 1, 'CG-Ia.': 1, 'phosphomannomutase II deficiency': 1, 'Congenital disorders of glycosylation Ia': 1, ', Ia/c': 1, 'Ia, III and VI': 1, 'Bjorck Ia': 1, 'Ia IMPs': 1, 'congenital disorders of glycosylation types Ia and Ib': 1, 'T1aN0M0/Ia': 1, 'CDG type I': 1, 'FCDGC': 1, 'PMM-': 1, '-IaINs': 1, 'phosphomannomutase-2-deficient congenital disorders of glycosylation': 1, 'phosphomannomutase 2 (': 2, 'PMM2-CDG Ia) deficiency': 1, 'CDG phosphomannomutase deficiency': 1, 'PMM2 CDG': 1, 'Banff Ia': 1, 'Stubline Ia': 1, 'Type 1a congenital disorder of glycosylation': 1, "Priamur'ia": 1, "Priokhot'ia": 1, 'PMM2-CDG.3': 1, 'Hyperinsulinemic phosphomannomutase 2 deficiency': 1, 'hyperinsulinemic phosphomannomutase 2 deficiency': 1, 'SN .Ia': 1, '.Ia': 1, 'congenital disorder of glycosylation (CDG)-Ia': 1, 'Phosphomannomutase (PMM) deficiency': 1, 'congenital disorder of glycosylation type-Ia': 1, '1A disorder': 1, 'UAs': 1, 'Ibanez Ia': 1, 'Congenital disorder of glycosylation (1a': 1, 'type Ia carbohydrate-deficient glycoprotein (CDG) syndrome': 1, 'Ia or III': 2, 'congenital disorders of glycosylation, type Ia': 1, 'CDG-Ia disorder': 1, 'congenital disorder of glycosylation Type 1a': 1, 'phosphomannomutase deficit': 1, '-IAs': 1, 'pT1N0M0 Ia': 1, 'Ia/c': 1, 'congenital disorders of glycosylation (CDG) type Ia': 2, 'Ideberg Ia andII glenoid fractures': 1, 'Ia EL': 1, '1a Congenital Disorder of Glycosylation': 1, 'Mwo-Ia-1': 1, 'Forrest Ia, b': 1, 'Forrest-Ia': 1, 'CDGS Ia.': 1, 'CDG-Ia (7)': 1, 'CaOx-Ia': 1, 'Ia 1': 1, 'Carbohydrate deficient glycoprotein syndrome type Ia.': 1, 'VTR Ia': 1, 'Congenital disorders of glycosylation type 1A': 1, 'ST Ia and III': 1, 'CLASS Ia RIBONUCLEOTIDE': 1, 'Ia FCDs': 1, 'nonGSD-Ia': 1, 'Ia, III and V': 1} | IAs |
Disease | MESH:C535740 | {'MPI': 268, 'Ib disease': 6, 'iB-NHLs': 1, 'SLSJ': 22, 'Ib': 331, 'T2aN0M0 Ib': 3, 'MPI-ESM-LR': 7, '-lac': 3, 'RDIC-lac': 1, 'Forrest Ia or Ib': 6, 'Forrest Ib': 22, 'MPI_AGE': 1, 'disorders of glycosylation type Ib': 1, 'Lac': 133, 'lac': 27, 'LACs': 67, 'Ia and Ib': 17, 'Ia or Ib': 12, 'MPI-': 17, 'MPI-CDG': 45, 'LaC': 6, 'Ib from Ia': 1, ', Ib, and': 1, 'IBs': 28, 'neurologica McCormick Ib': 1, 'Lac des sorciers': 1, 'Ib regurgitation': 1, 'Type 1b congenital disorders of glycosylation': 1, 'Lac-Megantic tragedy': 3, 'CDG-Ib': 45, 'SJF': 1, 'lACS': 1, '-Lac': 3, 'Hinchey Ia and Ib': 3, 'Hinchey Ib': 6, 'Saguenay-Lac St-Jean (SLSJ': 1, 'Lenke Ib': 1, 'LOE Ib': 1, 'Forrest Ib bleeding': 2, 'DD-Ib': 1, 'PI-Ib': 1, 'CIUSSS-SLSJ': 1, 'MPI deficiency': 7, 'ICCCa Ib': 1, 'CDG type 1b': 3, 'Ib or': 1, 'lacs': 3, 'Castellvi Ib': 2, 'IBEs': 16, 'LAc': 1, 'FIGO Ib to': 1, 'FIGO Ib to III': 1, 'MPI-L': 2, 'Lac-DH': 1, 'Ib lacunes': 2, 'Ib-Vb': 1, 'congenital disorder of glycosylation Ib': 2, 'Ib-IVM0 disease': 1, 'pStage Ib': 2, 'Congenital Disorder of Glycosylation Ib': 1, 'MG': 1, 'LD': 2, 'disease Ib': 1, 'MPI infection': 1, 'TMLE-Ib': 1, 'lAC': 2, 'Forrest-Ib': 1, 'FMA-Ib': 1, 'Forrest Ia and Ib': 7, 'MPI-n': 1, 'congenital disorder of glycosylation type Ib': 6, 'MPI defects': 1, "Darling's Ib": 1, '-MPI': 3, 'Adeno Ib': 1, '-Ia-Ib': 1, 'Forrest Ib lesions': 2, 'LP': 1, 'LM': 1, 'Herbert TYPE Ib SCAPHOID FRACTURE': 1, 'jeans': 1, 'MPI abnormality': 1, 'MPI-ESM - LR': 1, 'Ib, Is, and': 1, ', Is, and Ib': 1, 'tumorsPhase Ib': 1, 'ischemic MPI': 1, 'Lac-4': 1, 'Congenital Disorder of Glycosylation Type 1b': 1, 'CDG Ib': 8, 'Congenital disorder of glycosylation type 1b': 2, 'congenital disorder of glycosylation (CDG) type 1b': 1, 'congenital disorder of glycosylation type 1b': 3, 'CDG 1b': 1, 'congenital disorder of glycosylation 1b': 1, 'TSIV-Ib': 1, '-Ib': 3, 'MPI-deficient': 4, 'GEMM-Ib': 1, 'UICC Ia and Ib': 1, 'congenital defect of glycosylation type 1b': 2, 'MPI-NP': 1, 'ibs': 4, 'Forrest Ia-Ib': 1, 'Ib to': 1, 'Ib leak': 1, 'Ia from Ib': 1, 'Ib,': 1, 'Ia, Ib, and': 1, 'Corneoscleral lac': 1, 'SLSJ-COX deficiency': 1, 'Saguenay-Lac-Saint-Jean cytochrome-c oxidase (SLSJ-COX) deficiency': 1, 'Lac-Megantic Rail disaster': 1, 'Ia/Ib': 3, 'Forrest class Ia or Ib': 1, 'Ib MET': 1, 'MPI-S': 3, 'Jean-Luc': 2, 'LacS': 1, 'Lac-Megantic': 5, 'Ib injuries': 1, 'congenital disorders of glycosylation type Ib': 5, '1B) disorder': 1, 'jeans syndrome': 1, 'Jeans-Syndrom': 1, ', Ib/III': 1, 'Lac-a': 1, 'congenital disorder of glycosylation (CDG)-Ib': 1, 'Metastastic 1 Ib': 1, 'Ib-III': 2, 'Ia -Ib': 1, ', Ib,': 1, 'glycogenesis Ib': 1, 'LOCI': 1, ', Ib and': 2, 'GSDIa and Ib': 4, 'Ia, Ib, and V': 1, 'Ia, Ib': 4, 'Ib disorder': 2, 'PACs Ia/Ib or lower': 1, 'MPI abnormalities': 3, '-hag-ib-': 1, 'Ib and III': 2, 'MPI-ESM-P': 1, 'iBED': 1, 'WT Ib': 1, 'Forrest Ia, Ib': 4, 'PanIN Ib': 3, 'Ib/c': 2, 'Ia, Ib, III, and V': 1, 'Ib and VI': 1, 'MPI-deficiency': 1, 'FUNDED MPI_AGE PROJECT': 1, 'LV MPI': 1, 'TNM Ib': 2, 'FCDs Ib': 1, 'MPI-D disability': 1, 'MPI-D': 1, 'Gore IBEs': 1, 'Is and -Ib': 1, 'SLSJ-COX': 1, 'Ib to III': 1, 'CDG), type Ib': 1, 'Ib CMT': 1, 'gMPI': 1, 'pT2aN0M0 Ib': 1, 'ATHO-G': 1, 'MPI-H': 1, 'Lac Duparquet': 1, 'MPI enzyme deficiency': 1, 'Lac-au-Duc': 1, 'SLSJCOX': 1, 'Saguenay-Lac-Saint-Jean cytochrome c oxidase': 1, 'LGM-MPI': 1, 'Ib bouton number': 1, 'Jean': 1, 'congenital disorder of glycosylation (CDG) type Ib': 1, 'and Ib/c': 1, 'Van Praet class Ia and Ib': 1, 'CDG1b': 1, 'Ia/Ib -': 1, 'congenital glycosylation defect Type Ib': 1, 'CDG Type Ib': 1, 'Congenital glycosylation defect type Ib': 1, 'congenital glycosylation defect type Ib': 1, 'CDG type Ib': 5, 'SLSJCCOX': 1, 'Saguenay-Lac-Saint-Jean cytochrome-c oxidase': 1, 'JEANS': 1, 'CPI-Ib': 1, 'MPI-i': 1, 'MPI-perforation': 1, 'MPI-injury': 1, 'MPI-p': 1, 'Lac-Megantic derailment': 1, 'Lac-Megantic rail tragedy': 1, 'genotype Ib': 1, 'MPI-LMP': 1, 'GSDIa, Ib, III': 1, 'MPI-ESM-': 1, 'iB': 1, 'and Ib': 5, 'Lacs': 1, 'polybia-MPI': 1, 'Mannosephosphate isomerase (MPI) deficiency': 1, 'Congenital disorder of glycosylation (type 1b': 1, 'A-Ib': 1, 'ABraOM': 1, 'Saguenay-Lac-Saint-Jean cytochrome oxidase deficiency': 1, 'Saguenay-Lac-Saint-Jean (SLSJ) cytochrome oxidase (COX) deficiency': 1, 'PLSF': 1, 'TbMCA-Ib': 1, 'Ia, Ib, and III': 1, 'Ib-': 4, 'Uscher Ib': 1, 'FIGO Ib': 2, 'CA-Ib': 1, 'congenital disorder of glycosylation Type 1b': 1, 'Lac.2': 2, 'MPI-ESM': 2, 'Ib caverns': 1, 'Lejeuneaapiculata Sande Lac': 2, 'CDG1B': 2, 'Ia-Ib': 1, 'BDI-Ib': 1, '-Lac-': 2, 'Serotype Ib': 1, ', Ia, Ib': 1, 'MPI)-CDG': 1, '/Ib': 2, 'Ia-, Ib': 1, 'LG Ia and Ib': 1, 'IUCN Ia & Ib': 1, 'MPI-CGD': 1, 'carbohydrate-deficient glycoprotein syndrome (CDGS) type 1b': 1, 'Hinchey >Ib': 1, 'NTEKPC-Ib': 2, 'Sandblasting jeans': 1, 'Ib MN': 1, 'UICC Ib': 1, 'phosphomannose isomerase (MPI) deficiency': 1, 'CA92-1096 Ib III': 1, 'trichobothria ib': 1, 'JFD': 1, 'Ib, and': 2, 'Ib and': 1, 'Ia, Ib and III': 1, 'Ia:Ib': 1, 'pTNMa Ib': 1, 'Ia, Ib,': 2, 'goitre Ib': 1, 'Congenital disorder of glycosylation, type Ib': 1, 'PDDB-Ib': 1, 'Forrest Ia and Ib stigmata': 1, 'Ia or Ib stigmata': 1, 'Ia, Ib, III or': 1, 'carbohydrate-deficient glycoprotein syndrome type 1b': 1, 'CDGS1b': 1, 'Carbohydrate-deficient glycoprotein syndrome 1b': 1, 'Lac-Megantic rail disaster': 1, 'CDG Ib 2, 4': 1, 'congenital disorders of glycosylation (CDG) type Ib': 1, ', Ib': 3, 'NEC Ib': 1, 'SNC': 1, 'Forrest Ib bleed': 1, 'mannosephosphate isomerase deficiency': 2, 'Congenital disease of glycosylation type 1b': 1, 'congenital disease of glycosylation (CDG) type 1b': 1, 'Ib-A': 1, 'Meta Ib': 1, 'CNLC Ib': 1, 'Lac & cid': 1, 'myalgia Ia, Ib': 1, 'EOC Ib': 1, '& MPI': 1, 'LoE-Ib': 1, 'S-Ib': 1, 'Systolic and MPI dysfunctions': 1, 'Jean-2NM': 1, 'Lac-caninum': 1, 'type 1B congenital disorder of glycosylation': 1, 'Ib-1 from Ib-2': 1, 'CG-Ib': 1, 'Ia, Ib, and III CPSs': 1, 'ra-ib': 1, 'Ib IMPs': 1, 'CDG-type Ia and type Ib': 1, 'Struthanthus ibe-dzi': 1, 'Forrest class Ib': 1, 'Abernethy Ib;b': 1, 'CC Ib': 1, 'congenital disorder of glycosylation-1b': 1, 'MPI-ED': 1, 'Stubline Ib': 1, 'Ib lesions': 2, 'CDG-Ib Cystinosis 3': 1, 'Col Ib': 1, 'congenital disorder of glycosylation (CDG) Ib': 1, 'Congenital disorder of glycosylation Ib': 1, 'MPI-ESM 1-2': 1, 'St. Ib': 1, 'laC': 1, 'Lac des Aiguillettes': 1, 'GDS Ib': 1, 'CMR lac': 1, 'Ib bAVMs': 1, 'Type 1B disorder': 1, 'Plagiochilascabra Sande Lac': 1, 'Ib fractures': 2, 'pTNM Ib': 1, 'NCCN Ib': 1, 'Congenital disorder of glycosylation type Ib': 1, 'Ia + Ib': 1, 'Lac-': 1, 'pT2N0M0 Ib': 1, 'SPI[ibe': 1, 'Ib L-CT': 1, 'lac-': 1, 'Congenital Disorder of Glycosylation (CDG) type Ib': 1, 'Saguenay-Lac-Saint-': 1, 'Forrest-Ib bleeding': 1, 'Scapania ciliata Sande Lac': 1, "Shue'ib": 1, 'congenital disorder of glycosylation (CDG) Type Ib': 1, 'carbohydrate deficient glycoprotein syndrome type 1b': 1, 'Ib, III, and V': 1, 'Saguenay-Lac-Saint-Jean': 1, 'Jean-Decoster': 1, 'MPI-ESM1-2-LR': 1, 'Ib Abernethy deformation': 1, 'Saguenay-Lac Saint-Jean syndrome': 1, 'CDG syndrome type Ib': 1, 'deficiency of MPI': 1, 'MPI insufficiency': 1, 'CLASS Ib': 1, 'Hinchey-Ib': 1, 'Ib pseudohyoparathyroidism': 1, 'CSLSJ': 1, 'OMIM 232200) and Ib': 1, 'Ib FCDs': 1, 'hypomania 1b': 1, 'HTEA][LAc': 1, 'TJP': 1, 'XXINDEP Ib': 1, 'Ib SN': 1, 'Saguenay-Lac-Saint-Jean syndrome': 1, 'PHP-Ib': 1} | Ib |
Disease | MESH:C535741 | {'ice cube': 7, 'Ice': 327, 'ice': 2299, 'Ic': 427, 'ice cream': 103, 'NAOs': 4, 'sea-ice': 28, 'Ice-': 4, 'ice hockey injuries': 78, 'COS': 116, 'ice sheet': 52, 'ic': 67, 'Ib, Ic, II/R, III + Ic': 1, 'icing': 53, 'NDO': 1, 'ICs': 145, 'Ice-associated seals': 1, 'Dry ice': 157, 'ice hockey': 177, 'FIGO IA-Ic': 1, 'Class Ic drugs': 6, 'ice damage': 12, 'ice 15': 1, 'ice loss': 78, 'gastroesophageal var-ices': 1, 'Ice or fire': 1, 'sea ice': 151, 'OS': 86, 'SIC': 51, 'ice disaster': 7, 'Class Ic': 4, 'Class Ic antiarrhythmic drug': 1, 'ices VII and X': 1, 'ice VII': 42, 'Antarctic ice sheet': 1, 'AIS': 45, 'MISI': 10, 'ice floe': 3, 'Ia-Ic': 11, 'Hemodynam ics': 1, 'under-ice': 24, '-ice': 53, 'dry ice': 75, 'Ic disease': 15, 'Ice Recrystallization': 6, 'Ice recrystallization': 11, 'ice recrystallization': 17, 'ice scour': 25, 'OLIGOSACCHARIDES ON': 1, 'ice Ic': 23, 'ice I': 47, 'ice 0': 1, 'ice doline': 2, 'ice chunk crusher': 1, 'Ice hockey injuries': 17, 'I (Ia, Ib, Ic': 1, 'ice injury': 16, 'Ic and II': 1, 'XOS': 52, 'ice craving': 3, 'Ice-POP': 1, 'RFOs': 6, 'AOs': 4, 'UAmeXOS': 1, 'ice III': 34, 'alloster-ic': 1, 'impaired HbA(1c)': 1, 'ice-III': 4, 'ice-': 26, 'AOS': 70, 'GOS': 84, 'NTEKPC-Ic': 2, 'DLO': 3, 'ice contamination': 8, 'Icing': 31, 'sea-ice loss': 15, 'Anti/De-icing': 3, 'ec-Ic': 1, 'DIS': 7, 'INPs': 16, 'ice cubes': 3, '-On Ice': 1, 'ice-hockey': 3, 'ice-cream': 7, 'Ic-II': 2, 'sea ice disasters': 1, 'Sea Ice Disasters': 1, 'on-ice injury': 3, 'IN': 11, 'LIS': 20, 'AIS reduction': 1, 'GrIS': 3, 'PGOS': 1, 'VGOS': 1, 'Ice Hockey': 13, 'Ice hockey': 26, 'compulsive ice chewing': 1, 'ice injuries': 8, 'ice II': 29, 'IMA': 1, 'Ic CDBDs': 1, 'NAOS': 4, 'ice nucleation': 9, 'ice shelf': 3, 'Sea ice': 40, 'MOS': 70, 'ice breaker': 6, 'Ic-IV': 1, 'Ice VI': 3, 'Ib-Ic': 1, 'ice worm': 10, 'ice suppressant': 1, 'ice Ih': 2, 'ices': 4, 'ice algal': 9, 'ice accumulation': 4, 'ice III, V or VI': 1, 'ice IV': 11, 'Cordilleran Ice': 1, 'FIS': 2, 'Ic and II disease': 1, 'employment ice age': 1, 'EIA': 1, 'Dry Ice': 25, 'Ice cream': 9, 'dry-ice': 4, 'Congenital disorder of glycosylation type Ic': 3, 'CDG-Ic': 24, 'Ic CCs': 1, 'Ice damage': 1, 'sea ice anomaly': 1, 'RFO': 11, 'LOS': 4, 'ice burst': 1, 'ice VI': 35, 'ice V': 11, 'Lenke Ic': 1, 'class Ia or Ic': 1, 'IAP': 2, 'sea ice loss': 15, 'ice accretion': 2, 'INA': 12, 'Sea-ice': 4, 'DD-Ic': 1, 'ice-VII': 5, 'ice-scour': 2, 'Ice-skating injuries': 3, 'ices IV': 1, 'ices II-VI': 1, 'ice IX': 6, 'Ia, Ib, Ic, II': 2, 'ices II, III, and V': 1, 'Carbohydrate-deficient glycoprotein syndrome type V': 1, 'ICES': 26, 'Hypo-Ice': 1, 'ice hockey injury': 22, 'ICEDs': 1, 'congenital disorder of glycosylation, type Ic': 1, 'Ia, Ib, and Ic': 6, 'IMC': 1, 'IMO': 5, 'MOO': 2, 'LG-ICs': 1, 'Melting Ice': 1, 'FIGO Ic': 7, 'Ib and Ic': 3, 'SUIT': 1, 'Ice Cover': 7, 'AAD Class Ic': 1, 'FIGO Ia-Ic': 2, 'BI': 2, 'LI': 1, 'SIA': 5, 'ice reduction': 2, 'ice-sheet': 13, 'Ice-sheet': 1, 'mPWP AIS': 1, 'SOS': 2, 'Ice-breakers': 1, 'Ic and III': 2, "2')-Ic": 1, 'sensory block to ice': 1, 'Ics': 2, 'Ic (b': 1, "AAC(2')-Ic": 2, 'IStopo Ice': 1, 'ATVT-ic': 1, 'ice throw': 4, 'Ic-Ec': 1, 'Ic-e Other leukaemiab': 1, 'OB': 29, 'black ice': 9, 'Under-ice': 4, 'ice and': 2, 'marine ice cliff instability': 1, 'MICI': 8, 'ice cliff': 2, 'CA Ic': 1, 'Sea Ice Loss': 3, 'Blu-Ice': 1, 'ice addicts': 2, 'iced tea': 13, 'ice-ice disease': 9, 'OS abnormalities': 1, '-ICs': 7, 'var-ices': 2, 'ice-breaker': 2, 'Ice-hockey injuries': 1, 'icing injuries': 3, 'Ice III': 2, ', Ic': 1, 'Iced tea': 1, 'Ice Swimming': 5, '-ice avalanche': 1, 'iced-slush': 1, 'RMOS': 1, 'FOs': 3, ', Ic,': 2, 'Class Ia, Ib, and Ic': 1, 'of Ice': 1, 'of ice': 3, 'Cupping and Ice': 2, 'ice scouring': 3, 'ICs of': 1, 'ice avalanche': 1, 'Ic)': 1, 'Wenzel ice': 2, 'Cassie ice': 4, 'ice X': 10, 'MOS 2': 1, '-ics': 1, 'ice-recrystallization': 2, 'stage Ic': 11, 'Ice freeze': 1, 'ice freeze': 1, ', Ic, and': 1, 'Class Ia, Ib, or Ic': 1, 'stage Ia or Ib or Ic': 1, 'LIG AIS': 1, 'EIS': 2, 'Black Ice': 2, 'ice XVI': 2, 'IcE': 3, 'ICEs': 20, 'ice 1-S': 1, 'iCS': 3, 'Sea Ice': 6, 'falling-through-ice': 1, 'ice cleat': 3, 'SCOS': 1, 'ODH': 1, 'SIC anomalies': 2, 'Ic SCM': 1, 'AO': 3, 'AO-': 1, 'Marine Ice Cliff Instability': 3, 'Marine Ice Sheet Instability': 3, 'ice on cone': 1, 'DS': 1, 'IAFPE': 1, 'under-ice freshet': 1, 'Ia, Ib, Ic, and II': 4, 'OMO': 3, 'Kagome ice': 1, 'FOS': 3, '-OLIGOSACCHARIDES': 1, 'FAXO': 1, 'dry ice sensation': 1, 'stage-Ic': 1, 'ice-blue': 1, 'MOSs': 5, 'TEIS': 3, 'IRD': 6, 'LIL': 1, 'salty ice': 2, 'Ice skating injuries': 2, 'ice block': 3, 'GOSs': 5, 'sea ice decline': 3, 'S-iC': 2, 'IBMs': 1, 'Ice-VII': 1, 'OSA-COS': 1, 'TRIDENT': 2, 'ice fracture': 7, 'AADs Ic': 1, 'Ice vs.': 1, 'Cubic ice': 2, 'Ice Ic': 2, 'cubic ice': 3, 'Ia and Ic': 7, 'chocolate and ice-cream': 1, 'IRI': 6, 'ice jams': 11, 'Ice rink injuries': 1, 'SSIMS SIC': 1, 'Sea Ice Edge': 1, 'ice 19': 1, 'PUMC Ic': 1, 'LPIA': 2, 'Ic(a)': 1, 'Todani class Ia and Ic': 1, 'Laurentide Ice': 2, 'iC': 10, 'OLIGOSACCHARIDES': 15, 'ice X.': 2, 'Ia, Ib, and Ic and': 2, 'ice I(c)': 1, 'ice lesion': 1, 'Ice Sheet': 7, 'and Ic': 6, 'Ib or Ic': 1, 'Disorder 1C': 1, 'COSs': 4, 'ice-II': 2, 'ice I.': 7, 'Ice I': 4, 'ices III, II, and IX': 1, 'AOSs': 10, 'stage Ic-II': 2, 'Ice-Covered': 1, '2 AOs': 1, 'HIN': 5, 'SIA reduction': 1, 'SIA anomalies': 1, 'icing injury': 1, 'ALGOS': 1, 'OSCs': 1, 'ice-cream dessert': 1, 'ic-': 3, 'ice climbing': 3, 'Edible Ices': 1, 'IR': 7, 'ice jam': 12, 'ice disasters': 2, 'OLIGO': 2, 'HCIS': 1, 'ice-cliff instability': 1, 'Ice craving': 1, 'FICE': 1, 'Ice scour disturbance': 1, 'ice scour disturbance': 1, '-ice injury': 1, '/Ic': 2, 'H-ICs': 1, 'SIE': 15, 'troponina Ic': 1, 'ice melange': 8, 'ice mochi': 1, 'Dry Ice Loss': 1, 'oHA': 5, 'Klasse-Ia/Ic-Antiarrhythmika': 1, 'Ic, Ichthyosporea': 1, '-Ice': 2, 'Ice accretion': 4, 'road icing': 1, 'SICs': 1, 'AG': 2, 'Congenital disorder of glycosylation Ic': 3, 'ICD': 3, 'Gl-OS': 1, 'ice-Ic': 3, 'CDG Ic': 3, 'troponin Ic': 1, 'ice adhesion': 1, 'ice recrystallisation': 1, 'Ice for': 1, 'ice-1c': 1, 'ice dzud': 1, 'genotox-ic': 1, 'MOS-1': 1, 'ice V.': 2, 'MSIC': 1, 'ice rafted': 1, 'skin icing': 2, 'HAOS': 2, 'N-LINKED OLIGOSACCHARIDES': 1, 'UAOS': 1, 'UMOS': 1, 'SAOS': 1, 'sickness Ice': 1, 'Ice-rafted': 1, 'Ice Destroys Lives': 1, 'IWT': 1, 'SI ice': 1, 'Ice Climbing': 1, 'FIGO stage Ic': 1, 'leaf ice': 1, 'COD': 2, 'Ice algal': 1, 'Fibrous Ice': 1, 'Ice block': 1, 'dry ice poisoning': 1, 'ice seal': 2, 'ice seals': 3, 'Ice Seal': 1, 'IBPT': 2, 'RELATED OLIGOSACCHARIDES': 1, 'Ancient Ice Complex': 1, 'AIS SLE': 1, 'Marine Ice': 2, 'Ice Bucket': 3, 'ice sheet destabilization': 1, 'congenital disorder of glycosylation Ic': 1, 'Ic 3': 1, 'Glacier Ice': 1, 'RFaci[ice': 1, '-Ic': 8, ')gen(et)ic': 1, 'black-ice': 1, 'NLO': 1, 'BIS': 1, 'deficiency of glycoprotein V': 1, 'rime-ice': 1, 'fracture of sea ice': 1, 'SIS': 2, 'ice XIc': 1, 'ice chi': 1, 'Ic-CxPAs': 1, '(Ia, Ib, and Ic': 1, 'or Ic': 1, 'class Ic': 2, 'Under-Ice': 2, 'IFC': 2, 'Ic arrhythmic drugs': 1, 'ice VIII': 6, 'Ib/Ic': 3, '-Icing': 5, 'IS': 3, 'ices III and V': 1, 'Unwanted icing': 1, 'ice tea': 4, 'GOS-A': 1, 'Ice-cream man': 1, 'INP': 4, 'JAM_Ic': 1, 'ICRs': 1, 'Ic or': 2, 'Ice cube': 1, 'AlgOS': 1, 'ice crystal disorder': 1, 'ice disorder': 1, 'SIC anomaly': 2, 'SIE reduction': 1, 'ice blocker': 1, 'IBC': 2, 'IH-C': 1, 'IIb and Ic': 1, 'NEGIS': 1, 'ice IV ice VI': 1, 'ice-skating injuries': 5, 'sea-ice decline': 1, 'iced coffee': 2, 'ice environment': 1, 'ice-ice': 5, 'ice-ice infection': 1, 'Ice-ice disease': 1, 'Dry-ice': 2, 'ice 1': 1, 'ice diatoms': 1, 'ice ok': 1, 'C INA': 1, 'Ice scour': 5, 'SIR': 1, 'DI': 1, 'ice creams': 1, 'GO': 2, 'MO': 5, 'ice-scoop': 1, 'ice crusher': 1, 'chess on ice': 1, 'HOS': 1, 'CTOS': 1, 'CSOS': 1, 'ice-massaging': 1, 'V-GOS': 1, 'IIHF': 2, 'congenital disorder of glycosylation (CDG) type Ic': 2, 'ice Isd': 1, 'LCO': 1, 'Ice shelf fracture': 1, 'ice shelf fracture': 1, 'ice chewing': 2, 'Barents sea-ice anomaly': 1, 'ice floes': 1, 'IMOs': 2, 'Ic/II': 2, 'ICING': 2, 'ice tines': 1, 'Dry ice extrusion': 1, 'ice age bug': 1, 'MI': 2, 'Ia or Ic': 2, 'Ic-VIc': 1, 'ice III, V, VI, or VII': 1, 'Ices II-IX': 1, 'PGIS': 1, 'congenital disorder of glycosylation-Ic': 1, 'Ic to IIIa': 2, 'alphaGal syndrome': 1, 'alphaGal-syndrome': 1, 'AGS': 1, 'Hand icing': 1, 'hand icing': 1, 'NIBS': 1, 'IBS': 3, 'FIGO stage Ic-': 1, 'Intercollegiate ice hockey injuries': 1, 'ice slushy ingestion': 1, 'Ice swimming': 1, 'Ice Sheet Instability': 1, 'MOOs': 2, 'class Ia and Ic': 1, 'ice hockey concussion': 1, 'stage Ic-IV': 3, 'ice skating': 3, 'carbohydrate-deficient syndrome type V': 1, '- Ice -': 1, 'Ice Complex Deposit': 1, 'Ice Complex': 1, 'Class Ic AADs': 2, 'Ice-related injuries': 1, 'ice-related injuries': 1, 'marine ice cliff': 1, 'ice cream poisoning': 2, 'off ice': 1, 'leopardskin ice': 1, 'LCOs': 3, 'ice 9': 1, 'non-cytopath-ic': 1, 'CIS': 7, 'ice-X.': 2, 'Ice flashover': 1, 'ice flashover': 1, 'iced': 3, 'CEREMIDE OLIGOSACCHARIDES': 1, 'ices III': 1, 'Ices III and V': 1, 'sea-ice anomaly': 2, 'ice swimming': 1, 'LOs': 1, 'ice-VIII': 1, '-icing': 2, 'ice berg': 2, 'oil globule ice': 1, 'ice cold limbs': 1, 'PIS': 1, 'Lodwick Ic or higher': 1, 'PTLI': 1, 'CSO': 1, 'Vbn Vcn Vab Vbc Vca Ia Ib Ic': 1, 'ice mummy': 2, 'Ice loss': 4, 'ice-block': 2, 'Ice Cream': 3, 'Ice giant': 4, 'ice-VI': 2, 'Ia, Ic, or': 1, ', Ic, II': 1, 'ice-damage': 1, 'DAIS': 1, 'Ice IV': 3, 'stage Ia or Ic': 3, 'crystalline ice': 2, 'iced teas': 2, 'SIZ': 1, 'Vca Ia Ib Ic': 1, 'ice cider': 1, 'Sea-Ice': 2, 'sea-ice breakout': 1, 'congenital disorders of glycosylation type Ic': 1, 'ice-jam': 3, 'Ice cleats': 1, 'Ia, Ib and Ic': 1, 'congenital disorder of glycosylation (CDG)-Ic': 2, 'oligosaccharide abnormalities': 1, 'Oligosaccharide abnormalities': 1, 'Ice crevassing': 1, 'IH': 2, 'Swan & Ice': 1, 'FI': 1, 'Ices II, V, VI, and IX': 1, 'ices II and III': 1, 'Ices IV': 1, ', Ic, II,': 1, 'hepat- ic lesions': 1, 'EAIS': 2, 'ice in the eye': 1, 'and ice': 1, 'IC': 5, 'the ice': 1, 'Class Ia-Ic': 1, 'Hispan-ics': 1, '-OS': 2, 'pINA': 1, 'Ic:210': 1, 'Group Ic': 1, 'II/Ic': 1, 'Ice ice baby': 1, 'ice-associated seals': 2, 'Ib, Ic, II, and III': 1, 'ice fog': 3, 'FYSI': 1, 'Ice scouring': 3, 'ice I{c': 1, 'IRIs': 7, 'Iced coffee': 1, 'iC lesions': 4, 'Immune Def ic': 1, 'SIT': 3, 'SIT anomalies': 1, 'Ia-Ic lesions': 1, '0-Ic': 1, 'GalOS': 1, 'ILR': 1, 'Ic-Illc': 1, 'OLIGOSACCHARIDE DECOMPOSITION': 1, 'ice blue': 3, 'NEU5GC OLIGOSACCHARIDES IN': 1, 'ic-CLIEA': 1, 'Ice V': 1, 'ices III and VI': 1, 'ice obstruction': 1, ', Ib, Ic, II and': 1, 'Nottingham-Ice cream': 1, 'stages Ib and Ic': 1, 'ice-berg': 2, 'SIE anomaly': 1, 'GUCA1C': 1, 'falling-through-the-ice': 1, 'FTI': 2, 'ice nanotube': 1, 'OLIGOSACCHARIDE EPITOPES THAT': 1, 'GALACTO-OLIGOSACCHARIDES': 1, 'Ice jam': 1, 'ice-cliff': 1, 'ices II, V, and VI': 1, 'ice fault': 1, 'pStage Ic': 1, 'Ice seals': 1, 'on-ice': 2, 'Lake Ice Cover': 1, 'LIC': 1, 'B-GOS': 2, 'DIT': 1, 'FucOS': 1, ', Ic or II': 1, 'FIGO stage Ic': 1, 'ice damages': 2, 'Ic-': 3, 'dietary oligosaccharide intolerance': 1, 'congenital disorder of glycosylation type Ic': 3, 'HBCOSs': 1, 'IID': 1, 'Ice-Ice disease': 1, 'Ice-Ice syndrome': 1, 'choc ice': 1, 'Ice-II': 1, '-AOS': 1, 'LVIS': 1, 'Ice sheet': 1, 'Ice-jam': 1, 'Ia - Ic': 1, 'Ic,': 1, 'ice I-V': 1, 'ice VI ice I': 1, 'tox ic': 1, 'I subtype Ia-Ic': 1, 'I subtype Ic': 1, 'ice skating injuries': 2, 'and Ice': 2, 'Stage Ia or Ic': 1, 'POS': 1, 'anxiolyt-ic': 1, 'PROFILING OF N- AND O-LINKED OLIGOSACCHARIDES': 1, 'JJA SIC': 1, 'Ice Crawlers': 1, 'ice saddle': 1, 'Ice Saddle': 1, 'BT-ICs': 1, 'Ice VII': 2, "Siric'ic'ni": 1, "siric'ic'ni": 1, 'Congenital disorder of glycosylation-Ic': 1, 'myop-ic': 1, 'ic disease': 1, 'G-OS': 1, 'X-OS': 1, 'ice pop': 2, 'Ic, III,': 1, 'Chocolate Ice': 1, 'clean of ice': 1, ', Ic, and III': 1, 'ice A': 1, 'HEIN': 1, 'ICD-OC': 1, 'coastal Ice Complex Deposits': 1, 'c Ice Complex Deposits': 1, 'sugar icing': 1, 'OLIGOSACCHARIDE CONFORMATIONS': 1, 'Cheap Ice': 1, 'HAOs': 1, 'OLSC': 1, 'ice-skating': 1, 'OHS': 1, 'CDG type Ic': 3, 'Glacier ice worms': 1, 'AIS MB': 1, 'Cooling in ice': 1, 'Anti-Icing': 1, 'Ib versus Ic': 1, 'IA': 1, 'Ice adhesion': 1, 'Congenital disorder of glycosylation (CDG) type Ic': 1, 'Cubic Ice': 2, 'ice nanotubes': 1, 'Pyo Ib and Ic': 1, ', and Ic': 3, 'loss of ice sensation': 1, 'Ice fog': 1, 'OIR': 1, 'ice-nine': 2, 'ICs I-III': 1, 'CS': 1, 'ice use': 1, 'Endo-Ice': 1, 'Neurogen-ic injury': 1, 'iced-coffee': 1, 'glacier-ice viruses': 1, 'CDG type Ia, Ib, and Ic': 1, 'congenital disorders of glycosylation type Ia, Ib, and Ic': 1, 'Heat and Ice': 1, 'Fuji ice': 1, 'ROS': 1, 'fire and ice': 1, 'class Ia and Ic drugs': 1, "Rhea's ice": 1, 'PGOs': 1, 'ices VI and VII': 1, 'Flies on Ice': 1, 'SNe Ib/Ic': 1, 'II/Ib/Ic': 1, 'ices Ih, Ic, II, III, IV, V': 1, 'ANT(9)-Ic': 1, 'OI': 2, 'Ice Loss': 3, 'ice and fire': 1, '-COS': 1, 'ice-rafted': 3, 'CM-Ics': 1, 'ice-rafted detritus': 1, 'DLOs': 2, 'ISA': 1, 'DIN': 1, 'icing disasters': 1, 'Ice worms': 2, 'LA-GOS': 1, 'stage Ia and Ic': 1, 'IOD': 1, 'Eemian Ice': 1, 'ice devitrification': 1, 'Sea ice loss': 2, 'Sea Ice Cover': 1, 'GSIA': 1, 'Sea-Ice Anomaly': 1, 'blue-ice': 1, 'ice grapes': 1, 'HI': 1, 'Ic or III': 2, 'ice-ice"': 1, 'ice-ice" disease': 1, 'Ic (a)': 1, 'Glycosylation type Ic disorder': 1, 'ice i': 1, 'ICELI': 1, 'ice contractions': 1, 'IIML': 1, 'ancrod oligosaccharides': 1, 'ice falls': 1, 'LIP': 1, 'ice-intolerant': 1, 'icing sugar': 1, 'TCCV-Ic': 1, 'HMOS': 2, 'CDG Type Ia and Ic': 1, 'Embryon ic': 1, ', Ic, III': 1, 'Ice Cooling': 1, 'ice cooling': 1, 'Ice Bucket Challenge': 2, 'Ic, III, and IV crustins': 1, 'PD': 1, 'ice home': 1, 'Lake ice': 1, 'ID': 1, 'lake ice': 1, 'SIP': 1, 'Ic Ic Ic Ic Ic Ic Ib Ib Ib Ia Ia Ib': 1, '/Ic, II,': 1, 'ice MO': 1, 'SIE maxima': 1, 'XGOS': 1, 'AG-A': 1, 'ice-I': 1, 'COR Ic': 1, 'BGOS': 1, 'SGOS': 1, 'McMIS': 1, 'chilly-ice': 1, 'Ice dunking': 1, 'ice albedo': 1, 'ice dam disasters': 1, 'Ice Injury': 1, 'Raspberry Ice': 1, 'Tropical Ice': 1, 'iced-mango ACCESSED': 1, 'dystroph*ic': 1, 'Ice-breaker': 1, 'stage Ic or II': 1, 'class Ia, Ib and Ic drugs': 1, 'EC2 Ic': 1, 'ice burg': 2, 'loss of ice period': 1, 'seasonal loss of ice': 1, 'Loss of Ice': 1, 'Ice Hockey Injuries': 3, 'ice rink': 1, 'stage Ic-III': 1, 'OS-': 1, 'sea ice diatoms': 1, 'ice arrest': 1, 'ice XIX': 3, 'ice drug': 1, 'ORR': 1, 'ODRR': 1, 'OA': 1, 'Ice-related injury': 1, 'icing disaster': 1, '-ice injuries': 1, 'CHOS': 2, 'oHAs': 2, 'YIC': 1, 'TnIc': 2, 'melange ice': 1, 'Ice avalanche': 1, 'mDLO': 1, 'hc_ic': 1, 'AAD Ic': 1, 'OTHER OLIGOSACCHARIDES FOUND': 1, 'CO-Ic': 1, 'N-linked oligosaccharide transfer deficiency': 1, 'Ice accumulation': 1, 'amnes(t)ic disorders': 1, 'Ice-nine': 1, 'biolog- ics': 1, 'Ice floe': 1, 'UI': 2, 'PUI': 1, 'IOS': 1, 'craving ice': 1, 'SB': 1, 'FO': 1, 'ice-melt': 1, '-Ice I': 1, 'Ice scour injuries': 1, 'MOs': 1, 'ALICE': 1, 'Chitosan Ice': 1, 'oligosaccharide disorders': 1, 'class Ia/Ic antiarrhythmia drugs': 1, 'iC.': 1, 'IHP': 1, 'Ia, Ic, and IIb': 1, 'iC lesion': 1, 'ice fractures': 1, 'ice-cover': 1, 'ice wastage': 1, 'ULO': 1, 'MIP': 1, '-iC': 1, 'glacier ice worm': 1, 'ice lake': 1, 'stage Ia, Ib, Ic)': 1, 'IP 5': 1, 'ADAF': 1, 'ice-bucket': 1, 'GISP': 1, 'LIA': 1, 'ice giant': 19, 'SIC reduction': 1, 'ice-VII-like ice': 1, 'Edible ices': 2, 'OS type 1': 1, 'OSIs': 1, 'vitreous ice': 2, 'GPI': 1, 'Grease and pancakes ice': 1, 'Odden Ice': 1, 'Icv and Ic Cannulations': 1, 'IcS': 1, 'ics': 2, 'iCE': 2, 'ic disorders': 1, 'chronic anterior MI ic': 1, 'ice dancers': 1, 'Ice dancers': 1, 'O-HAs': 1, 'Iced': 1, 'ice out': 1, 'IRIs 4 and 5': 1, 'troponine Ic': 1, 'Ice Melt': 2, 'Ice Giant': 2, 'Ic, II': 1, 'stages Ic': 1, 'Ic to III': 1, 'WIP': 1, 'IP': 2, 'ice galloping': 1, 'KMOS': 1, 'GCOS': 1, 'GCOS-': 1, 'OST': 1, 'Ic IIa': 1, 'SBOS': 1, 'Ice hockey injury': 1, 'PAOS': 1, 'ice volcanism': 1, 'Lenke Ib, Ic, III': 1, 'turmer-ic': 1, 'CO': 1, 'ice I, VI': 1, 'hamstring icing': 1, 'CHIK-LR ic': 1, 'frazil ice': 1, 'Ice dunk': 1, 'stages Ic-IV': 1, 'I (Ia/Ic)/': 1, 'off-the-ice': 1, 'Todani Ic': 1, 'autosomal recessive congenital disorder of glycosylation (CDG) Type Ic': 1, 'MT-Ic': 1, 'IE': 1, 'IBF': 1, 'ice retreat': 1, 'ice-X': 1, 'ACIDIC OLIGOSACCHARIDES': 1, 'Accelerated Ice Loss': 1, 'ice sheet ice loss': 1, 'ice-rink injuries': 1, 'ice-lesion': 1, 'Ice contamination': 1, 'iced insulator': 1, 'Ice I Polytypism': 1, 'ice inhibitors': 1, 'ice ice': 1, 'oligosaccharide intolerant': 1, 'OSA': 1, 'sea ice fracture': 1, 'Eskimo icing': 1, 'Cassie Ice': 1, 'Ic C': 1, 'ice cover': 1, 'Anti-ice': 1, 'Baddne icing': 1, 'baddne icing': 1, 'SI': 1, 'Ice Damage': 1, 'LFOs': 1, 'Int-Ic': 1, 'Ice Shelf': 1, 'Oligosaccharide disorders': 1, 'Basal Ice': 1, 'arctic-sea-ice': 1, 'Congenital glycosylation disorder, type Ic': 1, 'Ice-skating and roller disco injuries': 1, 'ice Ih ice Ic': 1, 'ice Ih ice II': 1, 'ice Ih ice III': 1, 'AM OS': 1, 'PDX': 1, 'Congenital Disorder of Glycosylation-Ic': 1, 'Congenital Disorder of Glycosylation (CDG) type Ic': 1, 'CDG1C': 1, 'congenital disorder of N-linked glycosylation type 1C': 1, 'blue ice': 1, 'Dry ice kief': 1, 'dry ice kief': 1, 'MenC OS': 1, 'Ia, Ib, Ic': 1, 'MGO': 1, 'Bado Ia-Ic': 1, 'OLS': 1, '-Ic disease': 1, 'ice hockey defender': 1, 'Ice jams': 1, 'Stage Ic(b': 1, 'stage Ic(b': 1, 'ice.shp': 1, 'Ic - Carcinoma': 1, '-III INA': 1, 'Ice and': 1, 'loss of sensation to ice': 1, 'ice skate': 1, 'Ice floes': 1, 'HET': 1, 'HOM': 1, 'FCOs': 1, 'OE': 1, 'ice worms': 1, 'Ice Worm': 1, 'Ice Deformation': 1, 'Ice Doline': 1, 'ice II Ic': 1, 'ice IV ice Ic': 1, 'II Ic': 1, 'ice II ice Ic': 1, 'MYI': 1, 'FYI': 1, 'Ic/Ia': 1} | ice |
Disease | MESH:C535742 | {'ORCID iD': 4581, 'ORCID iDs': 3227, 'IDs': 886, 'iDs': 3, 'NUCs': 44, 'Id.': 319, 'ORCID iDs': 1, 'herniated IDs': 1, 'brain ID': 3, 'PMIDs': 14, 'ID disorders': 6, 'id.': 7, 'Litter IDs': 1, 'CDG-Id': 2, 'CDGS-IV': 1, 'NUC': 39, 'IDEs': 30, 'DECIPHER IDs': 1, 'ID Dysfunction': 1, 'ORCID iD.': 11, 'ventricular and atrial IDs': 1, 'iD': 18, '-Id.': 2, 'CSIDs': 1, 'DDD ID': 1, 'Id HLH': 1, 'Id': 29, 'HDSS IDs': 1, 'IDs 1 - 23': 1, 'ORCID IDs': 12, 'AP IDs': 1, 'Deficiency of IDs': 1, 'Congenital glycosylation type 1d': 1, 'Session-IDs': 1, 'ID Disorder': 1, 'ID Dysfunctional': 1, 'TCMID': 1, 'DD-Id': 1, 'NAs': 11, 'CDGS': 10, 'CDGS type V': 2, 'Chrysis (Trichrysis) pellucida': 1, 'Chrysis (Trichrysis) imperiosa': 1, 'Chrysis (Chrysura) crassiceps': 1, 'Chrysura hirsuta': 1, 'Trichrysis trigona': 1, 'Trichrysis) lusca': 1, 'NSA-IDs': 1, 'CL IDs': 1, 'id': 6, 'endometrio id carcinoma': 1, 'NA resistance': 1, 'fake IDs': 2, 'Fake IDs': 2, 'CDGS type IV': 2, 'carbohydrate-deficient glycoprotein syndrome (CDGS) type IV': 1, 'Id protein deficiency': 1, 'disorders of ID': 1, 'IDEDs': 1, 'Suicidal Id.': 1, 'Suicidal id.': 1, 'AMid': 1, 'CUI': 1, 'SMO-iD': 1, 'IDs 1-3': 1, 'LiTDI': 1, 'Jamu medicine': 1, 'Jamu': 1, 'congenital disorders of glycosylation type 1d': 1, 'Holdemania.id.2157': 1, 'Allisonella.id.2174': 2, 'IdS': 6, 'LUT IDs': 1, 'IDs 1, 2 and 3': 1, 'Id-An': 1, 'Id.c': 1, 'UID': 1, 'Amur ide': 1, 'Ids': 7, 'IDs of': 1, 'HCD-4.2': 1, 'GGE-IDs': 1, 'Parathyro id Carcinom a': 1, 'congenital muscular dystrophy type ID': 1, 'hypercholesterolaemic ac-ids': 1, 'NI': 3, 'OMIM IDs': 3, 'NIs': 1, 'Id-deficient': 3, 'Carbohydrate deficient glycoprotein syndrome type IV': 1, 'PMID': 2, 'Nucs': 1, 'ASD-ID': 8, 'atrial IDs': 1, 'TID': 1, 'Congenital ID': 1, 'ORICID iDs': 1, 'Id cKO': 1, 'Id-deficiency': 1, 'Id deficient': 1, 'LRR-IDs': 1, 'ID-related disorders': 1, 'PID': 1, 'autosomal recessive IDs': 1, 'X-linked IDs': 3, 'Shi-id': 1, 'ID intellectual disorder': 3, 'Pcom-IDs': 1, 'IDs 18, 20, and 21': 1, 'MP IDs': 1, 'Id_IDP': 1, 'OMIM IDs 608177': 1, 'NRTIs': 1, 'TCs': 1, 'Brain ID': 2, 'OMIM Id': 2, 'AIDs': 1, '-noddi.id': 1, 'ASD - ID': 1, 'CDGS Type 1a': 1, 'IDs 4, 5': 1, 'ORCIDs iDs': 1, 'bangda.go.id': 1, 'IDs associated': 1, 'NTD IDs': 1, 'ASD&ID': 1, 'ASD ID': 6, 'Star-IDs': 1, 'CARBOHYDRATE ANTIGEN 72-4': 1, 'IDs 3a, 3b, 11a': 1, '-IDs': 3, 'BPS': 1, 'carbohydrate deficient glycoprotein syndrome type IV': 1, 'ASD with ID': 1, 'Orcid iD': 2, 'Id-l': 1, 'HHID': 1, 'abnormal shoot 2-1D': 1, 'abs2-1D': 1, 'abs2-1D.': 1, 'A. abs2-1D': 1, 'ID-related impairment': 1, 'Nuc': 1, 'IDs 1, 2, 3)': 1, 'ORCID-IDs': 1, 'Organoid IDs': 1, 'ORICD iDs': 1, 'iD-DVT': 1, 'PSIDs': 1, 'ID ASD': 1, 'Id-': 1, 'iDS': 2, 'ids': 1, 'LAML': 1, 'AML': 1, '301SPD-Id': 1, 'Ids-': 1, 'iD.': 1, 'haemorrho-ids': 1, 'ORCID iDS': 1, 'muscle IDs': 1, 'CA72-4': 1, 'Anthrenus (Nathrenus) signatus': 1, 'spinal IDs': 1, 'Tc Id': 1, 'ulnar stylo id fracture': 1, 'developmental disorder;ID': 1, 'Metabric IDs': 1, 'ID Functions Disease': 1, 'Deficit ID': 1, 'NAr': 1, 'neurodevelopmental IDs': 1, '-Id by': 1, 'Anti-IDs': 1, 'IDs 1,2,3': 1, 'IDs 1 and 3': 1, 'GISAID IDs': 1, 'CDGS type Ia': 1, 'ID disorder': 1, 'Ia, Ib, Id,': 1, 'ID dysfunction': 1, 'NPI': 1, "'Id'": 1, 'and Id': 1, 'CDGS III glycoprotein abnormality': 1, 'MSIS_IDs': 1, 'CVE-IDs': 1, 'CDG-1d': 1, 'CDG type 1A and 1D Hypotonia': 1, 'prID': 1, 'SID': 1, 'iD DH': 1, 'septelia.inawati@ui.ac.id': 1, 'sUPD-IDs': 1, 'oUPD-IDs': 1, 'AOJ': 1, 'Xl-PSIDs': 1, 'CDG-Id.': 1, 'stolen IDs': 1, 'Id Est': 1, 'Degenerate Primer IDs': 1, 'ide': 1, 'syndromic ID disorders': 1, 'CDGS types Ia and Ib': 1, 'CDGS type II': 1, 'ORCHID iD': 1, 'OMIM id: 242650': 1, 'CDGS type 1A': 1, 'taxdetails&id': 1, 'types I and IV carbohydrate-deficient glycoprotein syndrome': 1, 'opio ides': 1, 'ADI-iD': 1, 'IDs from': 1, 'ID Disorders': 1, 'Ide deficiency': 1, 'IDs 1 and 4': 1, 'ID Immune dysfunction': 1, 'nucleos(t)ide analgue': 1, 'ACD': 1, 'ASD ID E/S Mac': 1, 'Ide(-/-)': 1, 'RF-Id': 1, 'RF-Id.': 1, 'Polygon IDs': 1, 'Camel-IDs': 1, 'treatable IDs': 1, 'Treatable IDs': 1, 'IdeS': 1, 'class Id RNR': 1, 'NRTI': 2, 'ID impairment': 1, 'maternal IDs': 1, 'TCids': 1, 'SIDs': 1, '-Id': 1, 'neuron IDs': 1, 'OMIM ID: 134790': 1, 'OMIM ID': 1, 'Class Id resinite': 1, 'Ids-deficient': 1, 'IDs 1 and 2': 1, 'ideD': 1, 'HID': 1, 'IdS.': 1, 'CaOx-Id': 1, 'IDs 5 and 8': 1, 'aZINC IDs': 1, 'ID': 1, 'NUC hepatitis': 1, 'OMIM id: 242650)': 1, 'Id genetic loss': 1, 'Id loss': 1, 'AgIDs': 1, 'IDs 19': 1, 'Litter id': 1, 'ORCiD iD.': 1, 'LCCICCG-CBM 4': 1, 'IDs in': 1, 'CDG (type 1d)': 1, 'Neuronal IDs': 1, 'ID) disorders': 1, 'autosomal recessive disease carbohydrate-deficient glycoprotein syndrome type II': 1, 'BR&id': 1, 'ceram ides': 1, 'CIDR': 1} | ORCID iD |
Disease | MESH:C535746 | {'IHs': 357, 'Ih': 104, 'IHEs': 58, 'ices Ih, III, and V.': 1, 'ice Ih': 38, 'iHS': 60, 'Ice Ih': 1, 'Ih remodeling': 1, 'IHs-3': 1, 'ices Ih and': 1, 'Ih- channel': 1, 'Ihe disease': 1, 'Ih block': 2, '-Ih': 2, 'Ih, IA': 1, 'of Ih': 1, 'Ih dysfunction': 3, 'Ih-channel dysfunction': 1, 'ice Ih and XI': 1, 'CDG Ih': 2, '5a-n.': 1, '5a-n': 1, 'Scalp-IHs': 1, 'scalp-IHs': 1, '(ih)CC': 1, 'iHE': 1, 'Ih and': 1, 'HHQ': 3, 'Ih conductance': 1, 'Ih Conductance': 1, 'iH': 3, 'Impairments in neocortical Ih': 1, 'Ih channel dysfunction': 1, 'Ia-Ih': 1, 'DERIVATIVES OF 2,4(1H,3H)-QUINAZOLINEDIONE': 1, 'LP Ih': 1, 'Ih and VII': 1, 'Ih sags': 1, 'Ihe': 1, 'ice Ih or III': 1, 'MECHANISM OF DAD REGULATION OF LP Ih': 1, 'ice-Ih': 1, 'Th2@Ih(7)-C80': 1, 'iHES': 3, 'impairment of Ih': 1, 'ulcerated IHs': 1, 'Ang-iH': 1, 'Tonic Ih': 1, 'CDG-Ih': 2, 'CDG Type 1H': 1, 'MPS type 1H': 1, 'MDHI': 1, 'ATC': 1, 'mucopolysaccharoidosis type 1H': 1, 'Ihs': 1} | IHs |
Disease | MESH:C535747 | {'type-II congenital disorder of glycosylation': 2, 'CDG type II diseases': 4, 'congenital disorder of glycosylation (CDG) type II': 4, 'type II congenital disorder of glycosylation': 19, 'type II CDG': 23, 'CDG type II': 39, 'mixed type I and II type CDG': 1, 'type II BP disorder': 1, 'Type II disorders': 2, 'CDG-II': 32, 'type II disorder': 12, 'Ovulation disorders type II': 1, 'congenital disorder of glycosylation type II': 14, 'CDG type I and type II': 3, 'congenital type II cell dysfunction': 1, 'CDG type I and/or type II': 1, 'CDG type I and II': 1, 'congenital disorders of glycosylation (CDG)-II': 1, 'type II disorders': 6, 'Congenital Glycosylation Disorder type II': 1, 'Congenital disorder of glycosylation type II': 2, 'congenital glycosylation type II disorder': 1, 'CDG Type II': 3, 'II CDG': 4, 'CDG-II defects': 2, 'Carpentier type II leaflet dysfunction': 1, 'CDG (type II)': 1, 'X-linked congenital disorder of glycosylation type II': 1, 'type II congenital disorders of glycosylation': 9, 'N-linked CDG disorders (Type I and II': 1, 'Type-II Congenital Disorders of Glycosylation and Hemostasis': 1, 'CDG II': 4, 'type-II Congenital Disorders of Glycosylation': 1, 'CDG type-II': 4, 'Congenital Disorders of Glycosylation type II': 3, 'congenital disorder of glycosylation type-II': 1, 'congenital disorder of glycosylation of types I and II': 3, 'CDG-type II': 1, 'type II CDG defect': 2, 'type II (CDG': 1, 'congenital disorders of glycosylation type II': 6, 'CDG types I and II': 1, 'congenital disorders of glycosylation (CDG) type II': 7, 'type-II CDG': 1, 'type II-CDG': 1, 'type II dysfunction': 6, 'CDG-II syndrome': 1, 'Congenital Disorder of Glycosylation-II': 1, 'Congenital disorder of glycosylation (CDG) type II': 1, 'type II ovulatory disorder': 1, 'type II ovulatory disorders': 2, 'Congenital Disorder of Glycosylation type II': 1, 'congenital disorder of glycosylation (CDG) of types I and II': 1, 'CDG-II deficiency': 1, 'CDG-type II defects': 1, 'CDG type II syndrome': 1, 'congenital disorder of glycosylation II': 3, 'CDG-I and II defects': 1, 'CDG-type II syndrome': 1, 'type II glycosylation disease': 1, 'Type II Congenital Disorders of Glycosylation': 1, 'I and type II CDG': 1, 'type I and type II CDG': 3, 'CDG-II Diseases': 1, 'ATII dysfunction': 2, 'CDG type I or II': 1, 'type I and type II glycosylation defects': 1, 'mixed type I and type II glycosylation defects': 1, 'type I or type II CDGs': 1, 'type I and II CDGs': 2, 'CDG-type II disorders': 1, 'congenital disorders of type II glycosylation': 1, 'CDG-IId': 1, 'congenital disorder of glycosylation type II-d': 1, 'congenital disorder of glycosylation of type II': 1, 'Congenital disorders of glycosylation type II': 2, 'CDG type II defects': 2, 'Type-I and Type-II CDGs': 1, 'Type-II CDGs': 1, 'type-II Congenital Disorder of Glycosylation': 1, 'type II congenital glycosylation disorders': 1, 'congenital disorders of glycosylation-type II': 1, 'type II pneumocyte dysfunction': 3, 'CDG-II diseases': 2, 'CDG-II type diseases': 1, 'Congenital Disorder of Glycosylation (CDG) Type II': 1, 'CDG Type II disease': 1, 'Type II CDG': 2, 'alveolar type II dysfunction': 1, 'CDG I and II': 1, 'CDG-I and II defect': 1, 'Type II CDGs': 2, 'Type II Dysfunction': 1, 'Carpentier Type II dysfunction': 1, 'glycosylation type II': 1, 'type-II disorder': 1, 'congenital disorder of glycosylation, of types I and II': 1, 'type II SO dysfunction': 1, 'congenital disorders of glycosylation type I and type II': 1, 'type I and II CDG': 1, 'type II N-glycosylation': 1, 'O-linked and type II N-linked glycosylation defects': 1, 'type II N-linked and O-linked glycosylation defects': 1, 'O-linked and type II N-linked glycosylation defect': 1, 'CDG I/II': 2, 'type-II CDGs': 1, 'Type II CDG defects': 1, 'CDG group II': 1, 'congenital disorders of glycosylation CDGs-II': 1, 'CDGs-II': 2, 'dysfunction (type II)': 1, 'CDG type II 1': 1, 'congenital disorders of glycosylation (CD G) type II': 1, 'CDG type II disorders': 1, 'congenital disorder of glycosylation, type II': 1, 'Type II congenital disorder of glycosylation': 2, 'congenital disorder of glycosylation II-c': 1, 'Type II CDG (CDG-II) diseases': 1, 'Type I, II, and III GPI-AP deficient': 1, 'Congenital Disorders of Glycosylation (CDG)-type II': 1, 'Type II Congenital Disorder of Glycosylation': 1, 'Congenital disorder of glycosylation, type II (AR)': 1, 'Cardiomyocyte dysfunction Type II': 1, 'congenital disorders of glycosylation type II B': 1, 'congenital disorders of glycosylation type-II': 1, 'or dysfunction (type II)': 1, 'CDG-I or -II': 1, 'Type II dysfunction': 1, 'congenital disorders of glycosylation types I and II': 1, 'Congenital Disorders of Glycosylation-type II': 1} | CDG type II |
Disease | MESH:C535748 | {'congenital disorder of glycosylation type 1J.': 1, 'CDG type 1J': 1, 'congenital disorder of glycosylation type 1J': 1, 'congenital disorder of glycosylation Ij': 1, 'CDG Ij': 1, 'CDG1J': 4, 'IJs': 2, 'CDG-Ij disease': 1, 'CDG-Ij': 5, 'CDG1J.': 1, 'Ij type': 1, 'IJs infection': 1, 'CDG1j': 1, 'Usher Type 1J': 1, 'Type Ij': 1, 'type IJ': 1, 'Congenital disorder of glycosylation, type 1j': 1, 'Type IJ': 1, 'PMMoV-Ij': 1} | CDG-Ij |
Disease | MESH:C535749 | {'Ike': 33, 'hurricane Ike': 8, 'IK delay': 1, "Yup'ik": 26, 'IKs': 10, 'Hurricane Ike': 67, 'IK': 64, 'ILF][LI][LIF][IV][LFI][SK][IL]IK[ASC': 1, 'Ik': 6, 'ike tumours': 1, 'Dysfunction of IK': 1, 'tIK': 1, 'IKe infection': 1, 'Bo-jung-ik-gi-tang': 1, 'Depressive-Ike': 1, 'Impairment of IKs': 1, 'IK-type': 1, 'U-type V-type IK-type I-': 1, 'IK,neo': 1, 'depression of IK': 2, "YUP'IK": 1, 'Type Ik': 1, 'IK-CSSLs': 1, 'IK-III': 1, 'dysfunction in the IKs': 1, 'IKs defects': 1, 'IK-LVA block': 1, 'flu-l ike illness': 1, 'IK Tau': 1, 'Ike damage': 1, 'absence of IKs': 1, 'IK deficiency': 2, 'Hurricane Ike-related damage': 1, 'Post-Ike': 1, 'IK/TK': 1, 'Friedlander IK': 1, 'IK and': 1, 'IK-A': 1, 'beta del canal Iks': 1, 'Fissure types I, IK, U': 1, 'Iks block': 1, 'YRCC': 1, 'LKI': 1, 'IK SY': 1, 'IK-1': 1, 'IKs blockade': 1, 'Usher syndrome, type IK': 1, 'deficiency of IKs': 1, 'Ikes': 1, 'IKs channel dysfunction': 2, 'deficiency of IK': 1, 'H. Ike': 2, 'IKs defect': 1, 'block of IK': 1, 'increase of IK': 1, 'SCID-IK-SADS': 1, 'IKs block': 3, 'iK-SADS': 1, "BRDL'IK": 1, 'IKs loss-of-function disorders': 1, 'Misumi-Ike': 1, 'CDG type 1k': 1, 'Ik(-/-)': 1, 'block of IK(erg)': 1, 'IK(': 1, 'congenital dysfunction of IKs': 1, 'Ito': 1, 'CDG Ik': 2, 'IKs deficiency': 1, 'loss of IKs': 1, 'Iks blockade': 1, 'IKs dysfunction': 1, 'IK(ATP) block': 1, 'A-type IK': 1, 'Hysteresis of IK': 1, 'lupus-ike syndrome': 1, 'influenza-ike': 1, 'IK-V': 1, 'cardiac IK': 1, 'IK channel deficiency': 1, 'reduction of IKs': 1, 'congenital disorder of glycoslyation type Ik': 1, 'IKs-HET': 1, 'IK-b': 1, 'ventricular cardiac IKs': 1, '-iK': 1, 'lupus-l ike disease': 1, 'influenzal ike-illness': 1, 'IK inflammatorischen': 1, "Yup'ik AN": 1, 'K or IK': 1, 'MNHN-IK-2012-': 1, 'MNHN-IK': 1, 'Han-Ik Cho': 1, 'ik': 1, 'ZH-IK': 1} | Hurricane Ike |
Disease | MESH:C535750 | {'IL': 973, 'erect ile dysfunction': 1, 'IL-2 tumors': 1, 'IL-17F-deficiency': 1, 'ile': 93, '-il-crollo-del-2020': 1, 'IL-050': 1, 'GNSI': 1, '-Asn-Ser-Ile': 1, 'IL-IRI': 4, 'Il': 19, 'il': 11, 'IL-5 deficiency': 1, 'IL-18 deficiency': 1, "Ha'il": 15, 'LI': 1, 'IL-17 deficiency': 15, 'D-allo-Ile': 1, 'Ile deficiency': 2, 'inborn errors of IL-17': 12, 'IL-17RC deficiency': 5, 'IL-17RA deficiency': 9, 'Inborn errors of IL-17 immunity': 2, 'IL-17E) type 2': 1, 'IL-2 deficiency': 42, 'arastirma ile ilgili olarak': 1, 'IL-S': 4, 'IL-12p40 deficiency': 7, 'IL-12 deficiency': 10, 'Nunes IL': 1, 'ILs': 42, 'Ile': 31, 'ON PATIENTS RECEIVING IL-12': 1, 'osteochrondopathies of the spina il': 1, 'deficiency of IL-36 receptor': 2, 'ilnesses': 3, 'ISF': 1, 'IL-12p40': 3, 'Defects of the IL-12': 1, 'necrosis#il': 1, 'ROLE OF IL-32': 1, 'IL-BPH': 1, 'IL-4 deficient': 1, 'ITK deficiency': 10, 'IL-2-inducible T cell kinase (ITK) deficiency': 2, 'IL-12Rbeta1 deficiency': 8, 'Ilness': 3, '- IL': 1, 'IL-6 deficiency': 14, 'IL-tuberosum': 1, 'respiratory ilness': 1, 'IL-C': 1, 'Ilnesses': 2, 'IMCI': 2, 'deficiency of IL-18BP': 1, 'ilness': 7, '%ile': 1, 'IL-': 5, '-ILs': 1, '-IL': 8, 'Leu-Asp-Glu-Pro-Asp-Pro-Leu-Ile': 1, 'ILEs': 18, 'IL-2rgammanull': 1, 'IL_I': 1, 'TFH': 1, 'IDF': 14, 'IDF Lakes': 1, 'ile-pro-ile': 1, 'IPI': 1, 'PFL': 1, 'congenital disorder of glycosylation type IL': 4, 'CDG-IL': 5, 'deficiencies of IL-10': 1, 'Deficiency of the IL-36 receptor': 1, 'Ile-Ife': 22, "culminant de l'ile": 1, 'IL-17 deficiencies': 5, 'IPV': 7, 'IL-005/20': 1, 'IL-PELD': 3, 'AGH': 1, 'ILCs': 1, 'iL-SHADE': 2, 'Il est difficile': 4, 'IL-15 deficiency': 5, 'TQ-ILs': 1, 'inborn errors of IL-12/ 23': 1, 'ITK-deficient': 3, 'deficiencies of IL-1': 1, 'deficiency of IL-4': 1, 'IL SL': 1, 'IL-21 deficiency': 9, 'IL-17F deficiency': 10, 'IL-G': 1, 'IL-15-deficiency': 1, '-Ile-Val-Ile-Ala': 1, 'IL-MT': 1, 'IL-17-deficient': 1, 'IL-21R1MUT': 1, 'IL-6 syndrome': 1, 'Bu gerekce ile olcek': 1, 'IL-12': 2, 'IL-7R deficiency': 3, 'il est difficile': 1, 'deficiency of IL-1A': 2, 'SxIP': 2, 'Ile LVID;d': 1, 'IL-PA': 1, '[IL]-A-': 1, 'COVID.Il': 1, 'ECHO.CA.IL': 2, 'inborn error of IL-17 immunity': 1, 'TI': 1, 'inborn deficiency of IL-2 receptor alpha': 1, 'IL-COF': 1, 'OIO': 1, 'mob-ile': 1, 'congenital disorders of glycosylation type 1l': 1, "Ile d'Yeu": 1, '-threo-Ile': 1, 'LL-I': 1, 'LL-III': 1, 'LL-II': 1, 'inborn errors of IL-17 immunity': 1, 'IL-1-': 3, 'FED-IL': 1, 'Re-FED-IL': 1, 'IL/2A': 1, 'Ile-ife': 2, 'ACC': 3, 'IL-MA': 2, 'IL-SS': 1, 'IL-2': 1, "Il n'existait pas de syndrome inflammatoire": 1, 'IDR': 1, 'Ile Des': 1, 'HCD-2.1L': 1, 'IL-11R deficiency': 2, 'IL-1and Type I Interferon-associated diseases': 1, 'IL-IPD': 1, 'IL-12Dosage': 1, 'iLE': 2, 'IL-10 deficiency': 9, 'IL]-L': 1, 'TIPS': 1, 'Aiken & Iles 02-051a': 1, 'Ile de la Maison': 1, 'Deficiency of IL-36 receptor': 2, "Notre-Dame-de-l'ile-Perrot": 1, 'IL-10': 1, 'IL-6emia': 1, 'ROLE OF IL-11': 1, 'OA.IL-1alpha': 1, 'agit-il': 1, 'IL-4 deficiency': 1, 'iL': 5, 'akademik basari ile okulu terk etme riski arasindaki': 1, 'Antisosyal davranislar ile okulu terk etme riski arasindaki iliski': 1, 'EGCs': 1, 'Urticaria IL-1 inhibitors': 1, 'IL-2 inducible T cell kinase (ITK) deficiency': 1, 'IL-22 deficiency': 3, 'SCID.IL-2gammar': 1, 'of IL-36 receptor': 1, 'Sept-iles': 1, 'iLS': 2, 'IL-CS': 1, 'Il riconoscimento': 1, 'IL-ATPS': 2, 'DSM-IV Axis Il disorders': 1, 'PED-IL': 1, 'IL-18opathies': 1, 'IL-18opathy': 1, 'War Il': 1, 'Ile des Pins': 3, 'I-ILs': 1, "IL n'y": 1, '-Ile': 1, 'Je-Ile NET': 1, '-Ile NET': 1, 'Je-Ile': 1, 'Je-Ile EC cell NET': 1, 'Je-Ile EC': 1, 'Je-Ile EC-cell NET': 1, 'IL cortex': 1, 'IL-1 mediated disease': 2, 'renal (IL-2) dysfunction': 1, 'arginare il': 1, 'Agelasida IL-2': 1, 'Poecilosclerida IL-2': 1, 'IL-17-Mediated Disorders': 2, '-ILEs': 1, 'Immune Deficiency of IL-10': 1, 'IL lobe tumors': 1, 'IL-5Cretdtomato': 1, 'IL-7 deficiency': 4, 'inborn errors of IL-12': 1, 'Ori-Ile': 1, 'GB-IL toxicities': 1, 'IL-CCCNC': 1, 'IL-DLLME': 1, 'sorulari ile': 1, 'deficiency of IL-1RA': 1, 'deficiency of IL-36RN': 1, 'Deficiency of IL-36RN': 1, 'IL-deficient': 2, 'IL 2,544': 1, 'IL-003': 1, 'deficiency of the IL-1ra': 1, 'DSM-IL': 1, 'IL-38 deficiency': 1, 'mama ile beslenmesini kabul ettim': 1, '-Pro-Ile-Tyr-Ala': 1, 'Ile Ife': 1, 'IL-1-mediated diseases': 3, 'Deficiency of IL-2': 1, 'Ile-a-la-': 1, '15HD': 1, 'ile aux Coudres': 1, "Ile d'Orleans": 1, 'IDO': 1, 'gasdermin D.IL-1beta': 1, 'Gaspesie - Iles-de-la-': 1, 'Gaspesie - Iles-de-la-Madeleine': 1, "che varia tra l'8,6 e il": 1, 'IL 7,826,777': 1, '-Ile-Ala-Val': 1, 'IL-10Ra deficiency': 1, 'IL-10Ra deficiency[OMIM': 1, 'life-limiting ilness': 1, 'AD IL-1': 1, 'of Il-1': 1, 'IL-2 deficiency syndrome': 2, 'CoCoNuTs': 1, 'IL-12Rbeta1': 1, 'of IL-2 receptor beta chain': 1, 'CMPS-IL': 1, '5xFAD;IL-6': 1, 'Il catasto': 1, 'Criticall Ilness': 1, 'Woodpecker iLED': 1, 'IL:0.07': 1, 'MEC IL/LG': 1, 'type I congenital disorder of glycosylation IL': 1, 'IL D': 1, 'iles': 2, 'Deficiency of the IL-36R': 1, "Il est cependant difficile d'en": 1, 'deficiency of IL-2': 2, '[IL': 1, 'IL-BASED': 1, 'IL-BASED ELECTROLYTES': 1, 'IL-T': 1, 'inborn errors of IL-6': 1, "meth'il-o-trof": 1, 'IL 33': 1, 'IF': 1, 'IL-GH deficiency': 1, 'GB-IL': 1, "Presqu'ile Malaise": 1, 'IL-21R-like Deficiency': 1, 'CMP': 1, 'mental ilness': 3, 'deficiency of the il-1-receptor antagonist': 1, 'AuNPs@IL': 1, 'IL-12 receptor deficiency': 4, 'MM': 1, 'Glu-Ile-Asp-Ile-Ile-Glu': 1, 'DITRA': 1, 'deficiency of the IL-36Ra': 1, 'il.htm': 2, 'Il perspettiva tibda tara': 1, 'IL-EUD': 1, 'DIRA': 1, 'Deficiency of IL-1ra': 1, 'IL-1 diseases': 2, 'Deficiency of IL-1': 2, 'Deficiency of IL-36ra': 1, 'mental ilnesses': 1, 'IL SIMPOSIO BRASILEIRO DE': 1, 'deficiency of IL-36 Ra': 1, 'IL-17A deficiency': 1, 'Deficiency of IL-21': 1, 'autosomal dominant (AD) IL-17F deficiency': 1, 'IL/R': 1, '1L-12 1ssR defect - 1': 1, 'IL-Ca': 1, 'Ile-': 2, 'IIEs': 1, 'BRG': 1, 'SPF-IL': 1, 'Deficiency of IL-23': 1, 'JA-ile': 1, 'IL-12 deficiencies': 1, 'MISTRG': 1, 'Deficiency of tRNA-Ile': 1, 'IL-1 mediated diseases': 1, 'IL 2B': 1, 'IL 1B': 1, 'IL 2A': 1, 'Il punteggio indicato piu': 1, 'deficiency of IL-1': 1, 'IL-10-deficiency': 1, 'IL-NTDT syndromes': 1, 'IL-NTDT': 1, 'IL-NTDT conditions': 1, 'A-IL': 1, 'FRGS': 3, 'Stereotyped Behaviors:%ile': 1, 'congenital disorders of glycosylation type IL': 2, 'SCILL': 1, 'Hyper-IL-6 syndrome': 1, 'IL-12 Receptor deficiency': 1, 'CMIL': 1, 'EMIL': 1, 'Ju-il Lee syndrome': 1, 'cN,5[Leu-Arg-Ile-Arg-Glu]-Lys-OH': 1, 'cN,6[Lys-Leu-Arg-Ile-Arg-Glu]-Lys-OH': 1, 'cN,6[Phe-Leu-Arg-Ile-Arg-Glu]-Lys-OH': 1, 'MIE-IL': 1, 'KILR': 1, 'IL-1 deficiency': 2, 'D-IL': 1, 'Inborn errors of IL-12/23': 1, 'Ilness & Injury': 1, 'Ile-T': 1, 'ile O': 1, 'Ile + Leu': 1, '-Ile-Leu': 1, 'ITK) deficiency': 1, 'IL-2-inducible T cell kinase': 1, 'IA': 1, 'type B + 1L': 1, 'JA-Ile deficiency': 1, 'IL-17 Johnson D 2019': 1, 'deficiency of Il-1 receptor antagonist': 1, 'IL-STS': 1, 'IL-SSG': 1, 'IL-7R-deficient': 1, 'IL-6Cancer': 1, 'IL-18PAP-': 1, 'IL-1-related diseases': 1, 'Deficiency of IL-36 Receptor': 2, 'Deficiency of il-1 receptor': 1, '-iLEDs': 1, 'Agbo-ile': 1, 'MA-IL': 1, 'IL-MD': 1, 'IL-12Rbeta deficiency': 1, 'AI': 1, 'CLP': 1, 'IL-23R deficiency': 1, 'IL-23 deficiency': 1, 'IleD': 1, 'ImILA': 1, 'il gusto del futuro': 1, 'SCID.IL-2': 2, 'GC.IL-33': 1, 'IL-LLE': 1, 'IL-SLE': 1, 'IL-2 inducible T cell kinase (': 1, 'IL-12 receptor': 1, 'Anti-inflammatory IL receptors': 1, 'IL-2R deficiency': 1, 'IL-12 beta-1 deficiency': 1, 'ITK deficiencies': 1, 'numarasi ile alindi': 1, 'LTH': 1, 'fMIVIL': 2, 'Ata ile': 1, 'dSSc': 1, 'ILC2': 1, 'Iles': 1, 'IL-21R deficiency': 1, 'IL-2Ralpha deficiency': 1, 'IL-10 receptor deficiency': 1, "Itzel Yab'il": 1, "Yab'il": 1, 'IL-21 receptor deficiency': 1, 'Post-1L neuropathy': 1, 'IL-CAC': 1, 'Inborn errors of IL-17': 2, 'IL-6ST deficiency': 1, 'idiopathic left (IL': 1, 'AR ITK deficiency': 1, 'cmvIL-10': 1, 'CMV IL-10': 1, 'IL-2 toxicity': 1, 'CC-Type2-IL-Sg': 1, 'IL-Sg': 1, 'AVI': 2, 'Ala-Val-Ile': 1, 'Deficiency of IL-36': 1, 'IL-2alpha deficiency': 1, 'pro-inflammatory IL-1': 1, 'metabolic prof ile': 1, 'CIT': 1, 'BRG-HIS': 1, 'IL-2-inducible T-cell kinase (': 1, 'E. ile sp': 1, 'ILNDFs': 1, 'deficiency of the IL-1Ra': 1, 'IL-51-8-2019': 1, 'IL/': 1, 'IL-12 interferon deficiencies': 1, 'inflammatory IL-1': 1, 'HemEC.IL-6': 1, '1L, type 2)': 1, 'ILV': 1, 'LIVT': 1, 'ACE-LIVT': 1, 'hyper-IL-6 syndrome': 1, 'S-IL': 1, 'CHS': 1, 'IL/81': 1, 'TARGETING IL-1': 1, 'IL turtles': 1, 'HMIE-IL': 1, 'IdF': 2, 'IL 659': 1, 'IL+LL': 1, 'Ile-Pro-Asp': 1, 'Ile-Pro-Val': 1, 'PE': 1, 'b\\ile duct dilations': 1, 'IL-IL': 1, 'IL 2 deficiency': 1, 'Il cavallo calcia la mucca': 1, 'Ley-IL': 1, 'CDG1L': 1, 'IL-17 immunity': 1, 'IL-6R deficiency': 1, 'impairment of IL-12': 1, 'IL-6 syndromes': 1, 'exanthematous ilnesses': 1, 'OSM': 1, 'PIST[IL': 1, 'PiLED': 1, 'Il est difficile d': 1, 'IL-7-deficient': 1, 'IL-10R deficiency': 1, 'IL-1': 1, 'OAU': 1, 'Ile Carre': 1, 'IL-LE': 1, 'IL-LP': 1, 'IL-POSSs': 1, 'Ile de france': 1, 'IL-17': 2, 'IL-2-inducible T-cell kinase (ITK) deficiency': 2, 'ileS': 1, 'IL-6A': 1, 'deficiency of IL-36Ra': 1, 'SYST IL-2': 1, 'inborn defects of the IL-12': 1, 'Il dolore aveva una durata': 1, 'Iles du Salut': 1, 'IDS': 1, 'IL-22-deficiencies': 1, 'IL fasciculus': 1, 'CINECA': 1, 'Chronic Ilness': 2, 'IL-020': 1, 'IL-12 tumors': 1, 'IL-17 dysfunction': 1, 'Val and Ile': 1, 'epitheloide.il': 1, 'TIL': 1, 'ACC Sarcoma': 1, 'ACC sarcoma': 1, 'IL-19': 2, 'IL.NTf2': 1, 'IL.Cl': 1, 'pandemi-nedeni-ile-acil-kabul-edilen-gz': 1, 'IL-7 receptor deficiency': 1, 'IL TRAPIANTO ORTOTOPICO': 1, 'FACIT-F': 1, 'Tong-il': 1, 'tong-il': 1, 'IL[HR': 1, 'DTE-iLED': 1, 'Psychiatric ilness': 1, '-ile': 1, 'IL-12 receptor beta1 subunit': 1, 'IL-2-': 1, 'IL-12-deficient': 1, 'Les iles': 1, 'Deficiency of IL-36R': 1, 'of IL-36R': 1, "l'ile des": 1, ", l'ile": 1, 'H. Il': 1, 'CLAL-Il mercato del latte': 1, 'ROLE OF IL-17': 1, 'AILs': 1, 'aprotic ILs': 1, 'OILs': 1, 'Protic OILs': 1, 'autosomal dominant deficiency of IL-17F': 1, 'IL-PFC': 1, 'DTY-IL': 1, 'LeIR': 1, "L'il": 1, 'IL-2LD': 1, 'VGR-IL': 1, 'deficiency of the IL-36Ralpha': 1, 'Mental Ilness': 1, 'VUI-IL': 1, 'Il-': 1, 'IL-3': 1, '-il': 1, 'ITK deficient': 1, 'RAS.IL-8': 1, 'IL-PV': 1, 'IL-1-mediated disease': 1, 'IL stenosis': 1, 'immune (IL-17) deficiency': 1, 'EM@IL': 1, 'IL-6IDD': 1, 'Il-dang-gui': 1, 'ile birinci sirada': 1, 'ile iliskili': 1, 'Civanpercemi ile': 1, 'Civanpercemi ile sari kantaron bitkisi iceren krem kullanimi daha etkin': 1, 'Aromaterapi ile ilgili': 1, 'ile,75': 1, 'yaglanma ile C-reaktif protein': 1, 'kuramsal ile uygulama arasindaki ucurumu kapatmaya yardimci olmaktadir': 1, 'istegi ile basvurmus ve kendi': 1, 'istegi ile yatisi olmus': 1, 'burslar ile desteklenmesi katki saglayabilir': 1, 'Konu ile iliskili': 1, 'Il-sang-ye-chan': 1, 'yontemi ile toplandi': 1, 'Konu ile': 1, 'ogrenci ile tamamlandi': 1, 'yontemi ile secilen': 1, 'OAUTH': 1, 'IAA': 1, 'Ile aux Aigrettes': 1, 'Olcegi ile toplandi': 1, 'chronic ilness': 1, 'deficiency of IL-10': 1, 'Il cavo': 1, 'INI': 1, 'MER-IL': 1, 'MER-IL[MER]15, 16,': 1, '-Il': 1, 'IL-RAMIE': 1, 'IK': 1, 'asilari-ile-ilgili-tjod-gorusu': 1, 'MD-IL': 1, 'IL&FS': 1} | IL |
Disease | MESH:C535751 | {'Ehlers-Danlos syndrome type 1X': 1} | Ehlers-Danlos syndrome type 1X |
Disease | MESH:C535752 | {'Carbohydrate-deficient glycoprotein syndrome type IA': 1, 'carbohydrate-deficient glycoprotein syndromes type I': 2, 'CDGS type II': 4, 'CDGS type I': 4, 'Carbohydrate-deficient glycoprotein syndrome type II': 3, 'Alkuraya-Kucinskas syndrome': 16, 'carbohydrate-deficient glycoprotein syndrome type I': 11, 'Congenital short columella': 1, 'type II carbohydrate deficient': 1, 'type II carbohydrate-deficient transferrin': 1, 'Alkuraya-Kucinskas Syndrome': 3, 'ALKKUCS': 3, 'GLYCOPROTEIN HR2': 1, 'El-Hattab-Alkuraya syndrome': 5, 'carbohydrate-deficient glycoprotein syndrome type 1: phosphomannomutase 2': 1, 'ALKKUCS syndrome': 1, 'beta 2-glycoprotein I (apolipoprotein H) deficiency': 1, 'carbohydrate-deficient glycoprotein syndrome type I.': 19, 'Deficiency of GP2': 1, 'spondyloepimetaphyseal dysplasia Faden-Alkuraya type': 2, 'Spondyloepimetaphyseal dysplasia Faden-Alkuraya type': 1, 'Carbohydrate-deficient glycoprotein syndrome type I': 10, 'carbohydrate deficient glycoprotein syndrome type I': 4, 'carbohydrate deficient glycoprotein syndrome type I transferrin': 2, 'carbohydrate deficient glycoprotein syndromes type I': 1, 'type A CBM': 1, 'congenital short columella': 1, 'type I carbohydrate-deficient glycoprotein syndrome': 2, 'type I CDGS': 2, 'IIA-X': 1, 'Alkuraya syndrome': 2, 'Type 2 CA': 1, 'HCD-2.1': 1, 'and type 2 carbohydrates': 1, 'A2GL': 1, 'CDG syndrome type I': 8, 'carbohydrate-deficient glycoprotein (CDG) syndrome type I': 4, 'CDGS type-II': 1, 'type I carbohydrate deficient glycoprotein syndrome': 2, 'beta 2GPI deficiency': 1, 'CDGS-I.': 1, 'CDGS-I': 2, 'CDGS Type-I.': 1, 'type I CDT': 3, 'CDG2A': 1, 'AKS': 3, 'short columella': 8, 'type IIA OAV spectrum disorder': 1, 'carbohydrate-deficient glycoprotein deficient syndrome type I': 1, 'ABMRZinc-alpha-2 glycoprotein': 1, 'Carbohydrate-deficient glycoprotein (CDG) syndrome type I': 3, 'a2-GPI': 1, 'ZnaGP-aemia': 1, 'carbohydrate deficient syndrome type II': 2, 'Alkuraya-Kucinsk syndrome': 1, 'ALKURAYA-KUCINSKAS syndrome': 1, 'type-I CDT': 1, 'Type-I CDT': 1, 'Type-II CDT': 1, 'carbohydrate-deficient glycoprotein type I syndrome': 3, 'Beta 2-glycoprotein I deficiency': 1, 'Short columella': 2, 'Carbohydrate-deficient glycoprotein syndromes (CDGS) type I': 1, 'CDG type II-d': 1, 'NMMHC-IIA dysfunction': 1, 'beta(2)-glycoprotein I deficiency': 1, 'carbohydrate-deficient glycoprotein syndrome type I (': 1, 'TYPE-SPECIFIC CARBOHYDRATES': 1, 'CDG syndrome type II': 2, 'Carbohydrate deficient glycoprotein syndrome type II': 1, 'CDG type I.': 1, 'CDG syndrome type I.': 3, 'type I carbohydrate deficient transferrin': 1, 'Carbohydrate-deficient glycoprotein syndrome (CDGS) type II': 1, 'carbohydrate-deficient glycoprotein syndrome type II': 2, 'CDGS) type I': 1, 'CDGS type I.': 1, 'Carbohydrate-deficient glycoprotein syndrome type 2': 1, 'CDG type I': 2, 'IIA/X': 1, 'Alkuraya- Kucinskas syndrome': 1, 'Carbohydrate deficient glycoprotein (CDG) syndrome type I.': 1, 'CDGS I': 1, 'SHORT COLUMELLA': 1, 'carbohydrate deficiency syndrome type II': 1, 'carbohydrate deficient glycoprotein syndrome Type I': 1, 'Carbohydrate deficient glycoprotein syndrome type I': 2, 'shortness of the columella': 2, 'SCC': 1, 'Faden-Alkuraya': 1, 'Carbohydrate-deficient glycoconjugate (CDG) syndrome type I': 1, 'type 2 and B type 2 carbohydrates': 1, 'type I CDG syndrome': 3, 'carbohydrate-deficient glycoprotein (CDG) syndrome type I.': 1, 'Alkuraya': 1, 'Columella abnormalities': 1, 'deficiency of beta(2)-glycoprotein I': 1, 'Alkuraya-Kufcinskas syndrome': 1, 'Spondyloepimetaphyseal dysplasia Faden-Alkuraya': 1, 'Spondyloepimetaphyseal Dysplasia Faden-Alkuraya': 1, 'SEMDFA': 1, 'Type I carbohydrate-deficient glycoprotein syndrome': 1, 'carbohydrate-deficient glycoprotein syndrome (CDGS) type I': 1, 'type II CDGS': 1, 'Carbohydrate deficient-glycoprotein syndrome type I': 1, 'beta2GPI deficiency': 1, 'Type I carbohydrate-deficient glycoprotein (CDG) syndrome': 1, 'PP2A-related (neuro) developmental disorders': 1, 'Type I carbohydrate deficient glycoprotein (CDG) syndrome': 1, 'ITC': 1, 'Type-A CBMs': 1, 'carbohydrate deficient glycoprotein (CDG) syndrome type I': 1, 'FADEN-ALKURAYA': 1} | carbohydrate-deficient glycoprotein syndrome type I. |
Disease | MESH:C535753 | {'IIDs': 69, 'and IId': 1, 'IId': 21, 'congenital disorder of glycosylation CDG IId': 1, 'Group IId': 1, 'Toxicity:2D': 1, 'congenital disorder of glycosylation type IId': 1, 'CDG-IId': 4, 'Iid': 1, 'Iid-Iie': 1, 'hip 2D deformity': 1, 'iIDS-C': 1, 'granuloma IId': 1, 'Congenital disorder of glycosylation IId': 1, 'Ia-Ic, Ie, If, IIa, and IId': 1, 'IIa-IId': 1, 'IIb, IId, IIIb': 1, '1,25(OH)2D disorder': 1, 'type II CDG': 1, 'type I and II CDG': 1, 'LAD II': 1, 'CDG type II deficiency': 1, 'Leukocyte adhesion deficiency type II': 1, 'CDG type II': 1, 'epileptic IIDs': 1, 'Brown class IId defect': 1, 'congenital neurological disorder of glycosylation type IId': 1, 'IId and IIa': 1, 'IIb-IId,': 1, 'Tc IId': 1, 'Brown IId defect': 1, 'IId fractures': 1, 'reduced 2D:4DL': 1, 'IIb and IId/x': 1, ') and IId': 1, 'II': 1, 'class IId': 1, 'congenital deficiency of glycosylation IId': 1, 'CDG IId': 1, ', IId': 1, 'iiD': 1, 'iid': 1, 'FRF': 1, '-IIa and IId': 1, 'IId injuries': 1, 'IIDness': 1, 'CDG2D': 1, 'Congenital disorder of glycosylation 2D': 1} | IIDs |
Disease | MESH:C535754 | {'stage IE and IIE disease': 4, 'stage IIE disease': 24, 'IIE': 121, 'IE and IIE': 14, 'stage IIE': 18, 'IE or IIE': 17, 'IIE tears': 1, 'stage IIE-IVE disease': 1, 'Lugano stage II2/IIE': 1, 'IE-IIE': 9, 'stage IE/IIE': 8, 'stage IE and IIE tumors': 2, 'CS IIE': 3, 'CS IIE - IV': 1, 'CS IE and IIE': 1, 'stage IE and IIE': 8, 'IE and IIE diseases': 1, 'IIE disease': 17, 'IE/IIE disease': 7, 'stage IE-IIE) disease': 1, 'IE/IIE': 20, 'II/IIE': 1, 'type IIE/F/H-like structural abnormalities': 1, 'IE and IIE disease': 2, 'IE-IIE disease': 2, 'stage IE and IIE lesions': 1, 'Vicenza and IIE': 1, 'Stage IIE disease': 4, 'stage IE-IIE': 6, 'stage IE/IIE disease': 1, 'IE or IIE disease': 5, '2A subtype IIE': 1, ', IE, II, or IIE': 1, 'Stage IE and IIE': 1, 'IE and IIE tumors': 1, 'IIE-1 disease': 1, 'IE or IIE-1': 1, '-IIE': 3, 'IIE-': 1, 'stage II and IIE disease': 1, 'stage IIE and IV': 1, 'stage IIE-IV disease': 2, 'stage IIE diseases': 1, '(IIE': 1, '2A(IIE)': 1, '/IIE 2 , 3': 1, '2A/IIE': 4, 'IIC, IIE)': 1, '2A (IIA and IIE)': 1, '/IIE': 2, 'Stage IIE(B': 1, 'IE to IIE': 3, 'Stage IE-IIE': 1, 'or IIE': 1, '&IIE': 1, 'MIIE': 1, 'II-IIE': 1, 'LGMD2E disorders': 1, '2e-ASD': 1, '2A[IIE': 1, '2A, subclass IIE': 1, 'IE+IIE': 1, 'stage II or IIE disease': 1, 'stage IE X IIE': 1, 'stage IE to IIE': 1, 'IIE-1': 1, 'Lugano stage IIE': 2, 'Lugano stage IIE-IV': 1, 'Ann Arbor stage IIE': 3, 'stage IIE-1': 1, 'IE 39 IIE': 1, 'Clade IIE': 1, '+ IIE': 1, 'Subtyp IIE': 1, 'group IIE tumors': 1, 'IE or IIE diseases': 1, 'stage IE /IIE': 1, 'IE /IIE': 1, 'stage II/IIE disease': 1, 'Stage IIE': 1} | IIE |
Disease | MESH:C535755 | {'IIa+IIc lesion on': 1, 'RHS': 280, 'AAF/II': 1, 'LAD II': 57, 'leukocyte adhesion deficiency type II': 38, 'stage IIc': 3, 'IIc': 146, 'Glaucoma IIc and IIIa': 1, '0-IIc': 39, 'IIc or IIa+c': 1, 'HLA-II deficiency': 2, 'Cell Adhesion Molecule 2': 1, 'IICs': 10, 'IIa-IIc': 4, 'leukocyte adhesion deficiency II': 29, 'Leukocyte adhesion deficiency type II': 16, 'LAD type II': 8, 'leukocyte adhesion deficiency type 2': 7, 'LAD2': 27, 'leukocyte adhesion deficiency, type 2': 1, 'IIa+IIc': 7, ', IIc, IIIb, and IIIc': 1, 'leukocyte adhesion deficiency syndrome type II': 3, 'LADII': 14, 'I-IIc': 1, 'Ib-IIc': 1, 'IIa, IIb, IIc': 3, 'IIb, IIc, IIIb, IIIc': 2, 'IIb, IIc, IIIb, and IIIc': 1, 'IIa and IIc': 3, 'IIb and IIc': 4, 'Forrest IIc lesions': 1, 'LAD-II': 17, '2c injuries': 1, '0-IIa+IIc lesion': 3, 'leucocyte adhesion deficiency type II': 1, '+IIc': 4, 'state IIc': 1, 'Leukocyte adhesion deficiency II': 11, 'RHS_V': 1, 'Congenital disorder of fucosylation type 2c': 1, "Brown's class IIc": 1, 'syndromic (RHS': 1, 'IIc bacteriocins': 1, '(IIc': 2, 'Adhesions 2': 1, 'congenital disorder of glycosylation-IIc': 1, 'IIa + IIc': 11, 'SCID-IIc': 1, 'RHS syndrome': 4, 'Is + IIc': 4, 'Ling IIc': 1, 'IIc and III': 3, 'CDG-IIc': 9, '-IIc': 17, 'leucocyte adhesion deficiency II': 3, 'Letenneur IIb and IIc': 1, 'IIc-e Other lymphomab': 1, '0-IIc lesions': 2, 'RMMJ': 2, 'stage IIb and IIc': 1, '+ IIc': 7, 'FFP-IIc fracture': 1, 'ITA type 2': 1, 'HLA-II': 1, 'Forrest Ia-IIc': 2, 'Forrest Ia to IIc': 1, 'Ia-IIc': 1, 'adhesion 2': 1, 'LAD-II disease': 3, 'Forrest IIc and III': 8, 'IIa+IIc lesion': 1, 'leukocyte adhesion deficiency-II': 3, '0-IIc+IIa lesion': 1, '0-IIc neoplastic lesion': 1, 'RHS-LC': 1, 'Hasharon': 3, 'CDG IIc': 5, 'FCM Ia, IIb, and IIc': 1, 'Leukocyte adhesion deficiency II syndrome': 1, 'TASMC': 2, 'CR': 1, 'LAD II disorder': 2, 'Adhesion 2': 1, 'leukocyte adhesion syndrome types 1 and 2': 1, 'AEC/RHS': 1, 'IIc and': 2, 'ypStage IIc': 1, 'stage-IIb/IIc': 1, 'L-2C.2': 1, 'anti-leukocyte antibodies type 1 as well as type 2': 1, 'LAD type 2': 4, 'RAMBAM': 2, '0-IIc lesion': 11, 'Leukocyte Adhesion Deficiency Type II': 2, 'CDG type IIc': 1, '0-IIa-IIc': 1, 'nongranular 0-IIc lesions': 1, 'Leukocyte Adhesion Deficiency type II (LAD II) syndrome': 1, 'HMSN) IIc': 1, 'Leukocyte adhesion deficiency types 1 and 2': 1, 'LT-IIc': 3, '/Ib/IIa/IIb/IIc/': 1, 'Whitehall IIc Infection': 1, 'slightly depressed (IIc) neoplasms': 1, 'CDGIIc': 3, 'congenital disorder of glycosylation type 2c': 1, 'Is/IIc/III': 1, 'Forrest IIc ulcers': 3, 'IIa, IIb, and IIc': 2, 'Paprosky IIc or': 1, 'Forrest IIc lesion': 2, 'Leukocyte adhesion deficiency (LAD) II': 2, 'IIc lesion': 11, 'IIc, D, IIIa, IIIb and IV': 1, 'TNM stage IIc': 1, 'Leukocyte adhesion deficiency (LAD) type II': 2, 'AF-IIc': 1, '-RHS': 1, 'IIc and IId': 3, 'RHS-FS': 1, 'Leukocyte adhesion deficiency type 2': 9, 'IIc lumbosacral': 1, 'IIc-': 2, '1 0 - IIa0 - IIb0 - IIc': 1, 'IIc/IIc + IIa cancer': 1, 'Is+IIc lesion': 1, 'congenital deficiency of glycosylation-IIc': 1, 'Leukocyte adhesion defect II': 1, 'stage IIc carcinoma': 1, 'IIc + IIa': 2, 'and IIc': 4, 'IIc lesions': 5, 'RHS-liver disease': 1, 'type II adhesions': 1, 'Type II adhesions': 1, 'Forrest IIc and III lacerations': 1, 'Forrest IIc-III': 1, 'Forrest IIc': 6, 'IIc or IId': 1, 'HMSN IIc': 1, '2c injury': 1, 'Forrest Ib-IIc': 1, 'IUA-II': 1, '0-IIa+IIc tumor': 2, 'leukocyte adhesion deficiency syndrome II': 2, 'Conformers IIa and IIc': 1, 'stage IIc disease': 2, 'or IIc': 1, '0-IIa and -IIc': 1, 'Leukocyte Adhesion deficiency type 2': 1, 'depressed (IIc) lesions': 1, 'depressed 0-IIc': 1, 'Leukocyte Adhesion Deficiency type II': 2, 'leukocyte deficiency syndrome II': 1, 'IIa, IIb, and IIc AVMs': 1, 'VABS-IIc': 1, 'IIc or D': 1, 'Ic IIc IIIc Ic IIc': 1, 'leukocyte adhesion deficiency (LAD) syndrome type II': 1, ', IIc, and IIb': 1, 'leukocyte adhesion deficiency-2': 1, 'Ic and IIc': 2, 'LAD), type II': 1, 'Leukocyte Adhesion Deficiency, Type II': 1, '0 - IIa + IIc': 1, 'stage IIa and IIc': 1, 'IIa + IIc lesion': 2, 'LAD-2': 1, '-IIc + Is': 1, 'Ia-Ic/IIa and IIb/IIc': 1, 'IIa vs. IIb and IIc': 1, 'Ib/Ic/IIc/IIIb/IIIc': 1, 'Stage IIc disease': 1, '-IIc tumor': 1, '0-IIc tumor': 3, 'stage Ib-IIc': 1, 'IIa-IIc disease': 1, 'Carpenter RHS': 1, 'RHS Fracture': 1, 'IIa+IIc tumor': 1, 'A IIb+IIc tumor': 1, 'I and IIc lesion': 1, 'IIa +IIc': 1, 'Craig IIc fractures': 2, 'Craig IIc injury': 1, 'Craig IIc': 2, 'RHS CPS R': 1, 'RHS SPS R': 1, 'IIc FMOs': 1, 'iIC': 4, 'Rambam': 5, 'IIa, IId, and IIc': 1, 'leukocyte adhesion deficiency (LAD) type II syndrome': 1, 'RHS syndromes': 1, 'congenital disorder of glycosylation IIc': 5, 'lesions of class IIc': 1, 'leukocyte adhesion deficiency type II syndrome': 3, 'IIc, D, IIIa': 1, 'IIa/IIc': 1, 'Type II leukocyte adhesion deficiency': 1, '0-IIc+IIa1 (A': 1, 'IIc disease': 1, 'Leukocyte adhesion deficiency-II': 1, 'BAMIC Grade 2c injury': 1, 'Paris Is + IIc lesion': 1, 'RHS-15appears': 1, 'RHS_D': 1, 'Paprosky typeIIb, IIc, IIIa, and IIIb': 1, 'LAD Type 2': 1, 'Leukocyte adhesion deficiency Type II': 1, 'Congenital disorder of glycosylation IIc': 1, 'congenital disorders of glycosylation leukocyte adhesion deficiency type II': 1, 'IIb + IIc': 1, 'Forrest IIb, IIc, and III lesions': 1, 'IIb, IIc and': 2, "0-IIa+IIc' tumor": 1, 'Leukocyte Adhesion Deficiency II': 2, 'depressed (0-IIc) lesion': 1, 'O-IIc': 1, 'Is/IIa/IIb/IIc': 1, 'Type II (LAD II) disorder': 1, 'Neer I and Craig IIc fractures': 1, 'Craig IIc fracture': 1, ', and IIc': 1, 'RHS - 15 CMDs': 1, '-, IIb or IIc': 2, 'IIc injuries': 1, 'pStage IIc': 1, 'leukocyte adhesion deficiency syndrome type 2': 2, 'ACME subtype IIb and IIc': 1, 'RHS canid': 1, 'IIc hips': 1, 'Forrest III/ IIc': 1, 'EMR-0-IIc': 1, 'RMC': 3, 'Is + 0-IIc': 1, 'Paris IIa + IIc lesion': 1, 'Leukocyte adhesion deficiency type II syndrome': 1, '0-IIa+IIc': 2, 'Forrest Ia-IIc ulcers': 1, 'IIc or': 1, 'reticulohystiocytary system (RHS) neoplasms': 1, '(IIc + III)': 1, 'PECA': 1, 'Forrest IIc and III ulcers': 1, 'leukocyte adhesion deficiency (LAD) type 2': 1, 'FFP IIc, IIIc and IVb injuries': 1, 'Ridge atrophy IIc': 1, 'Forrest Ib, IIa, IIb, and IIc': 1, 'IIc tumor': 1, 'carcinomas of the IIa + IIc': 1, 'Forrest Ia,/Ib/IIa/IIb/IIc/III': 1, 'IIc +': 1, 'Stoma IIc': 1, 'ARI 2': 2, '-IIa + IIc lesion': 1, '- IIa + IIc lesion': 1, 'Congenital Deficiency of Glycosylation-IIc': 1, 'Draf IIc': 1, 'III, IIc and IIc-III': 1, 'LQL-LES-RHS-RIL-RGX': 1, 'IIb, IIc,': 1, 'IIc, D, IIb': 1, '0-IIc tumors': 1, 'congenital disorder of gylcosylation IIc': 1, 'congenital disorder of neutrophil adhesion, leukocyte adhesion deficiency syndrome type 2': 1, 'IIc-a': 2, 'Paprosky IIc': 1, 'IIc adenomas': 1, 'Leukocyte adhesion deficiency, type II': 2, 'Hasharon haemoglobinopathy': 1, 'CGDIIc': 1, 'II LAD': 1, 'Type II LAD': 1, '0-IIc carcinoma': 1, 'I/IIc': 1, 'stage Ia-IIc tumor': 1, 'LEUKOCYTE adhesion deficiency II': 1, 'depressed (0-IIc)': 1, 'IIc + lIb': 1, 'leukocyte adhesion deficiency 1 and 2': 1, 'type 2 A-B adhesions': 1, 'ARI 1 and 2': 1, 'Congenital Disorder of Glycosylation IIc': 1, '-IIc lesion': 1, 'LX;PI-IIc;PR-1a': 1, '0-IIa + IIc': 3, '0 IIc': 1, 'DRAF IIc': 1, 'IIc erythematous': 1, 'iic lesions': 1, 'Graf IIc dysplasia': 1, 'dysplasia above Graf IIc': 1, 'IIc, III': 1, '-IIb-IIc': 1, 'Intrauterine adhesion 2': 2, '-IIc LPM': 1, 'Leukocyte Adhesion Deficiency type 2': 1, 'Leukocyte Adhesion Deficiency Type 2': 1, 'genetic impairment of the alpha(2C)-adrenergic receptor': 1, 'leukocyte adhesion deficiency II-CDG': 1, 'LAD 2': 1, 'Rambam-Hasharon syndrome': 3, 'type0 IIa+IIc lesion': 1, 'Mt type0-IIc T1a N0M0': 1, 'Leucocyte Adhesion Deficiency type II': 1, 'mucinous IIc': 1, 'RHS A': 1, 'Forrest IIa, IIb, IIc, and III': 1, 'leukocyte adhesion defects (LAD) II': 1, 'RHS-15': 1, '0-IIb + IIc tumor': 1, 'NaPi-IIc deficiency': 1, 'leucocyte type 1 and 2 adhesion deficiencies': 1, 'Leukocyte adhesion deficiency type 2 Glucose diphosphatase-fucose transporter-1': 1, 'EGC-IIc': 1, 'LECT2 deficiency': 1, 'IIc,': 2, '(IIa, IIb, and IIc': 1, 'leukocyte adhesion deficiency (LAD) type II genetic syndrome': 1, 'leukocyte adhesion deficiency (LAD)* type II': 1, 'leukocyte adhesion deficiency (LAD) type II': 1, 'congenital disorder of glycosylation (CDG)-IIc': 1, 'Forrest III and IIc)': 1, 'congenital HLA class II deficiency': 1, 'adhesion 2': 1, 'type II leukocyte adhesion deficiency': 1, '2C injuries': 1, 'UM_RHS': 1, '0-IIa plus IIc': 1, 'Condition IIc': 1, 'nonpolypoid lesions (IIa, IIb, IIc': 1, 'Graf IIb and IIc': 1, 'RHS-15a': 1, '-Is + IIc': 1, 'HLA-II defect': 1, '-IIa + IIc': 1, 'Filmy adhesion 2': 1, 'Graf IIc': 1, 'FFP IIc lesion': 1, 'Lect2 deficiency': 1, 'Forrest Ia, Ib, IIa, IIb, and IIc': 1, 'VGIIa/IIc': 1, '/IIc/D': 1, 'stenosis of the proximal LAD2': 1, 'Is+IIc': 1, 'LAD-II syndrome': 1, 'Ivory Coast IIc': 1, 'Leukocyte adhesion deficiency (LAD) type 2': 1, 'congenital disorders of glycosylation IIc': 1, 'LAD II syndrome': 1, 'Hb Hasharon': 1, 'hips (IIb, IIc, D, III': 1, 'Leukocyte Adhesion Deficiency-II': 1} | RHS |
Disease | MESH:C535756 | {'COG1 deficiency': 3, 'COG1-4': 1, 'COG1': 1, 'IIG RM': 1, 'Type IIC/IIG': 1, ', IIC/IIG': 1, 'IIG and IV RM': 1, 'IIG': 14, 'Type IIG RM': 5, 'IIG and IIM': 1, 'Type IIG TRDs': 1, 'LGMD type 2G': 1, 'LGMD type 2G.': 1, 'IIG R-': 1, 'type IIG and type III RM': 1, 'Cog1 deficiency': 1, 'IIG REases': 1, 'type IIG or IID': 1, 'Type IIG': 5, 'Type IIB and IIG': 1, 'type IIG R-M': 1, 'IIG R-M': 2, 'MIIG': 1, 'I, IIG and': 1, '-IIG': 1, 'Deficiency in COG1': 1, 'type IIG, and III': 1, 'type 2GS syndrome': 1, 'Type I, IIG, and III RM': 1, 'type II and type IIG': 1} | IIG |
Disease | MESH:C535757 | {'hearing dysplasia': 1, '-recessive ectodermal dysplasia syndrome with hearing loss': 1, 'Congenital ectodermal dysplasia with hearing loss': 1, 'HDR syndrome': 1} | hearing dysplasia |
Disease | MESH:C535758 | {'CHB': 757, 'congenital heart block': 1151, 'DFHS': 3, 'congenital complete heart block': 339, 'RCBD': 28, 'Congenital complete atrioventricular block': 39, 'congenital complete atrioventricular block': 101, 'Congenital complete heart block': 134, 'Complete Heart Block': 14, 'Complete heart block': 54, 'Congenital heart block': 218, 'Hypertrophic neuropathy with complete conduction block': 1, 'familial conduction disease': 6, 'CONGENITAL BLOCK': 1, 'AVB': 1, 'CMS': 1, 'FamHS': 9, 'COMPLETE HEART': 8, 'SHFS': 54, 'CCAVB': 50, 'congenital blocks': 2, 'congenital atrioventricular heart block': 7, 'congenital second-degree heart block': 1, 'Congenital second-degree heart block': 1, 'Familial congential heart block': 1, 'CCHB': 93, 'or complete block': 1, 'Congenital Heart Block': 59, 'IRH': 2, 'CAVB': 18, 'congenital complete atrio-ventricular block': 1, 'familial heart block': 24, 'Congenital Complete Heart Block': 14, 'atrio-ventricular complete block': 2, 'Congenital Complete Atrioventricular Block': 7, 'FAMILIAL CONGENITAL HEART BLOCK': 1, 'complete block': 29, 'Congenital CAVB': 3, 'congenital block': 11, 'ACBD': 1, 'congenital cardiac block': 6, 'SHS': 1, 'FHS': 10, 'Familial Heart Block': 2, 'complete heart block': 63, 'congenital cardiac conduction abnormalities': 4, 'SAFHS': 25, 'cAVB': 4, 'fetal complete heart block': 8, 'Complete congenital block with syncope': 1, 'CHB congenital heart block': 1, 'Congenital complete AV block': 3, 'familial complete heart block': 1, 'congenital-onset familial heart block': 1, 'Familial congenital complete heart block': 3, 'sensory and complete motor block': 1, 'CONGENITAL COMPLETE HEART BLOCK': 3, 'neonatal lupus congenital heart block': 4, 'autoimmune CHB': 11, 'Autoimmune associated congenital heart block': 2, 'congenital conduction disorder': 6, 'congenital heart disease block': 1, 'congenital or acquired block vertebrae': 2, 'Motor and sensory complete injury': 1, 'motor and sensory complete injury': 3, 'neonatal lupus syndrome-congenital heart block': 1, 'NLS-CHB': 1, 'Neonatal lupus syndrome-congenital heart block': 1, 'Familial Heart Block Type-1A': 1, 'Familial automaticity-conduction disorder': 1, 'COMPLETE HEART BLOCK': 28, 'autoimmune congenital heart block': 20, 'Congenital partial heart block': 3, 'congenital arterial block': 1, 'congenital block vertebrae': 12, 'familial heart block 1': 1, 'paroxysmal complete block': 1, 'Autoimmune Congenital Heart Block': 4, 'Autoimmune congenital heart block': 8, 'Congenital Complete Heart-block': 1, 'congenital complete AV block': 11, 'congenital block vertebra': 13, 'FHPHD.29': 1, 'FHPHD': 1, 'FHPHD.42': 1, 'familial heart block type 1': 9, 'Autoimmune Congenital Complete Heart Block': 1, 'COMPLETE AURICULOVENTRICULAR BLOCK': 2, 'Congenital block vertebrae': 3, 'complete conduction block': 1, 'CCB': 4, 'complete congenital heart block': 6, 'VENTRICULAR AUTOMATISM IN COMPLETE A-V BLOCK': 1, 'congenital block vertebrae of the spine': 1, 'congenital block vertebra of the': 1, 'Congenital complete atrioventricular blocks': 1, 'complete block of motor nerve conduction': 1, 'ISOLATED HEART': 11, 'complete unilateral block': 1, 'ISOLATED WORKING HEART PERFUSION': 1, 'congenital atrioventricular (AV) heart block': 1, 'Autoimmune-Associated Congenital Heart Block': 2, 'congenital complete atrioventricular (AV) block': 4, 'morphological block': 1, 'Congenital vertebral blocks': 1, 'Familial heart block': 4, 'isolated calcification of the heart': 1, 'heart isolation': 1, 'Autoimmune-associated CHB': 3, 'MECHANISMS OF AUTOIMMUNE-ASSOCIATED CONGENITAL HEART BLOCK': 1, 'CONGENITAL HEART BLOCK': 5, 'Autoimmune-associated Congenital Heart Block': 1, 'autoimmune-associated CHB': 1, 'congenital neonatal heart block': 2, 'congenital complete heart-block': 1, 'familial conduction abnormality': 1, 'familial heart block 1A': 1, 'congenital fetal heart block': 5, 'familial conduction block': 1, 'isolated conduction disease': 8, 'cardiac CHB abnormalities': 1, 'congenital hearth block': 1, 'IRHs': 1, 'Complete fetal heart block': 1, 'familial conduction disorders': 2, 'congenital complete/advanced atrioventricular block': 1, 'ISOLATED HEART MECHANICS': 1, 'congenital heart blocks': 15, 'isolated conduction disorders': 1, 'Congenital complete atrio-ventricular block': 3, 'familial heart block type IB': 2, 'congenital conduction disorders': 2, 'neonatal congenital heart block': 1, 'Congenital complete heart blocks': 1, 'COMPLETE HEART-BLOCK': 3, 'COMPLETE CONGENITAL A-V': 1, 'Autoimmune-associated congenital heart block': 7, 'congenital complete A-V block': 4, 'Congenital heart blocks': 2, 'CHBs': 2, 'Neonatal congenital heart block': 2, 'Congenital atrioventricular heart block': 4, 'Neonatal lupus-complete heart block': 1, 'NL-CHB': 1, 'neonatal lupus-complete heart block': 1, 'CONGENITAL ABNORMALITY OF THE HEART CONDUCTION SYSTEM': 1, 'type I, II or III CHB': 1, 'type III CHB': 1, 'Autoimmune CHB': 5, 'autoimmune-CHB': 1, 'type I CHB': 1, 'ACHB': 5, 'congenital total cardiac block': 1, 'retrograde complete block': 1, 'complete sensory block': 1, 'Familial auriculo-ventricular heart block': 1, 'palatal nerve block': 1, 'ICC': 1, 'isolated cardiac conduction': 2, 'isolated heart block': 1, 'Complete congenital cleft sternum': 1, 'neonatal complete heart block': 1, 'Complete auriculoventricular block': 2, 'Congenital or idiopathic complete A-V block': 1, 'congenital or idiopathic complete A-V block': 1, 'congenital complete AVB': 2, 'CHB.[9': 1, 'congenital vertebral blocks': 2, 'congenital block vertebrae of': 1, 'Familial complete heart block': 1, 'CHB inflammatory': 1, 'complete motor block': 1, 'congenital CHB': 2, 'VFHS': 1, 'congenital total heart block': 1, 'Congenital artio-ventricular block': 1, 'CHB CM': 1, 'isolated block': 1, 'CHB Congenital heart block': 1, 'A-V complete block': 1, 'Familial CCD': 1, 'familial CCD': 1, 'congenital vertebral block': 2, 'Congenital complete atrioventricular block in': 1, 'complete A-V heart block': 1, 'Complete congenital heart block': 5, 'BRACHIALGIA WITH CONGENITAL VERTEBRAL BLOCK': 1, 'congenital complete transverse block of the heart': 1, 'ISOLATED HEART PERFUSIONS': 1, 'left bundle or complete heart block': 1, 'CHRONIC COMPLETE HEART BLOCK': 1, 'A-V blocks congenital and': 1, 'ARCBD': 1, 'atrioventricular complete heart block': 2, 'Congenital complete atrioventricular heart block': 3, 'congenital and acquired heart block': 1, 'Isolated congenital complete heart block': 1, 'complete auriculoventricular block': 2, 'MANAGEMENT OF COMPLETE HEART': 1, 'Immune-mediated congenital heart block': 1, 'congenital complete auriculo-ventricular block': 1, 'congenital Heart Block': 1, 'iCHB': 1, 'Congenital conductive': 2, 'Maternal complete heart block': 1, 'autoimmune-associated congenital heart block': 2, 'aCHB': 2, 'familial infra-Hisian block': 1, 'Fetal complete heart block': 3, 'complete atrioventricular heart block': 1, 'familial disorder of heart muscle': 1, 'CONGENITAL COMPLETE PYLORIC OCCLUSION': 1, 'CHB grade III': 1, 'Autoimmune-mediated congenital heart block': 1, 'atrioventricular or complete heart block': 1, 'familial heart block (type 1)': 1, 'AV or complete heart block': 1, 'PITCH': 1, 'congenital complete heart blocks': 1, 'Congenital atrio-ventricular heart block': 1, 'congenital conduction block': 1, 'LCHB': 1, 'Transient complete heart block': 1, 'TCHB': 1, 'transient complete heart block': 1, 'fetal congenital heart block': 6, 'Familial Heart Block,': 1, 'CONGENITAL ATRIAL FLUTTER WITH COMPLETE HEART BLOCK': 1, 'congenital complete block': 1, 'Congenital fetal heart block': 2, 'congenital hear block': 1, 'FAMILY CONDUCTED': 1, 'Congenital AV heart block': 1, 'CHB IIa': 1, 'autoimmune mediated CHB': 1, 'congenital HB': 1, 'CHB.8 F-fluoro-deoxy-glucose': 1, 'Familial Heart Block Type-1': 1, 'congenital heart block -6': 1, 'CAHB': 1, 'congenital third-degree heart block': 2, 'congenital third degree heart block': 1, 'postoperative complete block': 1, 'congenital heart block': 1, 'Familial congenital heart block': 1, 'TACHYCARDIA COMPLICATING COMPLETE HEART BLOCK': 1, 'ISOLATED PERFUSED RAT HEART': 1, 'ICCD': 1, 'Congenital AV block Congenital heart disease': 1, 'Congenital complete transverse heart block': 2, 'Congenital Cardiac Conduction Abnormalities': 1, 'Neonatal lupus and congenital heart block': 1, 'orthostatic complete heart block': 1, 'motor and sensory complete injuries': 1, 'COMPLETE HEART BLOCK': 1, 'ICCAVB': 2, 'Fetal Congenital Heart Block': 1, 'fetal autoimmune complete heart block': 1, 'Congenital cardiac blocks': 1, 'cCAVB': 1, 'Congenital Heart-Block': 1, 'familial heart block type 1 diseases': 1, 'CONGENITAL COMPLETE': 1, 'TREATMENT OF COMPLETE HEART BLOCK': 1, 'Congenital complete auriculo-ventricular block': 3, 'Congenital heart or conduction abnormalities': 1, 'Congenital and familial atrio-ventricular block': 1, 'IH': 2, 'RBD': 3, 'PERFUSED ISOLATED HEART': 1, 'CHB-3': 1, 'CHB-': 1, 'CHB-1': 1, 'CHB-2': 1, 'ischemic CHB': 1, 'Familial atrioventricular heart block': 1, 'INTACT ISOLATED HEART': 1, 'heart isolated': 1, 'Autoimmune fetal congenital heart block': 1, 'neonatal lupus-congenital heart block': 1, 'CD abnormalities': 1, 'congenital block of vertebral': 1, 'isolated atrio-ventricular block': 1, 'congenital heart blocking': 1, 'congenital heart conduction block': 1, 'third-degree (complete) block': 1, 'congenital cardiac heart block': 1, 'FAMILIAL CONGENITAL HEART': 1, 'congenital atrio-ventricular heart block': 1, 'autoimmune congenital block': 1, 'Neonatal lupus congenital heart block': 1, 'Congenital complete atrioventricular (AV) block': 1, 'congenital A-V block': 1, 'motor/sensory complete injuries': 1, 'Congenital heart block Sepsis syndromes': 1, 'familial heart diseass': 1, 'congenital complete heart block.5': 1, 'CHB SpA': 1, 'Bradyarrhythmia CHB': 1, 'SYNCOPE WITH COMPLETE HEART': 1, 'congenital CAVB': 2, 'fetal hearts CHB': 1, 'cHB': 1, 'Congenital Heart-block': 1, 'congenital and childhood complete atrioventricular block': 1, 'Familial Heart Block type 1A': 1, 'POSTINFARCTION COMPLETE HEART BLOCK': 1, 'Adult familial idiopathic binodal block': 1, 'HEMODYNAMICS OF CONGENITAL HEART BLOCK': 1, 'HIP': 1, 'ICHB': 2, 'congenital heart-block': 2, 'auriculo-ventricular congenital heart block': 1, 'Complete Heart block': 1, 'congenital foetal heart block': 1, 'Complete block': 1, 'atrioventricular (AV) or complete heart block': 1, 'Chronic complete heart block': 1, 'AV and complete heart block': 1, 'complete heart blocks': 1, 'Congenital familial atrioventricular heart block': 1, 'Congenital, complete heart block': 1, 'congenital atrio-ventricular (AV) heart block': 1, 'complete isthmus block': 1, 'isolated heart': 1, 'congenital complete fetal heart block': 1, 'congenitally complete heart block': 4, 'Congenitally complete heart block': 1, 'COMPLETE heart block': 1, 'ISOLATED-HEART MODEL': 1, 'Congenital CHB': 1, 'sympathetic and complete motor block': 1, 'PATCH': 1, 'congenital blocked vertebrae': 1, 'Complete auriculo-ventricular heart block': 1, 'Neonatal complete heart block': 1, 'congenital heart block disease': 1, 'congenital AV block': 1, 'Congenital vertebral block': 2, 'FSCB': 1, 'acquired complete heart block': 1, 'HEART SURGERY-ISOLATED ARTIFICIAL': 1, 'MCI-H.': 1, 'MCI-H': 1, 'THE ISOLATED HEART': 1, 'CHB-BCI': 1, 'sudden complete block': 1, 'CCHB block': 2, 'congenital auriculoventricular heart block': 1, 'CASE OF CONGENITAL HEART BLOCK': 1, 'Atrioventricular (AV)/complete heart block': 1, 'familial cardiac block': 1, 'Fetal congenital heart block': 2, 'Familial branch block': 1, 'congenital heat block': 1, 'ALTERATIONS OF COMPLETE HEART BLOCK': 1, 'COMPLETE FORWARD BLOCK': 1, 'Atrioventricular complete heart block': 1, 'congenital heart-blocks': 1, 'iCCHB': 1, 'Familial trifascicular block': 1, 'Complete Motor block of the lower extremities': 1, 'congenital compete heart block': 1, 'congenital anomalies like block vertebra': 1, 'Autoimmune CCHB': 1, 'autoimmune CCHB': 1, 'degenerative complete heart block': 1, 'congenital block vertebrae at': 1, 'congenital complete opthalmoplegia': 1, 'autoimmune-congenital heart block': 1, 'familial type 1 heart block': 1, 'congenital complete atrioventricular heart block': 1, 'Congenital blocked vertebra': 1, 'CONGENITAL COMPLETE ATRIO-VENTRICULAR BLOCK': 1, 'IHH': 1, 'CBV': 1, 'CHB) disease': 1, 'Congenital heart block (': 1, 'CHB disease': 1, 'congenital auricular-ventricular heart block': 1, 'CONTRACTILITY OF ISOLATED HEARTS FROM MYXEDEMATOUS RATS': 1, 'Congenital complete arterio-ventricular block': 1, 'CHB complication': 1, 'CHB block': 1, "Congenital' block vertebra": 1, 'atrioventricular congenital heart block': 1} | congenital heart block |
Disease | MESH:C535759 | {'FIGO IA2-IIA': 3, 'IA2-': 14, 'FIM': 290, 'IA2': 224, 'c-stage IA2': 1, 'Familial myasthenia': 3, 'myasthenic episode': 2, 'Ia2': 10, 'congenital myasthenic syndrome with episodic apnea': 5, 'CMS-EA': 8, 'episodic apnea': 28, 'Episodic Apnea': 4, 'IAA': 1, 'IA2 tumors': 3, 'Stage IA2': 1, 'stage IA2-IIB': 2, 'FIM-M': 3, 'IA': 3, 'CMS with episodic apnoea': 1, 'congenital MD type 1A.': 1, 'FIM-': 2, 'IA2/': 1, 'IA2-IB2': 1, 'IA2-IIA': 9, 'pStage 0 to IA2': 1, 'IA2-IIIA': 1, 'IA2 disease': 9, 'Ia2-': 1, 'IA2, IB, or IIA': 2, 'CMS6-1': 1, 'SEE-FIM': 5, 'FIM-deficient': 1, 'IA2 carcinoma': 1, 'IA2 lesion': 1, 'congenital myasthenia with episodic apnea': 1, 'Episodic apnea': 3, 'FIM cognitive': 3, 'CMS6': 2, 'Obstructive apnea episode': 1, 'apnea episodes': 1, 'presynaptic congenital myasthenic syndrome 6 and 21': 1, 'FIM-4': 1, 'stage IA2': 13, 'CC-IA2': 1, '-FIM': 3, 'stage IA2-IB': 2, 'Autoimmune familial myasthenia': 1, 'stage IA2 to IB': 1, 'Familial infantile myasthenia gravis': 4, 'familial infantile myasthenia gravis': 3, 'Adeno IA2': 1, 'infantile myasthenia': 5, 'pStage IA2': 4, 'FIM-1DeltaU': 1, 'IA NOS': 1, 'stage IA': 1, 'CDG Ia': 1, 'congenital disorder of gylcosylation type Ia': 1, 'IA2 to': 5, 'IA2-II': 1, 'SCC IA2': 2, 'IA2-IIB1': 1, 'FIGO IA2': 1, 'FIGO Ia2': 1, 'FIGO stage Ia2': 2, 'familial infantile myasthenia': 9, 'stage IA2-IIIA': 2, 'IA from IB': 1, 'IA, IB, IC, II, and': 1, 'Familial infantile myasthenia': 6, 'stage IA2-IIA': 2, 'IA2 tumor': 2, 'ADC IA2': 1, 'Infantile myasthenia': 2, 'ocular infantile myasthenia': 1, 'FIGO2009 IA2 to': 1, 'familial myasthenia': 5, 'stage IA2-': 1, 'myasthenic episodes': 1, 'Apnea Episodes': 1, 'FIM-T': 1, 'FIM-C': 2, 'FIM+': 1, 'stage Ia2': 1, 'obstructive apnea episodes': 1, 'IA-2A': 1, 'IA2-IB': 1, 'Wee-FIM': 2, 'IA2-IIa': 1, 'autosomal recessive myasthenic syndrome with episodic apnea': 1, 'EA': 1, 'CFD Paley type 1a': 1, 'IA2-IB2 SCC': 1, 'FIGO stage IA2': 1, 'congenital presynaptic myasthenic syndrome 6': 1, 'Congenital presynaptic myasthenic syndrome 6': 1, 'Familial-Myasthenia-': 1, 'Ia2/3': 1, 'IA2 and IA3 tumors': 1, 'congenital, 1A': 1, 'IA2 MIC': 1, 'FIMG': 1, 'Myasthenic syndrome, congenital, 6, presynaptic 18': 1, 'dysfunction on motor FIM': 1, 'familial autoimmune myasthenia': 1, 'FIM types 2 and 3': 1, 'IA2-IIB': 4, 'stage Ia2 to IIa': 1, 'pStage 0-IA2': 1, 'IA2 3': 1, 'stage IA2 to IIA': 1, 'congenital myasthenic syndrome type 1a': 1, 'FIM 48': 1, 'Congenital type 1A': 1, 'congenital, type Ia': 1, "FIM's impairment": 1, 'congenital type 0 and type Ia disease': 1, 'c-FIM': 1, 'Ia2-IIa': 2, 'FIGO IA2-IIB': 1, 'cStage IA2': 1, 'IA2 and': 1, 'FIM Cognitive': 1, 'stage Ia2-IIa': 1, 'stage IA2-IIIB': 1, 'Stage Ia2': 1, 'congenital myasthenia syndrome with episodic apnea': 1, 'IA2 to IIA': 1, 'FIGO IA2 disease': 1, 'Apnea episodes': 1, 'congenital infantile myasthenia': 1, 'IA2-1B1': 1, 'INFANTILE MYASTHENIA': 1, 'FIM-Tm': 1, 'premature myasthenia': 1, 'Congenital myasthenic syndrome with episodic apnoea': 1, 'episodic apneas': 1, 'stage IA2 tumors': 2, 'congenital myasthenic syndrome type 21 or type 6': 1, 'Congenital Myasthenic Syndrome With Episodic Apnea': 1, 'congenital myasthenic syndrome type Ia.': 1, 'congenital myasthenic syndrome type Ia': 1, 'congenital and infantile myasthenia': 1, 'of FIM': 1} | FIM |
Disease | MESH:C535761 | {'CNF': 266, 'idiopathic nephrotic syndrome': 1735, 'Idiopathic nephrotic syndrome': 337, 'congenital nephrotic syndrome': 1070, 'Congenital nephrotic syndrome': 299, 'CNS CNF': 1, 'INS': 538, 'CONGENITAL NEPHROTIC SYNDROME': 4, 'congenital nephrosis': 140, 'Idiopathic Nephrotic Syndrome': 148, 'idiopathic NS': 41, 'idiopathic nephrotic': 2, 'CNS': 198, 'Congenital nephrosis': 21, 'congenital NS': 93, 'Nephrotic 1': 1, 'Finnish-type congenital NS': 1, 'congenital and idiopathic nephrotic syndrome': 1, 'iNS': 13, 'Idiopathic NS': 23, 'Congenital Nephrotic Syndrome': 56, 'nephrotic syndrome type 19': 1, '-CNF': 7, 'INS complications': 1, 'Nephrotic syndrome type 1': 3, 'adult idiopathic nephrotic syndrome': 18, 'congenital nephrotic syndromes': 24, '(idiopathic) nephrotic syndrome': 1, 'congenital or infantile nephrotic syndrome': 13, 'idiopathic Nephrotic syndrome': 3, 'congenital and infantile nephrotic syndrome': 15, 'primary idiopathic nephrotic syndrome': 3, 'idiopathic nephrotic syndromes': 21, 'Congenital NS': 15, 'congenital or infantile NS': 8, 'acquired and congenital nephrotic syndrome': 1, 'Adult Idiopathic Nephrotic Syndrome': 2, 'congenital syphilitic nephrotic syndrome': 1, 'Congenital syphilitic nephrosis': 2, 'DISCONTINUED PROLONGED PREDNISONE THERAPY OF 2 CASES OF NEPHROTIC SYNDROME': 1, 'congenital/infantile/syndromal nephrotic syndrome': 1, 'Nephrotic Syndrome 2': 3, 'NS type 3': 1, 'Finnish-type NS': 1, 'congenital/familial nephrotic syndrome': 2, 'NPHS1': 13, 'Familial idiopathic nephrotic syndromes': 1, 'congenital nephrotic syndrome of Finnish type': 1, 'CNS congenital nephrotic syndrome': 2, 'INS Idiopathic nephrotic syndrome': 1, 'ER syndrome 3': 1, 'nephrotic syndrome?4.2': 1, 'congenital Finnish type nephrotic syndrome': 1, 'congenital/infantile nephrotic syndrome': 5, 'congenital nephrotic syndrome of Finnish': 4, 'Congenital Nephrotic Syndrome of Finnish': 1, 'Nephrotic syndrome 1': 3, 'congenital and infantile nephrotic syndromes': 5, 'Congenital or infantile nephrotic syndromes': 1, 'congenital nephrotic disorder': 1, 'CNF+': 1, 'Idiopathic Nephrotic syndrome': 6, 'Type 3 early repolarization syndrome': 2, 'nephrotic syndrome type 3': 3, 'CNF abnormalities': 1, 'Congenital Nephrotic syndrome': 2, 'congenital and infantile NS': 6, 'P.CNF.5': 1, 'P.CNF.0': 1, 'INS infected': 1, 'INS disease': 7, 'FinMajor-NPHS1': 1, 'congenital nephrotic': 3, 'type 3 nephrotic syndrome': 1, 'variety of CNS': 1, 'idiopathic refractory nephrotic syndrome': 2, 'IRNS': 1, 'Congenital and infantile nephrotic syndrome': 4, 'microcystic Finnish congenital nephrotic syndrome': 1, 'CSINS': 1, 'nephrotic syndrome.1': 3, 'CLP': 1, 'CONGENITAL NEPHROTIC': 3, 'Congenital nephrotic syndrome of the Finnish': 7, 'congenital nephrotic syndrome of the Finnish': 7, 'congenital, Finnish': 2, 'familial idiopathic nephrotic syndrome': 1, 'congenital nephrosis syndrome': 6, 'Congenital Nephrotic Syndrome of the Finnish': 1, 'CNF cysts': 1, 'CNF cyst': 1, 'congenital and acquired nephrotic syndrome': 4, 'NPHS1 associated': 1, 'Idiopathic or Primary Nephrotic Syndrome': 1, 'infantile idiopathic nephrotic syndrome': 2, 'CNS complication': 1, 'CN': 2, 'ERS type 2 or type 3': 1, 'CAM': 1, 'nephrotic syndrome 1': 2, 'Congenital and Infantile Nephrotic Syndrome': 1, 'CMV CNS': 1, 'INS.MethodsPBL': 1, 'congenital cortico-resistant nephrotic syndrome': 1, 'iNS Idiopathic nephrotic syndrome': 2, 'autosomal recessive congenital nephrotic syndrome': 3, 'nephrotic syndrome type 2': 5, 'PREDNOS) 2': 1, 'PREDNOS 2': 1, 'idiopathic nephrotic syndrome.1': 1, 'congenital nephrotic syndrome of the': 1, 'Congenital nephrotic syndrome of the': 1, 'idiopathic nephrotic syndrome of': 2, 'Congenital and familial nephrotic syndrome': 1, 'congenital nephrotic syndrome, Finnish': 2, 'nephrotic idiopathic membranous glomerulopathy': 1, 'Nephrotic Syndrome types 1 and 2': 1, 'type 3 ERS': 6, 'congenital Finnish nephrosis': 1, 'type II nephrotic syndrome': 1, 'NPHS2': 1, 'nephrotic syndrome type 1': 6, 'Nephrotic Syndrome Type 2': 1, 'Congenital nephrotic syndrome, Finnish': 1, 'Congenital/infantile nephrotic syndrome': 1, 'autosomal recessive nephrotic syndrome type 3': 3, 'NPHS3': 3, 'congenital NS Finnish type': 1, 'CONGENITAL AND INFANTILE FORMS OF THE NEPHROTIC SYNDROME': 1, 'IDIOPATHIC NEPHROTIC SYNDROME': 1, 'type 3 early repolarization syndrome': 1, 'Nephrotic syndrome type 2': 1, 'ERS type 3': 1, 'rare Mendelian disorder Nephrotic syndrome type 1': 1, 'idiopathic nephrotic syndrom': 2, 'congenital Finnish type': 2, 'congenital Finnish': 2, 'microcystic congenital nephrotic syndrome': 1, 'Congenital mesangioproliferative nephrotic syndrome': 1, 'congenital Nephrotic syndrome': 1, 'infantile-congenital NS': 1, 'nephrotic syndrome.2': 1, 'Congenital and infantile NS': 2, 'Congenital nephrotic syndrome of Finnish': 2, 'congenital nephrotic syndrome': 1, 'type 3 early ventricular repolarization syndrome': 1, 'congenital nephrotic syndrome (type 5': 1, 'FCNS': 4, 'INS-R': 1, 'primary congenital nephrotic syndrome': 1, 'CNS involvement': 1, 'A4-CNF': 1, 'TC-CNF': 1, 'Nephrotic syndrome, type 19': 1, 'TO-CNF': 1, 'INS bout': 1, 'nephrin': 1, 'congenital and childhood nephrotic syndrome': 1, 'Congenital nephrotic syndromeq': 1, 'nephrotic syndromes 1': 1, 'congenital nephrotic syndrome (NPHS) gene 1': 1, 'congenital infantile nephrosis': 1, 'Deficiency of nphs1': 1, 'Reminiscent of Congenital Nephrotic Syndrome': 1, 'congenital or idiopathic nephrotic syndromes': 1, 'INF CNF': 1, 'nephrotic syndrome, type 3': 1, 'congenital nephrotic syndrome Finnish': 1, 'congenital nephritic syndrome Finnish': 1, 'congenital Nephrotic Syndrome': 1, 'Nephrotic-2': 1, 'nephrotic- 1': 1, 'nephrotic-2': 1, 'NS-1': 1, 'Congenital nephrosis of the Finnish type': 4, 'GCDNS': 1, 'genetic defects of CNS': 1, 'nonsyndromic CNS': 2, 'isolated congenital NS': 1, 'Congenital Nephrotic Syndrome (CNS) disease': 1, 'idiopathic membranous nephrotic syndrome': 1, 'Finnish type nephrotic syndrome': 1, 'CNF-CDT': 1, 'congenital, Finnish type': 2, 'idiopathic nondiabetic nephrotic syndrome': 1, 'CNS of Finnish type': 1, 'congenital and familial nephrotic syndromes': 1, 'Congenital glomerulonephritis with nephrotic syndrome': 1, 'isolated CNS': 2, 'CNS phenotype': 1, 'Congenital nephrotic syndrome 1': 1, 'acquired idiopathic nephrotic syndrome': 1, 'Fanconi type nephrotic syndrome': 1, 'FRCM': 3, 'congenital and secondary nephrotic syndromes': 1, 'congenital (CNS), infantile, and childhood-onset NS': 1, 'a-CNF': 1, 'Finnish type of CNS': 1, 'male Nephrotic syndrome Finnish type': 1, 'congenital nephrotic syndorome': 1, 'CNS of the Finnish': 2, 'NPHS1-related disease': 1, 'Type 3 ERS': 2, 'CONGENITAL NEPHROSIS': 2, 'Nephrotic syndrome 3': 2, 'idiopathic corticosteroid nephrotic syndrome': 1, 'nephrotic idiopathic syndromes': 1, 'PAEC;CNF-1': 1, 'congenital nephrosis disorder': 1, 'autosomal recessive congenital NS': 1, 'congenital nephrosis of the Finnish': 1, 'congenital Finnish nephropathy': 2, 'ERS type 1 ERS type 2 ERS type 3': 1, 'congenital and infectious nephrotic syndrome': 1, 'Finnish congenital nephrosis': 1, 'Congenital nephrotic syndrome with': 1, 'congenital Finnish nephritic syndrome': 1, 'nephrotic syndrome, Type 1': 1, "'Idiopathic' nephrotic syndrome": 1, 'congenital nephrotic disease': 1, 'congenital nephrotic syndrome of finnish type': 1, 'MAC': 1, 'MAC membrane': 1, 'NS type 1': 1, 'Congenital Nephrotic Syndromes': 1, 'congenital and acquired NS': 1, 'congenital and idiopathic NS': 1, 'CNF stenosis': 1, 'CNS-related complication': 1, 'INS infection': 1, 'CNS)': 1, 'congenital nephrosis of the': 1, 'nephrosis 1, congenital, Finnish type': 1, 'ECC Type 3': 1, 'congenital finnish nephrosis': 1, 'Idiopathic Relapsing Nephrotic Syndrome': 1, 'Idiopathic NEphrotic syndrome': 1, 'CNS finish type and II': 1, 'CNS finish': 1, 'NPHS1-nepropathy': 1, 'NSFT': 1, 'INS Idiopathic Nephrotic Syndrome': 1, 'INS lesions': 1, 'congenital or secondary NS': 1, 'congenital or/ infantile nephrotic syndrome': 1, 'congenital-infantile nephrotic syndrome': 1, 'CNS - congenital nephrotic syndrome': 1, 'congenital nephrotic syndrome type 1': 1, 'congenital nephrotic syndrome type 2': 1, 'idiopathic nephrotic syndrome with focal glomerulosclerosis': 1, 'ERS.3': 1, 'congenital or infantile nephrosis': 1, 'INS idiopathic nephrotic syndrome': 1, 'INS.MethodsPuromycin aminonucleoside': 1, 'congenital nephrotic syndrome Finnish-': 1, 'Congenital Finnish nephritic syndrome Nephrin': 1, 'Nephrotic-nephritic syndrome 2': 1, 'NephroT:1': 1, 'congenital NS CUBN': 1, 'congenital or familial nephrotic syndrome': 1, 'nephrotic syndrome type-2': 1, 'nephrotic syndrome type-1': 1, 'nephrotic congenital syndrome': 1, 'cNS': 1, 'Congenital and Infantile NS': 1, 'congenital/infantile NS': 2, 'Congenital nephrotic syndrome': 1, 'nonsyndromic congenital nephrotic syndrome': 1, 'CNS died': 1, 'Congenital nephrotic syndrome': 1, 'congenital or infantile nephrotic syndromes': 1, 'Congenital Finnish nephrosis': 1, 'Chronic glomerulonephritis of nephrotic type': 1, 'congenital/family nephrotic syndromes': 1, '(congenital) nephrotic syndrome': 1, 'IINS': 1, 'Kidney Idiopathic nephrotic syndrome': 1, 'Congenital syphilis with nephrotic syndrome': 1, 'ins': 1, 'CNS and': 1, 'CNS complications': 1, 'of CNS': 1, 'congenital nephrotic syndrome of the finnish': 1, 'Relapsing Idiopathic Nephrotic Syndrome': 1, 'familial congenital nephrotic syndrome': 1, 'congenital nephrotic syndrome type 3': 1, 'congenital nephrotic syndrome of Finland': 1, 'nephrotic syndrome, type 1': 1, 'CNS-F': 1, 'Congenital nephrotic syndrome of the Finnish type': 1, 'congenital nephrotic syndrome of the Finnish type': 1, 'Familial idiopathic nephrotic syndrome': 1, 'Congenital nephrotic syndromes': 1, 'Congenital and infantile nephrotic syndromes': 1, '-type early': 1, 'Nephrotic syndrome, type 2': 1, 'SRNS type 3': 1, 'idiopathic Nephrotic Syndrome': 1, 'CNS disease': 1} | idiopathic nephrotic syndrome |
Disease | MESH:C535762 | {'congenital pseudoarthrosis': 61, 'Congenital Pseudoarthrosis of the Tibia and Fibula': 1, 'congenital pseudoarthrosis of the tibia and fibula': 2, 'Congenital pseudoarthrosis of the tibia and fibula': 1, 'congenital pseudoarthrosis of the tibia': 46, 'Congenital pseudoarthrosis of the clavicle': 23, 'congenital pseudoarthrosis of the clavicle': 20, 'Congenital pseudoarthrosis': 10, 'Congenital pseudoarthrosis of the radius': 2, 'congenital pseudoarthrosis of clavicle': 2, 'Congenital pseudoarthrosis of the tibia': 23, 'CPT': 26, 'type IV CPT': 1, 'CPT Crowford type IV': 1, 'Crawford type IV CPT': 1, 'Congenital Clavicular Pseudoarthrosis': 1, 'Congenital clavicular pseudoarthrosis': 2, 'Congenital pseudoarthrosis of tibia and fibula': 1, 'Congenital pseudoarthrosis of the leg': 3, 'congenital pseudoarthrosis of tibia': 11, 'hypertrophic CPT': 1, 'Congenital pseudoarthrosis of the forearm': 1, 'congenital pseudoarthrosis of both the radius and ulna': 1, 'dysplastic congenital pseudoarthrosis': 1, 'congenital pseudoarthrosis of the clavicles': 1, 'CPT lesion': 1, 'Congenital Pseudoarthrosis of the Tibia': 3, 'congenital pseudoarthrosis of the fibula': 2, 'congenital pseudoarthrosis of': 1, 'congenital pseudoarthrosis tibia': 1, 'Congenital pseudoarthrosis tibia': 2, 'Boyd type IV congenital pseudoarthrosis of the tibia': 1, 'congenital pseudoarthrosis of the radius': 2, 'Boyd type-I congenital pseudoarthrosis of the tibia': 1, 'Congenital Pseudoarthrosis of the Clavicle': 3, 'congenital pseudoarthrosis of the left tibia': 1, 'Congenital bilateral pseudoarthrosis': 1, 'congenital pseudoarthrosis of the lower leg': 1, 'Congenital Tibial Pseudoarthrosis': 2, 'congenital pseudoarthrosis of the hip': 1, 'Congenital Pseudoarthrosis of the tibia': 1, 'Congenital Pseudoarthrosis': 4, 'Congenital bowing and pseudoarthrosis of the tibia': 1, 'congenital pseudoarthrosis of the shin bones': 1, 'anterolateral bowing of CPT': 1, 'Congenital pseudoarthrosis of tibia': 2, 'congenital pseudoarthrosis of the shin': 1, 'congenital and acquired pseudoarthrosis': 1, 'Congenital lower leg pseudoarthrosis': 1, 'congenital pseudoarthrosis of the right clavicle': 1, 'congenital clavicular pseudoarthrosis': 1, 'congenital pseudoarthrosis of the clavicula': 1, 'congenital pseudoarthrosis of the': 1, 'Tibial congenital pseudoarthrosis': 1, 'congenital pseudoarthrosis of the right tibia': 1, 'CPT of the': 1, 'Congenital clavicle pseudoarthrosis': 1, 'congenital clavicle pseudoarthrosis': 1, 'Congenital pseudoarthrosis of the ulna': 1, 'congenital pseudoarthrosis of the left radius': 1, 'atrophic or congenital pseudoarthrosis': 1, 'Congenital pseudoarthrosis of clavicle': 2, 'congenital pseudoarthrosis of the leg': 2, 'congenital pseudoarthrosis of tibiae': 1, 'Congenital clavicula pseudoarthrosis': 1, 'congenital clavicula pseudoarthrosis': 1, 'Congenital pseudoarthrosis of clavicula': 1, 'congenital pseudoarthrosis of the femur': 1, 'congenital pseudoarthrosis of the medial malleolus': 1, 'CONGENITAL PSEUDOARTHROSIS': 2, 'congenital tibial pseudoarthrosis': 6, 'congenital radius pseudoarthrosis': 1, 'Congenital Tibia Pseudoarthrosis': 1, 'CPT type 2': 1, 'CPT type': 1, 'Congenital tibial pseudoarthrosis': 1, 'Congenital Pseudoarthrosis of tibia': 1, 'Congenital forearm pseudoarthrosis': 1, 'Congenital metacarpal pseudoarthrosis': 1, 'Paley type 2A CPT': 1, 'Paley type 1 and 2 CPT': 1, 'Congenital Pseudoarthrosis of Medial Malleolus': 1, 'Congenital pseudoarthrosis tibia with': 1, 'CPT of long bones': 1, 'Congenital Pseudoarthrosis Tibia': 1} | congenital pseudoarthrosis |
Disease | MESH:C535764 | {'CHORIONIC GONADOTROPIN': 10, 'gonadotropin deficiency': 684, 'gonadotropin secretion': 7, 'deficiency of gonadotropins': 14, 'gonadotropin-subunit-': 1, 'pituitary gonadotropin deficiency': 9, 'gonadotropin': 89, 'Gonadotropin deficiency': 91, 'hCG-producing tumors': 5, 'hCG-producing tumor': 2, 'gonadotropin abnormalities': 16, 'gonadotropin deficiency or dysfunction': 2, 'gonadotropin-secreting tumors': 8, 'c-IVF': 2, 'gonadotropin-dependent premature puberty': 1, 'deficiency of hCG': 1, 'hCG deficient': 1, 'abnormal gonadotropin secretion': 9, 'gonadotropin-deficient': 23, 'PMS pregnant mare serum gonadotropin': 1, 'gonadotropin (Gn) deficiency': 8, 'gonadotropin (LH/FSH) deficiency': 2, 'Gonadotropin abnormalities': 3, 'gonadotropin deficiencies': 64, 'gonadotropin-dependent': 2, 'gonadotropin metabolism disorder': 1, 'exogenous gonadotropin': 1, 'GONADOTROPIN': 17, 'TREATMENT OF GONADOTROPIN-DEPENDENT': 1, 'gonadotropin-': 9, 'CONCENTRATIONS OF SERUM hCG': 1, 'gonadotropin adenomas': 11, 'deficiency of gonadotropin-releasing factor': 1, 'gonadotropin hormone': 2, 'gonadotropin disorders': 2, 'gonadotropin dysfunctions': 1, 'suppression of gonadotropin secretion': 14, 'Gonadotropin Deficiency': 12, 'THEORETICAL CHARACTERISTICS OF CHORIONIC GONADOTROPIN': 1, 'gonadotropin dysfunction': 9, 'hypopulsatile gonadotropin secretion': 1, 'gonadotropin deficit': 5, 'hMG': 25, 'deficient gonadotropin secretion': 3, 'gonadotropins deficiency': 8, 'GD': 5, 'GONADOTROPINS': 28, 'PITUITARY GONADOTROPIN': 3, 'hypogonadotropic eunuchoids': 2, 'Gonadotropin deficiencies': 4, 'hCG-secreting tumors': 13, 'of gonadotropin secretion': 4, 'gonadotropin-subunit-positive adenomas': 1, 'suppression of pituitary gonadotropin': 2, 'IMMUNOLOGICAL STUDIES ON CHORIONIC GONADOTROPINS': 2, 'CG': 11, 'deficient hyperglycosylated hCG': 1, 'gonadotropin function': 1, 'disorders of gonadotropin secretion': 1, 'pituitary gonadotropin': 4, 'pituitary gonadotropins': 2, 'abnormalities of gonadotropins': 1, 'PMSG': 1, 'pregnant mare serum gonadotropin': 2, 'IGD': 3, 'idiopathic gonadotropin deficiency': 3, 'gonadotropin secretion abnormalities': 4, 'suppression of gonadotropin': 6, 'suppression of gonadotropins': 8, 'HUMAN CHORIONIC GONADOTROPIN HORMONE VALUES': 1, 'gonadotropin deficiency syndromes': 1, 'GONADOTROPIN TRAFFICKING': 1, 'gonadotropins': 16, 'Gonadotropins': 1, 'FIGD': 11, 'gonadotropin deficients': 1, 'hCG-secreting tumor': 7, 'Human chorionic gonadotropin-secreting tumors': 1, 'Gonadal and extragonadal hCG-secreting tumors': 1, 'GONADOTROPIN STUDIES': 1, 'gonadotropin-releasing deficiency': 3, 'gonadotropin-deficient hypogonadal': 5, 'and gonadotropins (': 1, 'gonadotropin disorder': 3, 'GONADOTROPIN SYNTHESIS': 1, 'THE INDICATION FOR GONADOTROPIN THERAPY IN': 1, 'GTHs': 1, 'gonadotropin-related disorders': 1, 'gonadotropin and': 1, 'dysfunction of gonadotropin': 1, 'EFFECTS OF CHORIONIC GONADOTROPIN': 1, 'gonadotropins deficiencies': 4, 'Gn-PRLoma': 1, 'of gonadotropins': 3, 'deficiency of the gonadotropin axis': 1, 'ANTIBODIES TO HUMAN CHORIONIC GONADOTROPIN': 1, 'gonadotropin suppression': 4, 'Menopur': 1, 'HCG': 5, 'and gonadotropin-': 1, 'abnormal gonadotropin/gonadal hormone secretion': 1, 'gonadotropin secreting tumor': 3, 'GONADOTROPIN EXTRACTS': 1, 'human chorionic gonadotropin': 9, 'hMG disability': 1, 'Hypogonadotropic eunuchoidism': 2, 'ectopic human chorionic gonadotropin': 3, 'ectopic hCG': 1, 'Gn': 4, 'inhibition of gonadotropin secretion': 1, 'GRI': 1, 'Gonadotropin dysfunction': 2, 'abnormalities of gonadotropin': 1, 'Gn deficiency': 6, 'hypogonadotropic hypogonadism 12': 1, 'pituitary suppression of gonadotropin secretion': 1, 'hypogonadotropic eunuchoidism': 8, 'POTENTIATED CHORIONIC GONADOTROPIN': 1, 'GnRF': 2, 'gonadotropin deficient': 7, 'FGAs': 1, 'gonadotropin (LH, FSH) deficiencies': 1, 'low gonadotropin': 1, 'GnD': 6, 'Tonic gonadotropin': 2, 'Intracranial hCG-secreting tumors': 1, 'human chorionic gonadotropin-secreting tumors': 3, 'gonadotropin-producing tumors': 5, 'HCG abnormality': 1, 'gonadotropin-deficient puberty': 1, 'deficiency of gonadotropin': 3, 'EFFECT OF CHORIONIC GONADOTROPIN': 2, 'LHP': 1, 'GONADOTROPINS EXTRACTED FROM THE URINE': 1, 'CGB types I and II': 1, 'Gn dysfunction': 1, 'gonadotropin deficits': 3, 'gonadotropin and testosterone deficiencies': 1, 'INVESTIGATION OF CHORIONIC GONADOTROPIN': 1, 'Ectopic gonadotropin syndrome': 1, 'HUMAN CHORIONIC GONADOTROPIN': 12, 'human chorionic gonadotropin producing tumor': 1, 'Abnormalities in gonadotropin secretion': 1, 'gonadotropin, adrenocorticotropic hormone and': 1, 'CONTROL OF GONADOTROPIN SECRETION': 1, 'gonadotropin releasing': 1, 'gonadotropin excess': 2, 'Hypergylcosylated hCG': 1, 'human chorionic gonadotropin (HCG)-producing tumors': 1, 'human chorionic gonadotropin-producing tumors': 3, 'of gonadotropin': 4, 'Human chorionic gonadotropin': 1, 'Disorders of gonadotropin hormone synthesis': 1, 'gonadotropin deficiency syndrome': 1, 'GND': 1, 'suppression of pituitary gonadotropin secretion': 1, 'HMG': 6, 'GONADOTROPIN-': 2, 'HUMAN CHORIONIC GONADOTROPIN PATTERN': 1, 'Gonadotropin secretion disorder': 1, 'GONADOTROPIN ADMINISTRATION': 1, 'GONADOTROPINS OF UTERINE BLOOD': 1, 'gonadotropin secretion disorder': 1, 'functional gonadotropin deficiency': 1, 'suppression of cyclic gonadotropin secretion': 1, 'deficit of gonadotropins': 1, 'Gonadotropin': 5, 'Gonadotropin disorder': 2, 'human chorionic gonadotropin-secreting tumor': 3, 'CGA': 1, 'gonadotropins ectopic': 1, 'abnormality in gonadotropin secretion': 2, 'beta-hCG-producing tumors': 1, 'hCG-': 2, 'EFFECT OF CHORIONIC GONADOTROPIN ON': 1, 'gonadotropin disturbances': 1, 'gonadotropin-producing tumor': 2, 'gonadotropin-deficient hypopituitary': 1, 'gonadotropin (Gn) deficit': 1, 'deficit of Gn': 1, 'deficiency of human chorionic gonadotropin': 1, 'IDIOPATHIC HYPOGONADOTROPIC EUNUCHOIDISM': 1, 'HH12-13': 1, 'gonadotropin hypogonadism': 3, 'eCG': 1, 'cIVF': 3, 'Intracranial human chorionic gonadotropin producing tumors': 1, 'GONADOTROPIN RELEASING MECHANISM': 1, 'and gonadotropin-deficient': 1, 'familial hCG syndrome': 7, 'human chorionic gonadotropin (hCG)-producing tumors': 1, 'gonadotropin secreting tumors': 2, 'IPC': 1, 'Familial hCG syndrome': 4, 'hCG syndrome': 1, 'Congenital gonadotropin deficiency': 1, 'congenital gonadotropin deficiency': 6, 'CGD': 1, 'MENOPAUSAL GONADOTROPIN': 1, 'Deficiency of gonadotropin-releasing factor': 1, 'URINARY CHORIONIC GONADOTROPINS': 1, 'gonadotropin-type hypogonadism': 1, 'CHORIONIC GONADOTROPINS': 2, 'suppression of serum gonadotropins': 1, 'AGA': 1, 'SERUM GONADOTROPINS': 1, 'PITUITARY GONADOTROPINS': 3, 'gonadotropin (LH/FSH)': 1, 'gonadotropin abnormality': 2, 'deficiencies of gonadotropin': 1, 'hypersensitivity to gonadotropin': 1, 'impaired release of gonadotropin': 1, 'deficiency of hyperglycosylated hCG': 1, 'gonadotropin secretion disorders': 3, 'EFFECT OF GONADOTROPINS': 1, 'gonadotropin (1 of 1) deficiencies': 1, 'gonadotropin (5) deficiencies': 1, 'Chorionic gonadotropin': 2, 'CAUSED BY CHORIONIC GONADOTROPIN': 1, 'Deficiencies in gonadotropins and': 1, 'IGD +': 1, 'Phantom hCG syndrome': 2, 'PLASMATIC GONADOTROPIN': 1, 'gonadotropin-positive adenomas': 1, 'absence of gonadotropin': 1, 'PREGNANT MARE SERUM GONADOTROPIN': 1, 'gonadotropin-deficiency': 3, 'HCG abnormalities': 1, 'Idiopathic isolated gonadotropin deficiency': 1, 'HP-hMG': 3, 'gonadotropin-related diseases': 1, 'gonadotropin-associated disorders': 1, 'insensitivity to gonadotropin': 1, 'Intracranial human chorionic gonadotropin-secreting tumor': 1, 'GTD': 1, 'gonadotropin adenoma': 5, 'gonadotropin tumors': 5, 'Chorionic Gonadotropin': 1, 'GDP': 1, 'gonadotropin deficiencyHyperprolactinemiaOther': 1, 'HUMAN URINARY GONADOTROPIN': 1, 'ADMINISTRATION OF CHORIONIC GONADOTROPINS': 2, 'familial gonadotropin deficiency': 1, 'Lechenie gonadotropin-nezavisimogo PPR': 1, 'gonadotropin-secreting tumor': 3, 'to gonadotropins': 2, 'CHARACTERIZATION OF ANTI-HUMAN CHORIONIC GONADOTROPIN': 1, 'CHORIONIC GONADOTROPIN LOCALIZATION': 2, 'hypersensitivity to gonadotropins': 2, 'gonadotropin allergies': 1, 'gonadotropin and adrenocorticotropic hormone (ACTH) deficiencies': 1, 'gonadotropin-related': 1, 'adrenal gonadotropin': 1, 'gonadotropin-responsive tumors': 1, 'human chorionic gonadotropin- (hCG-) secreting malignancies': 1, 'Gonadotropin adenoma': 1, 'deficiency of gonadotropin secretion': 2, 'phantom hCG syndrome': 1, 'gonadotropin-induced hypogonadism': 1, 'CLINICO-PATHOLOGICAL CORRELATION OF THE CHORIONIC GONADOTROPINS': 1, 'chorionic gonadotropin-': 1, 'AFFECT GONADOTROPIN SECRETION': 1, 'Deficiency in gonadotropin': 1, 'Gonadotropin deficiencyc': 1, 'deficiency of pituitary gonadotropins': 1, 'hCG-secreting malignancy': 1, 'hCG-secreting Tumors': 1, 'SECRETION OF GONADOTROPINS': 1, 'chorionic gonadotropin-secreting tumor': 2, 'pituitary gonadotropin suppression': 1, 'UGP': 1, 'ectopic gonadotropin secretion': 1, 'EXCRETION OF GONADOTROPINS': 1, 'gonadotropin hormone disorders': 1, 'GONADOTROPIN SIGNALLING': 1, 'deficiency of pituitary gonadotropin production': 1, 'IASe': 1, 'familial idiopathic gonadotropin deficiency': 2, 'Hypersecretion of gonadotropins': 1, 'GIS': 1, 'gonadotropin subunit-producing tumors': 1, 'impaired gonadotropin secretion': 2, 'male gonadotropin deficiency': 1, 'USE OF GONADOTROPINS': 1, 'GDPP': 1, 'gonadotropin-dependent precious puberty': 1, 'IMMUNOLOGICAL EXAMINATION OF CHORIONIC GONADOTROPINS': 1, 'gonadotropin secretion anomalies': 1, 'hypogonadal gonadotropin-deficient': 1, 'THE SECRETION OF GONADOTROPINS': 1, 'IMMUNOLOGICAL CHORIONIC GONADOTROPIN': 1, 'gonadotropin and spermatogenic suppression': 1, 'impaired secretion of gonadotropins': 1, 'bihormonal gonadotropin deficiency': 1, 'EFFECTS OF RESERPINE ON GONADOTROPIN-INDUCED OVULATION': 1, 'gonadotropin toxicity': 1, 'GONADOTROPIN STIMULATION TEST': 1, 'GONADOTROPIN REGULATION': 1, 'hypogonadotropic eunuchoid': 1, 'gonadotropin releasing tumors': 1, 'Gn deficiencies': 2, 'GnD.': 1, 'idiopathic partial gonadotropin deficiency': 1, 'congenital GnD': 1, 'congenitally gonadotropin-deficient': 2, 'LIBERATION OF GONADOTROPINS BY': 1, 'idiopathic GnRH deficiency': 1, 'human chorionic gonadotropin secreting tumors': 1, 'Gonadotropin adenomas': 1, 'HH-12': 1, 'abnormality of gonadotropin': 1, 'hCG-secreting malignancies': 1, 'hyperglycosylated hCG': 1, 'Hyperglycosylated hCG': 1, 'pituitary gonadotropin production': 1, 'GONADOTROPIN PREPARATIONS': 1, 'GnIH': 2, 'gonadotropin dysregulation': 1, 'gonadotropin-inhibitory hormone': 1, 'human chorionic gonadotropin infection': 1, 'chorionic gonadotropin': 3, 'gonadotropin defect': 1, 'hypothalamic congenital gonadotropin deficiency': 1, 'gonadotropin-dependent gonadal tumors': 1, 'GN': 2, 'gonadotropin axis dysfunction': 2, 'HH12': 2, 'human chorionic gonadotropin tumors': 1, 'GTH': 3, 'IRP-hMG': 1, 'Hyperproduction of chorionic gonadotropin': 1, 'Gonadotropin tumors': 1, 'CPP': 1, 'neonatal gonadotropin deficiency': 1, 'gonadotropin and androgen deficiencies': 1, 'disordered gonadotropin secretion': 1, 'intrauterine gonadotropin secretion': 1, 'familial hypogonadotropism': 1, 'deficiencies of gonadotropins': 1, 'hCG': 4, 'gonadotropin insensitivity': 1, 'precocious gonadotropin secretion': 1, 'GONADOTROPIN EXCRETION': 1, 'HCG-secreting tumor': 1, 'Human chorionic gonadotropin (HCG)-secreting tumors': 1, 'low secretion of gonadotropins': 1, 'of gonadotropin and gonadal': 1, 'phantom hCG': 1, 'CGT': 1, 'Gonadotropin hormone tumors': 1, 'IMMUNOLOGICAL STUDY OF CHORIONIC GONADOTROPINS': 1, 'HORMONAL CHORIONIC GONADOTROPIN': 1, 'chorionic gonadotropin-producing tumors': 1, 'gonadotropin-subunit': 1, 'gonadotropin secretion defect': 1, 'hCG-producing malignancies': 1, 'HUMAN PITUITARY GONADOTROPIN': 1, 'Hypersensitivity to hCG': 1, 'TITRATION OF HUMAN CHORIONIC GONADOTROPINS': 1, 'GT': 2, 'deficiency for gonadotropins': 1, 'hypothalamic gonadotropin deficiency': 2, 'TRANSCRIPTIONAL CONTROLS OF THE GONADOTROPIN': 1, 'GONADOTROPIN RECEPTOR-DEFICIENT MOUSE MODELS': 1, 'ectopic HCG': 1, 'occult chorionic gonadotropin-secreting tumor': 1, 'pituitary gonadotropin secretion': 1, 'of gonadotropin releasing': 1, 'Gonadotropin (Gn) deficiency': 1, 'Gn-': 1, 'Gonadotropin deficiencya': 2, 'ACTH and Gn deficiencies': 1, 'gonadotropin (Gn) deficiencies': 1, 'ACTH and gonadotropin deficiencies': 1, 'Gn-deficient': 1, 'Gn deficiencya': 1, 'CHRONIC GONADOTROPINS': 1, 'hyper-secretion of gonadotropins': 1, 'Gonadotropin-storing tumors': 1, 'gonadotropin-storing adenomas': 1, 'gonadotropin-storing tumors': 1, 'gonadotropin post-receptor': 1, 'GnIH CELLS': 1, 'GnIH ACTION': 1, 'GnIH STUDIES': 1, 'GONADOTROPINS ON': 1, 'of pituitary gonadotropin secretion': 1, 'HORMONAL RESPONSE TO CHORIONIC GONADOTROPINS': 1, 'deficiency in gonadotropins': 1, 'Deficiency of gonadotropins': 1, 'Gonadotropin-secreting macroadenomas': 1, 'suppression of gonadotropines': 1, 'Human chorionic gonadotropin (hCG': 1, 'Gonadotropin disorders': 1, 'adrenocorticotroph, and gonadotropin/nonsecreting adenomas': 1, 'gonadotropin secretary abnormalities': 1, 'PGnD': 1, 'Gonadotropin-': 1, 'gonadotropin dissociation': 1, 'gonadotropin,': 1, 'gonadotropin or nonsecreting tumors': 1, 'IMMUNOCHEMICAL CHARACTERIZATION OF HUMAN CHORIONIC GONADOTROPIN': 1, 'gonadotropin/testosterone deficiency': 1, 'impairment of gonadotropin secretion': 1, 'GONADOTROPINS SYNERGIZE WITH': 1, 'gonadotropin, adrenocorticotropic hormone (': 1, 'tumor gonadotropin': 1, 'human chorionic gonadotropins': 1, 'Familial idiopathic gonadotropin deficiency': 1, 'suppressed gonadotropin secretion': 1, 'ANTI-GONADOTROPIN': 1, 'EFFECT OF CHORIONIC GONADOTROPINS': 1, 'USE OF CHORIONIC GONADOTROPIN': 1, 'ectopic gonadotropin-producing tumors': 1, 'GnIH Fiber': 1, 'GnRG-neironov': 1, 'gonadotropin-dependent disorder': 1, 'gonadotropin hypersensitivity': 1, 'hCG tumors': 1, 'Human chorionic gonadotropin (hCG)-producing tumors': 1, 'bHCG': 1, 'gonadotropin hormone deficiency': 1} | gonadotropin deficiency |
Disease | MESH:C535765 | {'Nonnephropathic cystinosis': 1, 'nonnephropathic cystinosis': 3, 'Ocular nonnephropathic cystinosis': 1, ', nonnephropathic cystinosis': 1, 'ocular nonnephropathic cystinosis': 1, 'nonnephropathic': 1, 'ocular or nonnephropathic cystinosis': 1, 'Benign or nonnephropathic cystinosis': 1} | nonnephropathic cystinosis |
Disease | MESH:C535766 | {'short fourth toe': 4, 'syndactyly of the second, third, and fourth toes': 2, 'CZ': 13, 'Czech dysplasia': 29, 'syndactyly of the right third and fourth toes': 1, 'absence of third, fourth and fifth toes': 1, 'agenesis of third, fourth and fifth toes': 1, 'CR': 5, 'NMPC': 13, "OLD CZECH TRANSLATION OF SALICETI'S SURGERY": 1, 'CGS': 2, 'short third and fourth toes': 4, 'short third and fourth metatarsals': 1, 'czech': 4, 'Czech': 4, 'familial Czech dysplasia': 1, 'brachydactyly of the third and fourth toes': 1, 'CZECH': 8, 'precocious osteoarthritis': 4, 'CCM 7221': 1, 'deformities of the third and fourth toes': 1, 'shortness of the fourth toe': 3, 'CNC': 1, 'CS': 3, 'CULSP': 4, 'deformities of the second, third, fourth, and fifth toe': 1, 'short fourth toes': 5, 'CD': 2, 'metatarsal dysplasia': 4, 'Metatarsal dysplasia': 1, 'CNCC-AIC': 1, 'dysplasia of a midline metatarsal': 1, 'Midline metatarsal dysplasia': 1, 'CBAS': 1, 'CNCTC': 1, 'metatarsal hypoplasia of the third and fourth toes': 1, 'short third toe': 1, 'syndactyly of the third and fourth fingers or toes': 1, 'necrosis of the third and fourth toe': 1, 'czech psychiatry': 1, 'third and fourth toe gangrene': 1, 'CTU': 2, 'CENDA': 1, 'bilateral syndactyly of the third and fourth toes': 1, 'Clinodactyly of third, fourth and fifth toes': 1, 'clinodactyly of the third, fourth and fifth toes': 1, 'bilateral clinodactyly of the third, fourth and fifth toes': 1, 'CMC': 1, 'Czech Dysplasia SED': 1, 'CCM 3239': 2, 'CCM': 4, 'short left fourth toe': 1, 'Short fourth toes': 1, 'Czech dysplasia metatarsal type': 4, 'CHMI': 2, 'abnormalities of the third, fourth and fifth toes': 1, 'syndactyly of the third and fourth toes': 3, 'Shortness of third and/or fourth toes': 1, 'shortening of the third and fourth toes': 1, 'COL2 Czech dysplasia': 1, 'Dysplasia of the tarsal and the metatarsals': 1, 'third-fourth toe deformity': 1, 'CZ beetle': 1, 'CZ fly': 1, 'short fourth toe of': 1, 'CPPS': 1, 'CSR': 2, 'anomalies of Czech dysplasia': 1, 'CMRD': 3, 'CZE-': 1, 'CZE': 3, 'weakness of the third and fourth left toes': 1, 'Syndactyly of third and fourth toe': 1, 'third and fourth toe damage': 1, 'Czech Dysplasia Metatarsal Type': 1, 'syndactyly of second to third and fourth to fifth toes': 1, 'autosomal dominant precocious osteoarthritis': 1, 'Precocious osteoarthritis': 1, 'CLA': 1, 'CLWs': 1, 'fibrous dysplasia of the first metatarsal': 1, 'FD of the metatarsals and': 1, 'CZ-PL': 1, 'CAR': 1, 'CSO': 1, 'Czech Dysplasia': 2, 'syndactyly of the second, third and fourth toes': 1, 'PTC': 1, 'CZR': 1, 'fibrous dysplasia of the metatarsals': 1, 'NMI 2 - CMI B': 1, 'CSD': 1, 'Czech dysplasia metatarsal': 1, 'shortened third and fourth toes': 1, 'fourth metatarsal dysplasia': 1, 'Fourth metatarsal dysplasia': 1, 'SMOC': 1, 'syndactyly of third and fourth toes': 1, 'Syndactyly of third and fourth toes': 1, 'CHPS': 1, 'short fourth finger and toe': 1, 'Czech dysplasia, metatarsal type': 1, 'short third toes': 1, 'vesicatoria CRI': 1, 'third, fourth and fifth toe gangrene': 1, 'Massilia violaceinigra CCM 8877T': 1} | Czech dysplasia |
Disease | MESH:C535767 | {'PKD': 148, 'Kidins220 deficiency': 1, 'D-glyceric aciduria': 20, 'PRKD': 1, 'D-glyceric Aciduria': 1, 'PKD-CA': 1, 'PrKD': 1, 'PKD-deficient': 1, 'ROLE FOR PROTEIN KINASE D': 1, 'D-glycerate anaemia': 1, 'D-glyceric acidemia': 6, 'D-glyceric acidaemia': 3, 'deficiency of glycerate 2-kinase': 1, 'D-glycerate aciduria': 1, 'D-glycerate kinase deficiency': 2, 'PKDs': 2, '2PGA': 1, 'ROLES OF PKD': 1, 'D-Glyceric aciduria': 2, 'p-PKD': 3, 'Glycine - D-Glyceric acidemia Refractory localization-related epilepsy': 1, 'D-(+)-glyceric aciduria': 1, 'D-glycerate kinase': 1, 'hyper-D-glyceric acidemia': 1, 'CMK': 3, 'D-glyceric-acidaemia': 2, 'D glyceric acidemia': 1, 'D-2OHGA aciduria': 1, 'P-PKD': 1, 'D-Glyceric acidemia': 1, 'glyceric acidemia': 1, 'Deficiency of GK': 1, 'd-glycerate kinase deficiency': 2, 'd-glycerate kinase (GK) deficiency': 1, 'Deficiency of DGK': 1, 'DGA': 2, 'PakD': 1, 'CMK AS': 1, 'deficiency of D(+)-glycerate kinase': 1, 'D(+)-glyceric aciduria': 1, 'PKD inhibitors': 2, 'glyceric acidemia syndrome': 1, 'PKD deficiency': 3, 'GLYCTK': 1, 'deficiency of D-glycerate kinase': 1, 'phospho-glycerate kinase deficiency': 1, 'PKD-SE': 2, 'PKD-WT': 1, 'BPKDi': 1, 'PKD dysfunction': 2, 'D-Glyceric Aciduria': 1, 'CA-PKD': 1, 'Deficiency of human glycerate kinase': 1, 'D-glycerate acidemia': 2, 'D-glycerate anemia': 1, 'PKD-KD': 2, 'D-glyceria aciduria': 1, 'DGKD': 1, 'd-Glycerate kinase deficiency': 1, 'Phospho-glycerate mutase deficiency': 1, 'D- and L-glyceric aciduria': 1, 'deficiency of human glycerate kinase': 1, 'Deficiency of PKD': 1, 'D-MARCKS ED': 1, 'PKD-': 1, 'D-glyceric and L-glyceric acidurias': 1, 'PKDi': 1, 'PKD.SS': 1, '3PG': 1, 'D-2HG aciduria': 1, 'D-glycerate kinase D-glyceric aciduria': 1} | PKD |
Disease | MESH:C535769 | {'borer': 302, 'borer pests': 5, 'emerald ash borer': 120, 'borer damage': 7, 'flatheaded borer': 2, 'Flatheaded borer': 1, 'flatheaded borer injury': 1, 'borers': 134, 'coffee borer': 5, 'Pod borer': 9, 'pod borer': 118, 'fruit borer': 25, 'fruit and shoot borer': 7, 'ESB': 1, 'stalk borer': 16, 'shoot borer': 16, 'SB': 2, 'grain borer': 22, 'ash borer': 30, 'cork borer': 7, 'legume pod borer': 6, 'Emerald Ash Borer': 26, 'CPB': 4, 'Newcomer 1-2': 1, 'EAB': 61, 'Emerald ash borer': 52, 'brinjal fruit and shoot borer': 1, 'Borer': 15, 'pulse pod borer': 1, 'Brinjal fruit and shoot borer': 2, 'poplar borer': 1, 'lentil pod borer': 1, 'Lentil pod borer': 1, 'MARINE BORER': 1, 'litchi fruit borer': 1, 'sugarcane borer': 13, 'goldspotted oak borer': 6, 'and fruit borer': 5, 'and Fruit Borer': 1, 'citrus fruit borer': 3, '-borer': 8, 'sugarcane borer damage': 1, 'Sugarcane borer': 9, 'borer injury': 3, 'stem borer damage': 9, 'emerald ash borer beetle': 1, 'marine borer': 1, 'tomato fruit borer': 1, 'dogwood borer': 8, 'LGB': 2, 'tomato borer': 1, 'Lymphedema hypoparathyroidism': 1, 'Gram pod borer': 4, 'turpentine borer': 1, 'pod-borer': 3, 'shoot and fruit borer': 4, 'date fruit stalk borer': 1, 'Fruit stalk borer': 1, 'fruit stalk borer': 1, 'Fruit Stalk Borer': 1, 'fruit/shoot borer': 1, 'NS': 1, 'emerald ash borers': 2, 'ash borers': 1, 'pod borer complex': 2, 'oak borer': 2, 'mahogany shoot borer': 4, 'Dogwood borer': 1, 'gram pod borer': 10, 'twig borer': 3, 'FOB': 1, 'weevil borers': 1, 'Weevil borers': 1, 'weevil borer': 2, 'Stem borer damage': 1, 'borer beetle': 3, 'fruit and shoot borers': 1, 'helicoverpapod borer': 1, 'Pod borers': 2, 'FSB': 3, 'pod borer damage': 2, 'Weevil borer': 1, 'WB': 1, 'borer pest': 6, 'borer attack': 1, 'fruit borers': 12, 'palm borers': 1, 'Lymphedema-hypoparathyroidism syndrome': 1, 'Cladode borer': 1, 'trunk borer pest': 1, 'borer beetles': 2, 'SGB': 2, 'SPB': 4, 'earth-borer': 1, 'corm borer': 1, 'brinjal shoot and fruit borer': 5, 'borer-': 1, 'againstpod borer': 1, 'SCB': 2, 'SCB injury': 1, 'GSOB': 1, 'stem borer disease': 1, 'Cork borer': 2, 'and shoot borer': 1, 'Dahlberg-Borer-Newcomer syndrome': 1, 'pseudostem borer': 1, 'Fruit borer': 2, 'Fruits borer': 1, 'borer caterpillar': 1, 'stalks borer': 1, 'longhorned borer': 1, 'pea borer': 1, 'scolityne borers': 1, 'Shoot and fruit borer': 2, 'Borer Damage': 2, 'sugarcane borer injury': 1, 'Emerald Ash borer': 1, 'SFB': 1, 'Citrus borer': 1, 'Branch borers': 1, 'cob borer': 1, 'Stalk borer': 2, 'eggplant fruit and shoot borer': 5, 'EFSB': 3, 'Eggplant Fruit and Shoot Borer': 1, 'LPB': 3, 'fruit borer of brinjal': 1, 'pea pod borer': 1, 'BSFB': 1, 'Maize Stalk Borer': 1, 'stalk borers': 3, 'Shothole borer': 1, 'BFSB': 2, 'Sugarcane Borer': 1, 'leaf borers': 1, 'pod borers': 5, 'Pod Borer Complex Damage': 1, 'Pod Borer': 2, 'Borer Complex Damage': 1, 'Crock borer': 1, 'plum borer': 1, 'common stalk borer': 3, 'trunk borer': 3, 'borer attacks': 1, 'pod borer beetle': 1, 'pod borer/bollworm': 1, 'Stalk borers': 1, 'giant borer': 1, 'CSB': 1, 'Cornstalk borer': 1, 'CSB injury': 1, 'Early shoot borer': 1, 'Internode borer': 1, 'beetle borer': 1, 'Peachtree Borer': 1, 'CORN BORER': 1, 'earth-borer beetle': 1, 'vine borer': 1, 'Legume pod borer': 1, 'noctuid borer': 1, 'eggplant fruit borer': 1, 'leaf borer': 1, 'CWSB borer': 1, 'Striped borer': 1, 'striped borer': 1, 'linden borer': 1, 'squash borer': 1, 'MSB injury': 1, 'MSB': 1, 'stalk borer injury': 1, 'borer worm': 1, 'Guava borer worm': 1, 'guava borer worm': 1, 'NC': 1, 'leaf crown borer': 1, 'borer parasitoid': 1, 'mulberry borer': 1, '-lined borer': 1, 'Borers': 1, 'lined borer': 1, 'large grain borer': 1, 'shoot borers': 1, 'internodes borer': 1, 'Newcomer': 1, 'pod borer-resistant': 1, 'stem-borer damage': 1, 'fruit tree borer': 1} | borer |
Disease | MESH:C535772 | {'Dandy-Walker variant/malformation': 2, 'Dandy-Walker variant': 58, 'DWV': 16, 'Dandy-Walker variant malformation': 5, 'Dandy Walker variant': 4, 'Dandy-Walker Variant': 15, 'Dandy-Walker variant with precocious puberty': 1, 'Dandy walker variant': 2, 'Dandy Walker Variant': 3, 'Dandy-Walker variant syndrome': 4, 'Dandy-Walker variant anomaly': 1, 'Dandy-Walker variant and malformation': 1, 'Dandy-Walker variants': 3, 'Dandy-Walker variant disorder': 3, 'Dandy -Walker variant malformation': 1, 'Dandy-Walker (DW) variant malformation': 1, 'Dandy-Walker variant 1': 1, 'Dandy-Walker variant/': 1, 'DWv': 2, "Dandy-Walker's variant": 1, 'WALKER VARIANT': 1, 'Dandy-Walker variant cist': 1, 'D-WV': 1, 'Dandy-Walker variant with intellectual disability': 1, 'Dandy-Walker variant cystic malformation': 1, 'DWM variant': 1, 'Dandy Walker variant anomaly': 1, 'Dandy-Walker-variant': 1} | Dandy-Walker variant |
Disease | MESH:C535773 | {'PGS': 144, 'X-linked syndromic mental retardation 5': 1, 'Fried syndrome': 17, 'MRXS5': 2, 'Pettigrew syndrome': 18, 'Fried/Pettigrew': 1, 'fried rice syndrome': 6, 'Fried': 266, "Fried's": 80, 'DSM-5 neurodevelopmental disorder': 1, 'mental retardation type 5': 5, 'FRIs': 58, 'HFF': 1, 'MRD5': 8, 'Pettigrew Syndrome': 2, 'mental illness;5': 1, 'KF': 11, "Fried's phenotype": 6, 'DSM-5-TR': 1, 'fries': 1, 'mental illness.4,5': 1, 'ASD-PGS': 1, 'of Fries': 1, 'deep-fried meat': 1, 'Deep-Fried Meat': 1, 'FrI': 2, 'X chromosome-linked mental retardation and epilepsy 5': 1, 'FRIED': 17, 'MFC': 3, 'WOF': 1, 'mental illness.5': 4, 'fried sausage': 2, 'reduced power of 2/5': 1, "Fries' knees": 1, 'carp fries': 1, 'AD mental retardation 5': 1, 'fried': 9, 'HT': 1, 'Fries Rearrangements': 1, 'pPGS': 3, 'mPGS': 1, 'Fried rice syndrome': 3, '-PGS': 1, 'X;21;19;4': 1, 'FP': 19, 'Fried hovenia': 1, 'sweetpotato fries': 1, 'Phospho-Fries Rearrangement': 1, 'IF': 1, 'fried rice disease syndrome': 1, 'congenital with or without mental retardation, type B, 5': 1, 'NDD,5': 1, 'PGS.LD': 1, 'DEEP FRIED READYTO-EAT FOOD': 1, 'Fried sweetpotato root': 1, 'Fimpa dig fri': 2, 'Stefan Fries': 1, 'Fried phenotype': 6, 'phospho-Fries rearrangements': 1, 'Phospho-Fries Rearrangements': 1, 'sturgeon fries': 1, 'chunk fries': 1, 'fried sweetpotato': 1, 'Fried sweetpotato': 2, 'fRI': 1, 'mental problems.5': 1, 'MAND': 3, 'PGS-1': 1, 'PGS-2': 1, 'IVF-PGS': 1, 'MRD-5': 1, 'fried bacon': 1, 'AMI 5': 1, 'PGS- carcinoma': 1, 'MBD5-Associated Neurodevelopmental Disorder': 1, 'MBD5-associated neurodevelopmental disorder': 1, 'DSM-5 mental illness': 1, 'Fried-Pettigrew syndrome': 1, 'BFF': 1, 'Sweetpotato French fries': 1, 'Mental and Behavioural 5': 1, 'PGS-SZ': 1, 'NON-FRIED VEGETABLES': 2, 'Hakka stir-fried green tea': 2, 'HSGT': 2, 'DFS': 1, 'Elias Fries': 2, 'Fries': 6, "Fries's": 1, 'epimedium fried': 1, 'Epimedium Fried': 1, 'FrI dysfunction': 1, 'Pettigrew': 1, 'fried food': 2, 'DIA-X-5 symptoms': 1, 'Ortho-Fries Rearrangement': 1, 'ortho-Fries rearrangement': 1, 'OBSERVATION.fried': 1, 'Fried Biologic Syndrome': 1, 'fried foods': 2, 'mFI': 1, 'FRIED-Q': 1, 'Snieckus-Fries-Type Rearrangement': 1, 'irritable bowel11.5': 1, 'neurodevelopmental disabilities.5': 1, 'crunchy fried locusts': 1, 'Mental retardation-type 5': 1, 'mental illness"5': 1, "Fried's FPs": 1, 'PGS type 1': 1, 'Neurodevelopmental PGS': 1, 'neurodevelopmental PGS': 1, 'fries the brain': 1, 'Fried-Oken Augmentative and alternative': 1, 'AF': 2, 'DFSM': 1, 'DF': 2, 'deep-fried shrimp': 1, 'Deep-Fried Croquettes': 1, 'LUAD-PGS': 1, 'GBM-PGS': 1, 'LUSC-PGS': 1, "Crohn's PGS": 1, '5 Mental state': 1, 'Fried noodles': 1, 'fried nail syndrome': 1, 'hand irritation.5': 1, 'Snieckus-Fries Rearrangement': 2, 'Fries Bake 2': 1, 'fri': 2, 'MFP': 1, 'Fried-type X-linked mental retardation': 1, 'Tree Fruits Fried': 1, 'PGSSCZ': 1, 'sugar-glazed fried sweetpotato': 1, 'DSM-5 neurodevelopmental disorders': 2, 'neurodevelopmental and neurocognitive impairments.5': 1, 'RAR': 1, 'Fries Rearrangement': 2, 'N. ceranae infections': 1, 'N. ceranae infection': 1, 'HAF': 1, 'SCZ-PGS': 1, 'Fried or Pettigrew syndrome': 1, 'Fried/Pettigrew syndromes': 1, 'Mental Retardation type 5': 1, 'PGS-S': 2, 'cutaneous irritation.5': 1, 'PGS III': 1, 'PGS II and III': 1, 'PGS/2019': 1, 'french fries': 2, 'iPGS': 1, 'AIS': 1, 'MRX59': 1, 'SCFS': 1, 'Fried symptoms': 1, 'Achkar and Fries': 1, 'fries fried': 1, 'Hulten & Fries': 1, 'fried rice"': 1, 'R.E. Fries': 1, 'fried falafel': 1, "Fried' s": 1, 'Chips and Fries': 1, 'Fried Debilitating': 1, 'Neurodevelopmental Disorders 5 (1)': 1, 'Snieckus-Fries Rearrangements': 1, 'Stir-Fried Green Tea': 1, 'Mental Retardation- Type 5': 1, 'DSM 5 mental illness': 1, 'Fried-Pettigrew Syndrome': 1, 'Mental Retardation-Type 5': 1, 'sterlet fries': 1, 'bacillus-cereus-fried-rice-syndrome.html': 1, 'Theodor Fries': 1, 'RPGLD': 1, 'PGS/2019/18': 1, 'fried V': 1, 'Fried Tilapia': 1, 'fried catfish': 1} | Fried |
Disease | MESH:C535775 | {'facial and scapular anomalies': 1, 'IIID': 1, 'Mild dysplasia': 2, 'mGD': 1, 'MiD': 6, 'mild dysplasia': 4, 'MID': 3, 'ectocervical mild dysplasia': 1, 'scapular anomalies': 2, 'mD': 7, 'BMD': 1, 'and mild dysplasia': 1, 'CIN I, II, III': 1, 'CIN I, II, III,': 1, 'CIN I-II': 1, 'CIN I': 2, 'MM': 1, 'oral mild dysplasia': 1, 'MiD lesion': 1, 'scapular anomaly': 3, 'rib, pectus, and scapular anomalies': 1, 'Md': 1, 'mmDP': 1, 'Adenomatous gland Mild dysplasia': 1} | mD |
Disease | MESH:C535776 | {'HET ES': 1, 'HET': 139, 'HETEROZYGOUS INDIVIDUALS': 1, 'HeFH': 68, 'Pich Het': 1, 'HZ': 22, 'HET-GOF': 1, 'WZS': 15, 'HT': 129, 'Thibierge-Weissenbach syndrome': 44, 'DCVs': 1, 'cHet': 2, 'Heterozygous familial hypercholesterolaemia': 31, 'Thibierge and Weissenbach syndrome': 4, 'Weissenbacher-Zweymuller syndrome': 24, 'HTZ': 14, 'HE': 17, 'HETEROZYGOUS MUTATION': 1, 'Weissenbacher-Zweymuller': 4, 'Weissenbacher Zweymuller syndrome': 1, 'HE]:[GP': 1, 'HE]:[HN': 1, 'heterozygous familial hypercholesterolaemia': 9, 'HT-P': 1, 'HT-': 1, 'TTNtv': 1, 'NHL': 1, 'heCNL': 1, 'OSMEDA': 3, 'HF': 1, 'HetEM': 3, 'heFH': 6, 'HBT': 2, 'Thibierge-Weissenbach': 1, 'AT': 1, 'Thibierge-Weissenbach type scleroderma': 1, 'CT': 2, 'HT,11': 1, 'HBTs': 1, 'heterozygous-thalassaemia syndromes': 1, 'HETEROZYGOUS PROINSULIN MUTATIONS': 1, 'beta - heterozygous thalassaemia': 1, "Zweymuller's Bicon cup": 1, 'Thiberge-Weissenbach syndrome': 3, 'congenital heterozygous deficiency': 1, 'Thibierge-Weissenbachs syndrome': 1, 'heterozygous autosomal dominant disorder': 1, 'HETs': 1, 'HNCNs': 1, 'generalized scleroderma of the Thibierge-Weissenbach type': 1, 'HRM': 7, 'HeD': 1, 'HMSD': 1, 'heterozygous protoporphyria': 1, 'het': 5, 'Weissenbach': 2, 'DEFINING THE HETEROZYGOUS': 1, 'heteroEM': 1, 'Naca heterozygous deficiency': 1, 'HEM': 1, 'hetEM': 1, 'Weissenbacher-Zweymueller syndrome': 1, 'Thibierge- and Weissenbach-syndrome': 1, 'MH': 2, 'WEISSENBACH SYNDROME': 2, 'GOF-related disease': 1, 'GOF': 1, 'Weissenbacter-Zweymuller syndrome': 1, 'D9-HET': 1, 'HEMs': 1, 'Thibierge- Weissenbach syndrome': 1, 'monogenic heterozygous diseases': 1, 'Heterozygous': 3, 'Weissenbacher syndrome': 1, 'heterozygous': 2, 'hetLOF': 1, 'CHF': 1, 'HFH': 6, 'hFH': 1, 'HR': 1, 'CHARACTERIZING HETEROZYGOUS': 1, '& Weissenbacher-Zweymuller': 1, 'EFFECT OF HETEROZYGOUS MUTATIONS': 1, 'OF HETEROZYGOUS': 1, 'Thibierge Weissenbach syndrome': 1, 'HAOS': 1, 'PHS': 1, 'Heterozygous Familial Hypercholesterolaemia': 1, 'heterozygous thalassaemia': 1, 'OBHZ': 1, 'Weissen-Bacher-Zweymuller syndrome': 1, 'Thiebierge-Weissenbach syndrome': 1, 'STL3': 2, 'Weissenbacher - Zweymuller syndrome': 1, "Thibierge-Weissenbach's syndrome": 2, 'Heterozygous betathalassaemia': 1, 'Thibierge-Weissenbach-syndrome': 2, 'Tumor': 1, 'III Weissenbacher-Zweymuller syndrome': 1, 'HET Q175': 1, 'familial heterozygous hypercholesterolaemia': 1, 'HETD': 1, 'Weissenbacher-Zweymuller (W-Z) syndrome': 1, 'Weissenbacher-Zweymuller, Stickler, and Marshall syndromes': 1, 'PHP': 1, 'CHP': 1, 'Het': 1, 'DH': 2, 'Thibierge - Weissenbach syndrome': 1, 'HT carcinomas': 1, 'Thieberge-Weissenbach syndrome': 1, 'Zweymuller': 1, 'heterozygous thalassemic': 1, 'Thieberge--Weissenbach syndrome': 1, 'Weissenbach syndrome': 2, 'Gdnf HETEROZYGOUS': 1, 'beta-heterozygous thalassaemia': 2, 'HEs': 1, 'Heterozygous familial hypobetalipoproteinaemia': 1, 'Weissenbacher-Zweymuller Syndrome': 1, 'HD': 1, 'heterozygous haemoglobinopathy': 1, 'Heterozygous hemochromatosis': 1, 'Hz': 1, 'ABHet': 1, 'BH': 1, 'alpha zero-like heterozygous': 1, 'DHZ': 1, 'cHET': 1, 'HER': 1, 'heterozygous varians': 1, 'He': 2, 'WEISSENBACH': 2, 'EFFECTS OF HETEROZYGOUS': 1, 'STL3 syndrome': 1, 'Weissenbacher-Zweimuller': 1, 'HET-HET': 1, 'dHT': 1, 'Weissenbacher-Zymuller syndrome': 1, 'familial heterozygous hypobetalipoproteinaemia': 1, 'double heterozygous disease': 1, 'Weissenbacher-Zweymuller dysplasia': 1, 'HP': 1, 'Heterozygous Deficiency of HMBS': 1, 'Ht': 1, 'HET-TEI': 1, 'HZD': 1, 'HETEROZYGOUS': 1, 'autosomal dominant otospondylomegaepiphyseal dysplasia': 1, 'HTG': 1, 'PAT-HET': 1, 'MIX-HET': 1, 'Thiebirge-Weissenbach syndrome': 1, 'PHt': 1, 'HtFH': 1, 'TH': 1, 'Thieberge and Weissenbach syndrome': 1, 'HETEROZYGOUS MUTATIONS': 1, 'Weissenbacher- Zweymller syndrome': 1, 'GENETIC ROLE OF HETEROZYGOUS INDIVIDUALS': 1} | HET |
Disease | MESH:C535777 | {'split hand and foot deformity': 1, 'split hand/foot': 9, 'split foot': 9, 'split foot phenotype': 1, 'split hand and foot': 4, 'split hand/split foot deformity': 4, 'Split hand/split foot deformity': 1, '-split foot': 1, 'split hand/foot deformities': 2, 'split hand and foot syndrome': 5, 'split-hand/foot abnormalities': 1, 'split-hand/foot': 3, 'Unilateral split foot': 1, 'unilateral split foot': 2, 'Split hand/foot abnormalities': 1, 'split-foot deformity': 2, 'split-hand and -foot deformity': 2, 'Split--hand and split--foot deformity': 1, 'and split-foot deformity': 1, 'split foot/hand disease': 1, 'split hand/foot deformity': 2, 'split hand/foot or ectrodactyly': 1, 'bilateral split foot': 1, 'Split hand/split foot deformity with focal dermal hypoplasia': 1, 'foot, hand and limb related deformities': 1, 'split foot and elbow': 1, 'split hand-foot syndrome': 1, 'SF': 1, 'Split Foot Syndrome': 1, 'split hand or foot deformity': 1, 'split hand--split foot deformity': 1, 'hand-foot split deformity': 1, 'split hand-split foot deformity': 2, 'Split-foot deformity': 1, 'split-hand and foot deformity': 1, 'split foot deformity': 1, 'split-foot defect': 2, 'RFESS': 1, 'Split hand/foot': 1, 'split hand/foot syndrome': 3, 'Split hand/foot syndrome': 1, 'congenital split hand/foot disorder': 1, 'split hand/foot (central ray deficiency': 1, 'split hand/foot phenotype': 1, 'split-foot phenotype': 1, 'or split foot': 1, 'Split foot deformity': 2, 'split-foot': 1, 'split-hand/split-foot deformity': 3, 'split hand/foot disorders': 1, 'Split foot and developmental retardation': 1, 'split foot and developmental retardation': 1, 'split foot/hand deformity': 1, 'split hand-foot limb deficiency': 1, 'Familial split hand and foot': 1, 'bilateral split-hand and foot deformities': 1, 'split hand and foot disease': 1} | split hand/foot |
Disease | MESH:C535779 | {'spondylo-epi-meta-physeal-dysplasia': 1, 'juvenile spondylo-arthropathies': 1, 'spondylo-arthropathies': 24, 'seronegative spondylo-arthropathy': 3, 'spondylo-': 4, 'SpA': 2, 'spondylo- arthropathies': 1, 'spondylo-epi-(meta)-physeal dysplasias': 2, 'spondylos': 6, 'spondylo-ocular syndrome': 19, 'spondylo-epiphysial dysplasia': 7, 'spondylo epi (meta) physeal dysplasia': 2, 'Spondylo-epi-(meta) physeal Dysplasia': 1, 'spondylo paralysis': 1, 'spondylo and ptosis': 1, 'Spondylo-enchondrodysplasia': 1, 'spondylo-arthropathy syndromes': 2, 'spondylo costal dysostosis': 1, 'Spondylo costal dysostosis': 2, 'SCD': 3, 'Spondylo-ocular syndrome': 7, 'dysplasia spondylo-epiphysaria congenita': 1, 'spondylo-epiphysary dysplasia': 1, 'spondylo-arthrotic processes': 1, 'seronegative spondylo-arthropathies': 9, 'spondylo-arthropathy': 22, 'spondylo': 6, 'spondylo-peripheral dysplasia': 1, 'Spondylo-epi-(meta)-physeal dysplasias': 2, 'Spondylo-ocular dysplasia': 2, 'spondylo-epyphyseal dysplasia': 1, 'spondylo"-dysplasia': 2, 'spondylo-dysplastic': 1, 'Spondylo-arthropathy': 4, 'spondylo-cheiro-dysplastic type': 1, 'Spondylo-costal dysostosis': 4, 'spondylo-epiphysial dysplasias': 2, 'Spondylo-megaepiphysealmetaphyseal dysplasia': 1, 'JSpA': 1, 'Juvenile Spondylo-Arthropathy': 1, 'Spondylo-ocular Syndrome': 2, 'spondylo-costal dysplasia': 4, 'Spondylo-costal dysplasia': 2, 'spondylo-costal dysplasias': 1, 'spondylo(epi)chondrodysplasia': 2, 'spondylo meta physical dysplasi Kozlowskys type (1': 1, 'spondylo-epiphysial dysplasia tarda': 2, 'spondylo-epiphysial dysplasia congenita': 2, 'spondylo-epiphysial chondrodysplasia': 4, 'Spondylo-': 1, 'Spondylo': 3, 'inflammatory spondylo-arthropathy': 2, 'SCD ia': 1, 'Spondylo-polyepiphyseal dystrophy': 1, 'Spondylo-epiphysial dysplasia tarda': 2, 'SpAs': 1, 'spondylo-enchondroplasia': 1, 'SOS syndrome': 1, 'SOS': 2, 'spondylo-articular deformities': 1, 'spondylo-articular problems': 1, 'Ortho-spondylo-dysathrics': 1, 'spondylo-ephyseal dysplasia': 1, 'spondylo-, epi-, spondylometa- and physeal dysplasia': 1, 'spondylo-arthrotic degeneration': 1, 'SPONDYLO': 1, 'SA': 1, 'ISP': 1, 'spondylo-discopathy': 1, 'Spondylo-vertebral and spondylo-thoracic dysostosis': 1, 'spondylo arthropathy': 1, 'spondylo-arthopathies': 1, 'Congenital spondylo-epiphysial dysplasia': 1, 'congenital spondylo-epiphysial dysplasia': 4, 'spondylo-epimetafysal dysplasia': 1, 'spondylo-rib dysplasia': 1, 'SNSA': 1, 'spondyloic myelopathy': 1, 'Broncho-spondylo-lumbar fistula': 1, 'spondylo-epi-methaphyseal dysplasia': 1, 'spondylo-costal dysostosis': 1, 'spondylo-arthropathry': 1, 'spondylo-enchondro-dysplasia': 1, 'spondylo-enchondrodysplasia': 1, 'Spondylo-cardialgia': 1, 'spondylo-epiphisary dysplasia': 1, 'spondylo-pathies': 1, 'Spondylo-camptodactyly syndrome': 1, 'Spondylo-enchondroplasia': 1, 'Spondylo-thoracic dysplasia': 1, 'spondylo-costal malformations': 1, 'Spondylo arthopathy': 1, 'spondyloe-pimetaphyseal dysplasia': 1, 'SEMD': 1, 'Spondylo-epi-(meta)-physeal dysplasias 23': 1, 'spondylo-discarthrosis': 1, 'late spondylo-epiphysial dysplasia': 1, 'spondylo-epihyseal dysplasia': 1, 'spondylo-epi-metaphysaria': 1, 'spondylo-epi(meta)physeal dysplasias': 1, 'spondylo-arthopathy': 1, 'spondylo-costal': 1, 'spondylo-pelvic injury': 2, 'Axial spondylo- arthropathy': 1, 'isthmic spondylo- listhesis': 1, 'Spondylo-Costal Dysostosis': 1, 'spondylo-carpo-tarsal syndrome': 1, 'Spondylo-epiphseal dysplasia': 1, 'spondylo arthropaty': 1, 'axial spondylo arthropathy': 1, 'Spondylo-epi-meta- physeal dysplasia': 1, 'spondylo-(meta)-physeal dysplasias': 1, 'spondylo-epi-(meta)-physeal dysplasia': 1, 'spondylo epi(meta)physeal dysplasia': 1, 'Spondylo Epi(meta)physeal Dysplasia': 1, 'Spondylo-epi(-meta)physeal dysplasias': 1, 'spondylo-epifysaire dysplasie': 1, 'Spondylo-arthropathies': 1, 'Spondylo-epi-(meta)-physeal dysplasia': 1, 'spondylo-thoracic dysplasia': 1} | spondylo-arthropathies |
Disease | MESH:C535780 | {'carpal fusions': 21, 'Spondylocarpotarsal synostosis (SCT) syndrome': 2, 'Spondylocarpotarsal Synostosis Syndrome': 7, 'Spondylocarpotarsal synostosis syndrome': 27, 'Spondylocarpotarsal synostosis': 12, 'spondylocarpotarsal syndrome': 13, 'SCT syndrome': 3, 'SCT Syndrome': 1, 'SCT': 636, 'autosomal-recessive SCT': 1, 'carpal bone fusions': 2, 'spondylocarpotarsal synostosis syndrome': 38, 'carpal bone fusion': 16, 'IEC no-SCT': 1, 'and SCT': 1, 'Carpal Fusion': 1, 'LCF': 1, 'spondylocarpotarsal fusion syndrome 1': 1, 'spondylocarpotarsal fusion syndrome 1B.': 1, 'autoSCT': 1, 'Autologous SCT': 3, 'SCTS': 3, 'ASCOT SCT-4': 2, 'spondylocarpotarsal synostosis': 22, 'autosomal dominant spondylocarpotarsal synostosis': 3, 'Spondylocarpotarsal Syndrome AD': 1, 'spondylocarpotarsal synostosis syndromes': 1, 'autosomal recessive spondylocarpotarsal syndrome': 1, 'autosomal dominant spondylocarpotarsal syndrome': 1, 'SCT%': 1, 'recessive spondylocarpotarsal syndrome': 3, 'vertebral, carpal and tarsal fusions': 4, 'SCT, NOS': 2, 'Vertebral, carpal and tarsal fusions': 1, 'spondylocarpotarsal synostosis (SCT) syndrome': 1, 'allo-SCT': 1, 'SSS': 6, 'carpal fusion': 28, 'Carpal fusion': 6, 'Altman type IV SCT': 1, 'Altman type I SCT': 1, 'Spondylocarpotarsal dysplasia': 1, 'spondylocarpotarsal synostosis (': 1, 'spondylocarpotarsal fusion syndrome 1B': 1, 'spondylocarpotarsal fusion syndromes 1B': 1, 'spondylocarpotarsal fusion syndromes IA and IB': 1, 'spondylocarpotarsal fusion syndrome IB': 1, 'fusion of carpal bones': 9, 'Inflammatory SCT': 1, 'vertebral and carpal coalition': 1, 'congenital synspondylism': 3, 'Congenital synspondylism': 2, 'synspondylism': 1, 'SCT-NOS': 5, 'EMSCT': 1, 'IMSCT': 1, 'SCT-MD-26': 1, 'SCT-MD-16': 1, 'SCT-MD-18': 1, 'SCT-MD-27': 1, 'SCT-MD-21': 1, 'SCT tendinosis': 1, 'SST tendinosis': 1, 'fusion of the carpal bones': 2, 'spondylocarpotarsal (SCT)': 1, 'autosomal recessive SCT': 1, 'Auto-SCT': 1, 'Spondylocarpotarsal Synostosis': 4, 'spondylocarpotarsal syntosis': 1, 'AlloSCT': 1, 'USLs': 1, 'Carpal bone fusion': 1, 'Recessive spondylocarpotarsal syndrome': 1, 'alloSCT': 1, 'POST-SCT ADJUVANT': 1, 'Spondylocarpotarsal syndrome': 2, 'vertebral, carpal, and tarsal fusions': 2, 'extramedullary SCT': 1, 'EM-SCT': 1, 'M-SCT': 1, 'malignant SCT': 1, 'sclerosing SCT': 1, 'SCT)': 1, 'Malignant SCT-NOS': 1, 'recessive spondylocarpotarsal synostosis syndrome': 1, 'carpal, tarsal and vertebral fusion': 1, 'SCT-FSN': 1, 'FGM-SCT': 1, 'SCT-C': 1, 'SCT-S': 1, 'Type 1 SCT': 1, 'Familial synspondylism': 1, 'Carpal fusions': 5, 'post-SCT lymphoproliferative disorder': 1, 'CBT': 1, 'SCT_L': 1, 'SCT injuries': 1, 'DSMQ-SCT': 1, 'intra-abdominal SCT': 1, 'carpal, tarsal and vertebral fusions': 1, 'hematopoietic SCT': 1, 'SNOMED SCT': 1, 'recessive spondylocarpotarsal synostosis': 1, 'HJC&SCT': 1, 'SCT-15': 1, '-carpal fusion': 1, 'Type III SCT': 1, 'Carpal Bone Fusion': 1, 'Malignant SCT': 1, 'SCT condition': 1, 'SCT diseases': 2, 'spondylocarpotarsal syndromes': 2, 'AD SCT': 1, 'vertebral and carpal/tarsal fusions': 1, 'STS': 1, 'spondylocarpotarsal Dysostosis': 1, 'SCM': 1, 'SCT of': 1, 'autosomal recessive spondylocarpotarsal synostosis syndrome': 1, 'autosomal dominant and recessive spondylocarpotarsal synostosis syndromes': 1, 'SS': 1, 'autosomal dominant spondylocarpotarsal synostosis syndrome': 1, '-SCT': 1, 'SCT symptoms': 1, 'SCT Symptoms': 1, 'SCT metastases': 1, 'carpal bones fusion': 1, 'XLR Spondylocarpotarsal synostosis': 1, 'CARPAL FUSIONS': 1, 'SCT-NOS lesions': 1, 'SCT-NOS lesion': 1, 'recessive SSS': 1, 'autosomal recessive SCTS': 1, 'AUTO-SCT': 1, 'SCT-ALL': 1, 'autosomal-recessive spondylocarpotarsal syndrome': 1, 'Autosomal dominant spondylocarpotarsal synostosis syndrome': 1, 'unilateral bar': 1, 'PCT SCT': 1, 'post-SCT lung infection': 1, 'type-II SCT': 1, 'Type I SCT tumors': 1, 'SCT type III': 1, 'allogenic SCT Respiratory 10': 1, 'SCT,16': 1} | SCT |
Disease | MESH:C535781 | {'vertebral fractures': 12176, 'Vertebral fractures': 1592, 'vertebral, non-vertebral and hip fractures': 30, 'multiple vertebral anomalies': 8, 'vertebral abnormalities': 529, 'vertebral fracture': 9011, 'vertebral malformation': 274, 'Vertebral defects': 86, 'vertebral injury': 201, 'non-vertebral fractures': 431, 'Vertebral Fracture': 349, 'vertebral': 1091, 'vertebral anomalies': 1353, 'Vertebral fracture': 1036, 'vertebral and non-vertebral fracture': 85, 'non-vertebral fracture': 229, 'vertebral deformities': 916, 'spondylothoracic dysplasia syndrome': 3, 'STD syndrome': 2, 'Spondylothoracic dysplasia': 23, 'Jarcho-Levin syndrome': 172, 'costovertebral dysplasia': 14, 'STD': 32, 'congenital vertebral anomalies': 119, 'vertebral anomaly': 184, 'congenital vertebral anomaly': 27, 'Vertebral anomalies': 208, 'congenital vertebral malformations': 109, 'Congenital spinal vertebral anomalies': 2, 'vertebral damage': 85, 'vertebral deformity': 738, 'Costovertebral angle knock pain': 1, 'Metastatic vertebral disease': 1, 'vertebral segmentation anomalies': 45, 'vertebral disorders': 61, 'vertebral and extravertebral fractures': 1, 'vertebral malformations': 404, 'vertebral and non-vertebral fractures': 472, 'VFs': 320, 'vertebral lesion': 446, 'and vertebral abnormalities': 1, 'vertebral and nonvertebral fractures': 406, 'fracture of thoracic vertebral and vertebral arch': 1, 'vertebral and non-vertebral fragility fractures': 4, 'vertebral,': 35, 'vertebral slippage': 95, 'VERTEBRATE CRANIOFACIAL': 1, 'vertebral lengthening': 8, 'vertebral involvement': 237, 'non vertebral fractures': 2, 'VF': 353, 'NVF': 19, 'rib, and vertebral anomalies': 2, 'vertebral lesions': 793, 'vertebral defects': 676, 'vertebral disease': 170, 'Vertebral Fracturec': 1, 'vertebral diseases': 64, 'autosomal recessive familial spondylocostal dysostosis': 1, 'Vertebral malformations': 52, 'rib and vertebral anomalies': 22, 'vertebral and costal anomalies': 18, 'Jarcho Levin syndrome': 11, 'Vertebral and non-vertebral fractures': 5, 'Vertebral Fractures': 371, 'vertebral dislocation': 169, 'pathologic vertebral weakening': 1, 'vertebral arch cleft': 2, 'vertebral pedicle': 1, 'VERTEBRAL ARTERIOVENOUS': 2, 'thoracic vertebral fractures': 98, 'thoracic vertebral fracture': 115, 'vertebral joints injuries': 1, 'vertebral artery anomaly': 27, 'non-contiguous vertebral fractures': 1, 'Non-contiguous vertebral fractures': 1, 'Congenital vertebral malformations': 25, 'vertebral, and rib anomalies': 2, 'Rib and Vertebral Anomalies': 1, 'vertebral and rib anomalies': 55, 'vertebral plexus': 1, 'traumatic vertebral fractures': 59, 'vertebral disk dislocation': 1, 'Developmental vertebral anomalies': 1, 'of L5 vertebral slippage': 1, 'CVM': 84, 'complex vertebral malformation': 21, 'fractured vertebral': 125, 'neoplastic vertebral lesions': 5, 'Vertebral blockade': 2, 'vertebral and NHVN fracture': 1, 'Vertebral Abnormalities': 6, 'VERTEBRAL ANASTOMOSIS': 1, 'vertebral articular process anomalies': 2, 'Non-vertebral fracture': 34, 'Vertebral deformities': 120, '-vertebral Fractures': 1, 'Vertebral deformity': 70, '-non-vertebral fractures': 1, 'Congenital Vertebral Malformations': 5, 'Vertebral Deformities': 5, 'CVMs': 15, 'Congenital vertebral malformation': 5, 'VVs': 6, 'Vertebral injuries': 16, '-vertebral fractures': 78, 'posterior vertebral space-occupying lesions': 1, 'vertebral defect': 168, 'Vertebral osteoymelitis': 1, 'vertebral or renal anomalies': 2, 'metastatic vertebral lesions': 15, 'Vertebral dislocation': 7, 'vertebral and limb fractures': 4, 'vertebral loss': 27, 'non-vertebral and vertebral fracture': 3, 'vertebral damage at': 1, 'vertebral injuries': 161, 'osteolytic vertebral disease': 1, 'vertebral abnormality': 55, 'vertebral fusion anomalies': 12, 'Vertebral injury': 18, 'Vertebral hypersegmentation': 1, 'vertebral hypersegmentation': 3, 'vertebral reduction': 19, 'AVF': 29, 'transverse vertebral fracture': 1, 'vertebral inflammatory process': 3, 'vertebral-fracture': 16, 'Congenital cleft vertebral centrum': 1, 'vertebral bony anomalies.[Figure': 1, 'vertebral deformations': 36, 'vertebral, or': 1, 'spine and vertebral anomalies': 1, 'vertebral clefts': 23, 'vertebral alterations': 14, 'vertebral anomalies of the': 1, 'IVPP': 41, 'Vertebral abnormalities': 70, 'defects in vertebral disc and': 1, 'vertebral articular calcification': 1, 'congenital vertebral deformity': 7, 'vertebral arch lesion': 2, 'Vertebral': 118, 'Vertebral lytic lesions': 4, 'vertebral biconcavity deformities': 1, 'costovertebral angle pain': 42, 'vertebral metatases': 1, 'vertebral and': 19, ') vertebral lesions': 1, 'vertebral dislocations': 27, 'Vertebral Anomalies': 14, 'Consortium for Vertebral Anomalies and Scoliosis': 1, 'ICVAS': 2, 'VA': 42, 'Vertebral deformations': 3, 'fracture of the vertebral': 3, 'VERTEBRAL ARTERIOGRAPHY IN MALFORMATIONS OF': 1, 'blocking of the vertebral joint': 1, 'Vertebral anomaly': 20, 'vertebral refracture': 26, 'vertebral joint': 4, 'vertebral joints': 5, ', vertebral': 3, 'VERTEBRAL MANIPULATION': 1, 'vertebral and/or nonvertebral fractures': 6, 'VA anomaly': 28, 'VA anomalies': 51, 'limb, vertebral or gut anomalies': 1, 'costovertebral joint osteoarthritis': 2, 'costovertebral degenerative changes': 1, 'fratura vertebral': 2, 'Osteoartrose costovertebral': 1, 'vertebral colum': 1, 'costovertebral hyperostosis': 1, '-vertebral junction deformities': 1, 'vertebral stiffness': 11, 'VERTEBRAL': 122, 'costovertebral defects': 20, 'vertebral forward dislocation': 1, 'Vertebral malformation': 15, 'benign vertebral lesions': 8, 'lytic vertebral lesions': 20, 'intra-vertebral lesion': 1, 'Vertebral body anomalies': 5, 'vertebral body anomalies': 32, 'lytic vertebral disease': 2, 'segmental anomalies of the vertebral bodies': 3, 'Vertebral haemangiomas': 23, 'Vertebral haemangioma': 16, 'vertebral corpus lesion': 1, '-vertebral': 7, 'vertebral problems': 23, 'vertebral homeosis': 5, 'vertebral and other fractures': 27, 'VFA': 27, 'Impairment in vertebral': 1, 'vertebral haemangiomas': 61, 'costovertebral joint dysfunction': 3, 'Vertebral defect': 9, 'vertebral fracture of': 5, 'osteoarthritic changes of vertebral': 1, 'vertebral disorder': 11, 'vertebral) and health disorders': 1, 'Vertebral disorders': 5, 'vertebral necrosis': 16, 'vertebral spondyloptosis': 1, 'Skipped vertebral lesions': 1, 'Vertebral involvement': 30, 'vertebral facture': 10, 'vertebral problem': 3, 'vertebral "deformities': 1, 'Costovertebral malformations': 4, 'Vertebral deformation': 4, 'vertebral squaring': 4, 'Vertebral fractureRib': 1, 'and vertebral fractures': 22, 'vertebral osteomielitis': 2, 'Vertebral Abnormality': 1, 'vertebral arch defects': 19, 'vertebral and/': 1, 'costovertebral joint disruptions': 1, 'anomaly of the vertebral artery': 10, 'Vertebral apophyseal fracture': 2, 'thoracolumbar vertebral deformities': 1, 'vertebral and discal deformities': 1, 'costovertebral': 22, 'associated vertebral fractures': 2, 'spondylocostal/spondylothoracic dysostosis': 2, 'vertebral and limb anomalies': 5, 'Vertebral or rib anomalies': 2, 'vertebral pathologies': 38, 'vertebral derotation': 10, 'Dominant vertebral': 1, 'vertebral disturbances': 1, 'vertebral discopathy': 6, 'vertebral artery anomalies': 41, 'arteria vertebral direita pervia': 1, 'AVD': 4, 'arteria vertebral direita': 4, 'Congenital vertebral anomalies': 16, 'costovertebral abnormalities': 9, 'vascular and vertebral anomalies': 2, 'vertebral or discovertebral lesions of the': 1, 'Vertebral canal haematomas': 1, 'Vertebral canal': 2, 'vertebral canal': 29, 'vertebral canal haematomas': 1, 'and non-vertebral fractures': 22, 'vertebral, hip and non-vertebral fractures': 15, 'congenital malformation of the SVL': 1, 'UVL': 1, 'SVL': 1, 'congenital vertebral hypoplasia': 1, 'renal, cardiac and vertebral anomalies': 2, 'skeletal (vertebral) anomalies': 1, 'vertebral deformities and fractures': 1, 'vertebral metastatic lesions': 27, 'vertebral amyloidoma': 2, 'VERTEBRATE': 51, 'Vertebral lesions': 63, 'vertebral and nonvertebral fracture': 81, 'congenital vertebral malformation': 41, 'vertebral split fractures': 3, 'vertebral clefting': 5, 'dorsal vertebral anomalies': 1, 'vertebral lytic lesion': 11, 'vertebral fracture and': 1, 'malformations of vertebral units': 3, ', vertebral (': 1, 'vertebral puzzle': 2, 'VERTEBRATES': 57, 'vertebral deformities': 1, 'vertebral apophyseal injury': 1, 'vertebral/spinal anomalies': 3, 'sacral vertebral anomalies': 5, 'Thoracic vertebral anomalies': 2, 'L5 vertebral fracture': 12, 'thoracolumbar vertebral fractures': 75, 'costovertebral angle': 37, '-vertebral fracture': 45, 'traumatic vertebral fracture': 34, 'limb and vertebral fractures': 5, 'thoracic vertebral anomalies': 19, 'vertebral, and nonvertebral fractures': 3, 'posterior costovertebral ligament disruption': 1, 'vertebral facet joints': 1, 'vertebral deformation': 48, 'autosomal recessive spondylocostal dysostosis': 11, 'vertebral lytic lesions': 18, 'costovertebral pain': 14, 'Vertebral and Clinical Fractures': 1, 'vertebral or clinical fracture': 2, 'vertebral or clinical fractures': 1, 'vertebral lamina defects': 1, 'AVT': 18, 'Vertebral body anomaly': 1, 'vertebral and clinical fractures': 33, 'post- vertebral fracture': 1, 'DELAYED VERTEBRAL': 1, 'vertebral block': 22, 'vertebral deformity2': 1, 'cardiac, renal, vertebral and anal anomalies': 1, 'VD': 19, 'Spondylothoracic dysostosis': 15, 'vertebral haemangioma': 54, 'spinal cord and vertebral/sacral anomalies': 1, 'vertebral and/or sacral anomalies': 1, 'vertebral, urological and musculoskeletal anomalies': 1, 'of both vertebral': 1, 'vertebral, non-vertebral, and hip fractures': 32, 'vertebral epiphysitis': 6, 'spondylothoracic dysostosis': 55, 'Spondylothoracic and spondylocostal dysostosis': 1, 'limb and vertebral anomalies': 4, 'vertebral patterning anomaly': 1, 'abnormalities of the vertebral pattern': 1, 'vertebral and congenital anomalies': 1, 'vertebral patterning abnormalities': 1, 'spondylothoracal dysplasia': 1, 'vertebral fracture 1': 1, 'congenital vertebral, cardiac or renal anomalies': 1, 'trunk and/or vertebral deformity': 1, 'vertebral and sternebrae fractures': 1, 'agenesis of vertebral canal': 1, 'teardrop vertebral fracture': 1, 'Traumatic vertebral fractures': 2, 'SQ-VD': 2, 'vertebral cortex fracture': 4, 'costo-vertebral malformations': 7, 'Thoracic vertebral fracture': 25, 'Vertebral,': 4, 'costovertebral defects.5': 1, 'vertebral and organ-system anomalies': 1, 'Non-vertebral fractures': 37, 'vertebral disk disease': 8, 'vertebral spinous process defects': 1, 'T11 vertebral fracture': 1, 'loss of vertebral': 20, '-traumatic vertebral fractures': 2, 'vertebral pathology': 25, 'costovertebral joint fracture': 5, 'vertebral commpression fractures': 1, 'spondylocostal dysostosis 3': 1, 'VCD': 1, 'non-vertebral': 4, 'Vertebral lumbosciatalgia': 1, 'vertebral or rib anomalies': 4, 'vertebral fracture non-': 1, 'MVF': 8, 'vertebral and epiphyseal abnormalities': 1, 'fracture of the vertebral joint': 1, 'Multiple Vertebral Involvement': 1, 'fracture of the vertebral arch': 2, 'orofacial and vertebral malformations': 1, 'Jarcho-levin syndrome': 4, "Jarcho's syndrome": 1, 'vertebral spondylarthritic or': 1, 'CVL': 1, 'vertebral and vertebral fracture': 5, 'vertebral and vertebral fractures': 15, 'VERTEBRAL LIGAMENT': 1, 'vertebral fracture or': 3, 'Vertebral pathology': 2, 'vertebral or visceral anomaly': 1, 'vertebral anulus fibrosus': 1, 'vertebral disc extrusion': 4, 'vertebral pattern abnormalities': 1, 'cardiac, renal, and vertebral anomalies': 3, 'vertebral hypoplasia': 43, 'multiple vertebral disease': 1, 'APROPOS OF FRACTURES OF THE VERTEBRAL': 1, 'vertebral hypomobility': 2, 'vertebral or': 9, 'femoral, vertebral,': 2, 'vertebral and craniofacial anomalies': 2, 'PK-VF': 4, 'Vertebral fracture reduction': 1, 'vertebral or non-vertebral fracture': 27, 'vertebral-': 4, 'abnormality in the vertebral circulation': 1, 'vertebral sclerosis': 38, 'cranial and vertebral deformities': 1, 'vertebral osteoplasty': 1, 'vertebral nonunion': 15, 'nonunion of vertebral fractures': 2, 'enchondroplasias with vertebral lesions': 1, 'vertebral skeletal defects': 5, 'LARGER VERTEBRATES': 1, 'vertebrate disease': 5, 'facioauriculo vertebral sequence': 1, 'Vertebral block': 2, 'vertebral EHs': 1, 'vertebral recollapse': 3, 'vertebral esquerda': 1, 'vertebral direita': 1, 'Vertebral loss': 2, 'Vertebral Manipulation': 2, "vertebral bodies' anomaly": 1, 'vertebral apophysis': 3, 'cleft vertebral arch': 1, 'Multiple vertebral deformity': 1, 'vertebral deformities Fracture': 1, 'vertebral, femoral': 1, 'vertebral disc abnormalities': 4, 'vertebral end plate anomalies': 1, 'vertebral arch lesions': 3, 'thoracolumbar vertebral fracture': 63, 'vertebral agenesis': 23, 'vertebral and spinal cord anomalies': 5, 'vertebral or nonvertebral fracture': 23, 'VERTEBRAL ARTERIOGRAPHY': 5, 'Vertebral deformiy': 1, 'vertebral osteolytic changes': 1, 'vertebral dysfunction': 16, '-VERTEBRAL SPACE': 1, 'vertebral or cardiac anomalies': 2, 'vertebral cleft': 31, 'Vertebral physitis': 2, 'vertebral physitis': 1, 'vertebral forward slippage of the': 1, 'Vertebral forward slippage': 2, 'portador de doenca metastatica vertebral': 1, 'Metastastica Vertebral': 1, 'DMV': 1, 'vertebral/': 5, 'Metastastica Vertebral Para': 1, 'Vertebral Metastatic Disease': 3, 'of vertebral': 28, 'Transverse fractures of the vertebral arch': 1, 'vertebral arch defect': 8, 'vertebral disk pathologies': 2, 'vertebral osteolytic fractures': 1, 'intra-vertebral deformity': 1, 'multiple vertebral involvement': 3, 'Vertebral and nonvertebral fractures': 12, 'Vertebral and non-vertebral fracture': 2, 'Vertebral reshaping': 1, 'vertebral reshaping': 1, 'vertebral skeletal deterioration': 2, 'arteria vertebral': 17, 'Vertebral agenesis': 3, 'Vertebral and other fractures': 3, 'oculoauriculo-vertebral': 1, 'costo-vertebral anomalies': 4, 'cervicothoracic vertebral malformation': 1, 'vertebral fusion anomaly': 3, 'Vertebral Fusion Anomaly': 1, 'vertebral soma fracture': 1, 'costo vertebral malformations': 1, 'congenital costo vertebral malformations': 1, 'vertebral remodeling defects': 1, 'and vertebral': 15, 'VGNC': 5, 'renal and vertebral anomalies': 8, 'vertebral, or disc problems': 1, 'VERTEBRATE INNOVATIONS': 1, 'vertebral pincer fracture': 1, 'Vertebral pincer fractures': 1, 'vertebral pincer fractures': 1, 'vertebral dystrophy': 5, '-vertebrate': 1, 'Vertebral artery anomalies': 10, 'vertebral apophyseal injuries': 1, 'hip, vertebral and non-vertebral fractures': 10, 'Vertebral, rib, and limb anomalies': 1, 'Vertebral and radial anomalies': 1, 'Complex vertebral malformation': 13, 'haemodynamic or vertebral problems': 1, 'Osteoarthritis of the costovertebral joints': 2, 'osteoarthritis of a costovertebral joint': 1, 'osteoarthritis of a single costovertebral joint': 1, 'vertebral, ocular, and renal anomalies': 1, 'nonvertebral or vertebral': 1, 'post-vertebral fractures': 2, 'Vertebral Malformation': 14, 'CVM-defect': 1, 'Complex Vertebral Malformation': 8, 'CVM defect': 3, 'vertebral curve deformities': 1, 'vertebral malformation or deformity': 1, 'bony and vertebral artery (VA) anomalies': 1, 'vertebral number abnormalities': 1, 'fractured vertebral reduction': 1, 'Vertebral corpus fractures': 1, 'CVJ-VA anomalies': 1, 'thoracic vertebral malformations': 17, 'anomalies of vertebral artery and axis': 1, 'extraosseous vertebral artery anomaly': 1, 'anomalies of the vertebral artery and axis': 1, 'posterior vertebral fusion anomalies': 1, 'costovertebral joint arthritis': 3, 'vertebral epiphyses': 3, 'T10 vertebral lesion': 1, 'Jarcho-Levin': 12, 'Thoracic vertebral fractures': 11, 'vertebral and total fractures': 5, 'vertebral derangement': 1, 'post-vertebral fracture': 14, 'vertebral or non-vertebral fractures': 28, 'vertebral anomaliesCT': 1, 'vertebral fracture': 4, 'vertebral joint involvement': 1, 'vertebral arch clefts': 1, 'vertebral calcification': 17, 'Spinal cord and vertebral anomalies': 1, 'Multiple vertebral anomalies': 2, 'vertebral or other fractures': 5, 'vertebral disk anomalies': 1, 'Vertebral OM': 3, 'Vertebral fracturesSevere': 1, 'lumbar vertebral anomalies': 5, 'discal and vertebral involvement': 1, 'idiopathic vertebral fractures': 1, 'IVF': 3, 'idiopathic vertebral fracture': 3, 'spondylothoracic dysplasia': 39, 'multiple vertebral malformations': 2, 'cardiac, cardiothoracic, or vertebral columns anomalies': 1, 'vertebral number': 15, 'Vertebral number': 1, 'vertebrate': 21, 'vertebral imbalance': 4, 'vertebral/nonvertebral fractures': 6, 'vertebral kyphotic deformity': 4, 'vertebral destabilization': 2, 'Jarcho levinc': 1, 'Vertebral compromise': 1, 'vertebral maldevelopment': 3, 'Jarcho-Levin Syndrome': 17, 'JLS': 31, 'Jarcho Levin Syndrome': 5, 'vertebral curvature anomalies': 1, 'Type 2 phenotype of SCD': 1, 'Vertebral fracture Non-vertebral fracture': 2, 'vertebral fracturing': 4, 'vertebral disc': 21, 'congenital vertebral deformities': 5, 'VVS': 3, 'vertebral, hip, and non-vertebral fractures': 10, 'vertebral cortex': 1, 'cranial and vertebral malformations': 4, 'ARSCD1': 1, 'Autosomal recessive spondylocostal dysostosis type 1': 1, 'costovertebral malformations': 19, 'Metastatic Vertebral Lesions': 3, 'necrotic vertebral': 3, 'anomalies of the vertebral column': 9, 'absence of vertebral vascularization': 1, 'vertebral fracture deformity': 1, 'vertebres': 6, 'DETERMINATON OF VERTEBRAL': 1, 'Bypass anomaly of the vertebral artery': 1, 'Vertebral metastasisa': 1, 'posterior vertebral anomalies': 1, 'anterior and posterior vertebral anomalies': 1, 'Vertebral abnormality': 10, 'vertebral impingement': 1, 'vertebral subsidence': 5, 'vertebral fracturesb': 1, 'non-vertebral fracturesb': 1, 'Vertebral or non-vertebral fractures': 1, 'vertebral artery course anomaly': 1, 'Vertebral Injuries': 4, 'cranial or vertebral deformities': 1, 'non-traumatic vertebral and non-vertebral fractures': 1, 'vertebral morphologic anomalies': 1, 'vertebral disc pathology': 3, 'Vertebral articular joint hypoplasia': 1, 'Vertebral lesion': 9, 'vertebral necrosis of L4': 1, 'cranio-vertebral anomalies': 8, 'Vertebral Lesion 1': 1, 'Spondylocostal/spondylothoracic dysostosis': 1, 'vertebral OM': 2, 'vertebral/rib anomalies': 10, 'vertebral and cardiac abnormalities': 1, 'vertebral and associated injuries': 1, '-Vertebral Fractures': 3, 'vertebral ostemomyelitis': 1, 'hip, vertebral and other non-vertebral fractures': 1, 'vertebral column and craniofacial anomaly or syndrome': 1, 'cerebral, spinal cord or vertebral anomalies': 1, 'vertebral changes': 15, 'PVA': 9, 'lytic vertebral lesion': 10, 'hip, vertebral or non-vertebral fractures': 1, 'vertebral flexion fractures': 1, 'vertebral retropulsion': 2, 'Vertebral disease': 15, 'Vertebral burst': 1, 'vertebral osteoporostic fracture': 1, 'vertebral vein reflux': 1, 'Vertebral epiphyseodesis of': 1, 'vertebral arch fractures': 7, 'vertebral discopathies': 6, '-vertebral involvement': 1, 'discogenic vertebral sclerosis': 2, 'Discogenic vertebral sclerosis': 3, 'Thoracolumbar vertebral fracture': 5, 'vertebral-level injury': 1, 'lumbo-costovertebral syndrome': 2, 'vertebral osteopathy': 4, 'Vertebral dislocations': 6, 'vertebral augmentation': 16, 'Vertebral augmentation': 3, 'vertebral (but not non-vertebral) fractures': 1, 'VH': 6, 'coluna vertebral': 1, 'vertebral artery developmental anomalies': 1, 'VV reflux': 2, 'vertebral hyperrotation': 1, 'craniovertebral junction vertebral artery anomalies': 1, 'Posterior vertebral artery anomaly': 2, 'Developmental anomalies of thoracic and lumbosacral vertebral column': 1, 'DCVA': 1, 'Vertebral and': 1, 'vertebral/non-vertebral fractures': 5, 'Vertebral and/or non-vertebral fractures': 1, 'Congenital VA anomalies': 1, 'vertebral and cord anomalies': 1, 'vertebral patterning defects': 1, 'the vertebral a.': 1, 'increased vertebral number': 3, 'ankylosis of the costovertebral joint': 1, 'costovertebral ankylosis': 1, 'costovertebral ligamentous ossification': 1, 'pontine vertebral artery anomaly': 1, 'CVA)': 3, 'Vertebral 5': 1, 'Vertebral dysmorphism': 1, 'vertebral, and sternaldefects': 1, 'vertebral physeal injury': 1, 'vertebral transformation defects': 1, 'vertebral and scapular fracture': 1, 'Deformidad vertebral morfometrica': 4, 'VMI': 1, 'multi-vertebral fractures': 4, 'reduction in VF': 1, 'inter-vertebral disc deformity': 1, '(vertebral) fractures': 5, 'in (vertebral) fractures': 1, 'vertebral hyperextension': 2, 'non-vertebral factures': 1, 'vertebral ligaments': 2, 'disco-vertebral lesions': 9, 'cervicothoracic vertebral anomalies': 1, 'vertebral or nonvertebral fractures': 31, 'non-vertebral clinical fractures': 1, 'vertebral ones': 6, 'vertebral abnormal activity': 1, 'vertebral arches': 2, 'Costovertebral dysostosis': 1, 'NV fracture': 4, 'Non-vertebral (NV) fractures': 1, 'vertebral and NV fractures': 1, 'NV fractures': 3, 'lumbar vertebral segmentation anomalies': 1, 'vertebral and spinal anomalies': 4, 'Vertebral and spinal anomalies': 2, 'vertebral and disk malformation': 1, 'vertebral malsegmentation': 5, 'dislocation of the vertebral facet': 1, 'vertebral defor': 1, 'vertebral segmentation anomaly': 7, 'costovertebral angle (': 5, 'or vertebral': 6, 'vertebral fractured': 5, 'vertebral cortex fractures': 2, 'Vertebral Haemangioma': 6, 'STDO': 1, 'vertebral com-pression fractures': 1, 'Vertebral and Clinical Fracture': 1, 'cranio-vertebral junction anomaly': 4, 'Thoracic vertebral malformations': 1, 'vertebral angulation': 6, 'thoracic and vertebral malformations': 2, 'VHs': 4, 'thoracic vertebral anomaly': 4, 'or intraosseous vertebral artery anomalies': 1, 'extraosseous and intraosseous anomalies of vertebral arteries': 1, 'skeletal (mainly vertebral) anomalies': 1, 'extremity and vertebral fracture': 2, 'extremity and vertebral fractures': 1, 'vertebral and extremity fracture': 2, 'CVF': 6, 'vertebral and cutaneous abnormalities': 1, 'Vertebral/rib anomalies': 3, 'costovertebral joint destruction': 7, 'Costo-vertebral Angle': 1, 'CVA': 11, 'loss of vertebral and': 1, 'Spondylocostal dysostosis type 4': 3, 'vertebral function': 1, 'spondylolytic vertebral': 1, 'Vertebral hypoplasia': 5, 'Segmental vertebral anomalies': 1, 'of the Vertebral': 1, 'vertebral disc deformations': 1, 'Benign vertebral fracture': 1, 'VERTEBRATE OPIOID': 1, 'vertebral recidiva': 1, 'vessel anomalies of bilateral vertebral arteries': 1, 'Vertebral Deformity': 8, 'EXTRACRANIAL VERTEBRAL DISEASE': 1, 'Vertebral arch abnormalities': 1, 'Non-vertebral Fractures': 6, 'vertebral fractureFirst': 1, 'VERTEBRAL FORMULA': 1, 'vertebral and limb injuries': 1, 'Vertebral Anomalies and Scoliosis': 5, 'fracture vertebral': 7, 'vertebral and limb abnormalities': 1, 'VV anomalies': 1, 'VV': 7, 'VV DS': 1, 'Spondylocostal dysostosis type 3': 3, 'Delta-like 3 Spondylocostal dysostosis type 2': 1, 'vertebral disc calcificationFacetal': 1, 'spondylocostal dysostosis type 6': 1, 'mid-thoracic vertebral fracture': 1, 'to the vertebral cortex': 1, 'bony vertebral abnormality': 1, 'malposition of the costovertebral joint': 1, 'vertebral blocks': 4, 'and vertebral involvement': 1, 'vertebral or non-vertebral osteoporotic fracture': 1, 'vertebral and notochordal defects': 1, 'vertebral and upper limb anomalies': 1, 'Costovertebral angle pain': 7, 'vertebral and facial anomalies': 1, 'hypoplastic vertebral (VA) and': 1, 'damage to the common vertebral ligament': 1, 'dysplastic vertebral elements': 1, 'Vertebral Dystrophic Alterations': 1, 'vertebral beaking': 10, 'vertebral involvement 2': 1, 'vertebral scalloping': 8, 'vertebral step deformities': 1, 'vertebral or cord anomalies': 2, 'vertebral osteopaenia': 2, 'congenital thoracic vertebral anomalies': 2, 'CVAs': 2, 'Sandwich vertebral fracture': 2, 'and vertebral (': 1, 'fractures non-vertebral': 1, 'vertebral deformality': 1, 'cardiac and vertebral anomalies': 4, 'Vertebral artery course anomalies': 1, 'vertebral congenital malformations': 1, 'vertebral disc and ligament deformity': 1, 'and Jarcho-Levin': 1, 'vertebral disc calcification': 4, 'vertebral metastatic lesion': 19, 'vertebral/disc abnormalities': 1, 'Congenital vertebral duplication': 1, 'costovertebral joint disorders': 2, 'vertebral clinical fracture': 4, 'vertebral dislocation injury': 1, 'vertebral clinical fractures': 1, 'DCVO': 2, 'vertebral discprotrusion': 1, 'brucellar vertebral VO': 1, 'BVO': 1, 'Non-Vertebral Fractures': 6, 'and non-vertebral fracture': 14, 'de developpement vertebral;': 1, 'Oculoauriculo-vertebral spectrum': 1, 'Bleeding from the vertebral venous': 1, 'vertebral metastatic': 2, 'vertebral index fractures': 1, 'of vertebral ligaments': 1, 'Amyelic vertebral fractures': 2, 'and vertebral fracture': 5, 'pathological vertebral disc': 1, 'vertebral and midfoot fractures': 1, 'Jarcho-': 1, 'Traumatic Vertebral Fracture': 2, 'Anomaly of Bilateral Vertebral Arteries': 1, 'reduction in vertebral high': 1, 'renal, vertebral, and testicular anomalies': 1, 'T12 vertebral fracture': 13, 'vertebral differences': 1, 'vertebral fracture reduction': 10, 'Muscular Vertebral anomalies': 1, 'Vertebral and/or rib anomalies': 1, 'vertebral column anomalies': 14, 'nonvertebral and vertebral fracture': 1, 'defects of the vertebral alignment': 1, 'multiple vertebral': 2, 'vertebrate and': 1, 'cervico-vertebral, and rib anomalies': 1, 'vertebral disks': 2, 'Dorsolumbar vertebral dislocations': 1, 'vertebral and other developmental defects': 1, 'asymmetrical vertebral joints': 1, 'vertebral fracture not otherwise': 1, 'VP': 4, 'Multiple vertebral involvement': 2, 'vertebral involvement of': 2, 'Vertebral Diseases': 2, 'vertebral-related diseases': 1, 'vertebral related diseases': 1, 'Vertebral Related Diseases': 1, 'Vertebrate diseases': 1, 'vertebral morphologic lesions': 1, 'Vertebral problems': 2, 'vertebral artery (VA) anomaly': 8, 'Vertebral Dysfunction': 1, 'vertebral dysfunctions': 2, 'Maldevelopment anomalies of the vertebral arteries': 1, 'NonVFs': 1, 'osteoblastic-related metastatic vertebral lesions': 1, 'Osteoblastic-Related Metastatic Vertebral Lesions': 1, 'vertebrate diseases': 15, 'vertebral collapsea': 1, 'vertebral arthrodeses': 1, 'vertebral and non-vertebral (including hip) fractures': 4, 'vertebral disk hardening': 1, 'vertebrate deformed': 1, 'Vertebral osteoperosis': 1, 'clinical vertebral fractures': 2, 'vertebral hemangiomatosis': 1, 'vertebral disk': 5, 'congenital familial extensive vertebral anomalies': 1, 'CFEVA': 1, 'Cranio-vertebral junction anomalies': 1, '-vertebral junction': 6, 'benign vertebral fractures': 3, 'vertebral pedicle fracture': 3, 'vertebral pedicle injuries': 1, 'vertebral alignment': 3, 'vertebral destroyed': 1, 'congenital vertebral, cardiac, and renal anomalies': 1, 'pelvis/vertebral injuries': 1, 'VERTEBRATE CELL': 1, 'anomalies of the VA': 3, 'vertebral artery (VA) anomalies': 14, 'vertebral, non-vertebral and hip fracture': 2, 'costovertebral lesion': 3, 'costovertebral dislocation': 2, 'vertebral or basilar disease': 1, 'vertebral primary': 1, 'Vertebral disc': 3, 'vertebral and paravertebral muscle disease': 1, 'costo-vertebral defects': 1, 'and vertebral lesions': 1, 'metastatic vertebral fractures': 3, 'ankylosis of the costovertebral joints': 6, ', and non-vertebral fractures': 2, 'vertebral and/or extra-vertebral fractures': 1, 'vertebral-anomalies syndrome': 4, 'ocular and vertebral anomalies': 1, 'vertebral, and non-vertebral fractures': 9, 'hip, vertebral, and non-vertebral fractures': 13, 'thoracolumbar vertebral hypoplasia': 1, 'osteolytic metastatic vertebral fractures': 1, 'congenital anomalies of the vertebral column': 2, 'Congenital Vertebral Anomalies': 3, 'congenital vertebral column anomalies': 1, 'arthritis of costovertebral joints': 1, 'vertebral, epiphyseal, and metaphyseal anomalies': 1, 'vertebral/non-vertebral osteomyelitis': 1, 'nonvertebral and vertebral fractures': 7, 'left costovertebral pain': 1, 'Multiple congenital vertebral anomalies': 1, 'PVL-O': 1, 'PVL': 1, 'vertebral hyperosteogeny': 1, 'congenital or traumatic anomalies in the VA': 1, 'Vertebral cleft': 1, 'hip, vertebral, and non-vertebral fracture': 3, 'vertebral osteocondensation': 1, 'vertebral and/or spinal cord anomalies': 1, 'spinal cord or vertebral anomalies': 2, 'autosomal recessive SCD': 2, 'vertebral bone anomaly': 1, 'vertebral functional impairment': 1, 'vertebral, cardiac, renal, limb anomalies': 4, "vertebrate's diseases": 2, 'vertebral canal lesions': 1, 'mVF': 2, 'vertebral involvementby': 1, 'PVC': 1, 'CVJ anomalies': 7, 'Cranio-Vertebral Junction Anomalies': 1, 'Vertebral anomalies Myelodysplasia': 1, 'vertebral morphometric fracture': 2, 'vertebral or disco-vertebral lesion': 1, 'VF reduction': 2, 'inter-vertebral disorders': 1, 'vertebral, non-vertebral, or hip fractures': 1, 'anal, vertebral, or uterine anomaly': 1, 'vertebral laminar defects': 1, 'vertebral OOs': 1, 'vertebral lombalgia': 1, 'porotic vertebral fracture': 1, 'Vertebral fracturea': 2, 'PHYLOGENESIS OF VERTEBRATES': 1, 'vertebral and cardiac anomalies': 3, 'Costo-vertebral echinoccoccus': 1, 'Thoracic Vertebral Fractures': 3, 'Bisystolic Vertebral': 1, 'vertebral injury or disease': 1, 'osseous vertebral abnormality': 1, 'benign vertebral haemangiomas': 1, 'vertebral collapseof': 1, 'Vertebral fracture#2': 2, 'Vertebral and Nonvertebral Fractures': 1, 'Vertebral fracture"[All': 1, 'vertebral elements fracture': 1, 'vertebral, anal, tracheoesophalangeal and renal (VATER) anomalies': 1, 'inter-vertebral disease disorders': 1, 'of the vertebral': 4, 'Vertebral deformity type 1': 1, 'VKA': 1, 'congenital vertebral body anomalies': 1, 'injuries of the vertebral arteria': 1, 'injuries to the vertebral arteria': 1, 'vertebral arteria injury': 1, 'Vertebral arteria injury': 1, 'vertebral Fracture': 4, 'Multilevel vertebral anomalies': 2, 'vertebrate injuries': 1, 'SCD type 2': 2, 'vCNEs': 1, 'costovertebral rigidity': 1, 'fractures of the vertebral spinous apophyses': 1, 'osteolytic vertebral stiffness': 1, 'osteolytic vertebral': 2, 'facial and vertebral abnormalities': 1, 'Vertebral sclerosis': 6, 'Vertebral diseases': 4, 'vertebral and disc': 2, 'vertebral metastatic disease': 12, 'vertebral and digit malformations': 1, 'vertebral-basilar malformation': 1, 'dorsolumbar vertebral fracture': 1, 'vertebral joint arthropathy': 1, 'vertebral fracture or deformity': 4, 'fractures other than vertebral': 1, 'flexion-distraction vertebral injury': 1, 'metastatic vertebral lesion': 3, 'VB': 3, 'vertebral (VB) fracture': 1, 'vertebral fracturesnephrolithiasis': 1, 'myelo-vertebral malformations': 2, 'VO': 2, 'vertebral osteotome': 1, 'vertebral and clinical fracture': 2, 'Vertebral Fractures and': 2, 'VF 4': 1, 'diseases of the vertebral canal': 1, 'osteoporotic vertebral anomalies': 1, 'vertebral joint osteoplasia': 1, 'vertebral radiographic fractures': 2, 'fractura vertebral': 3, 'Vertebral Fractureb': 2, 'vertebral (thoracic) fracture': 2, 'reduction in vertebral (and non-vertebral) fractures': 2, 'vertebral process': 2, 'vertebral canal widening': 1, 'congenital deteriorated vertebral disc': 1, 'vertebral discomfort': 1, 'pharyngo-vertebral crepitus': 1, 'vertebral and nonvertevral fractures': 1, 'ossification anomalies of the vertebral column': 1, 'vertebral, rib, and intraspinal anomalies': 3, 'Vertebral, rib, and intraspinal anomalies': 1, 'vertebral and intraspinal anomalies': 1, 'vertebral, rib and intraspinal anomalies': 1, 'Vertebral Fracture and': 1, 'vertebral fresh fracture': 1, 'vertebral apophyseal fracture': 1, 'anomalies of vertebral column': 2, 'vertebral haemangioma like': 1, 'VH lesions': 1, 'disc or vertebral fracture': 1, 'vertebral and fin abnormalities': 1, 'cranial, fin and vertebral abnormalities': 1, 'Vertebral remodelling': 2, 'vertebral arch disturbances': 1, 'congenital anomaly of the lower vertebral column': 2, 'vertebral and non-vertebral osteoporosis': 1, 'costovertebral arthropathy': 3, 'Fracture of the transverse vertebral apophysis': 1, 'vertebral-renal-limb anomalies': 1, 'VRL': 1, 'VCRL': 1, 'vertebral, cardiac, renal, and limb anomalies': 2, 'vertebral recurrence': 3, 'vertebral traction': 3, 'malformations of the occipito-vertebral joint': 3, 'VERTEBRAL DISK DISEASES': 1, 'VERTEBRAL ANOMALIES': 2, 'vertebral canal haematoma': 3, 'Vertebral disc fractures': 1, 'vertebral, and other fracture': 1, 'vertebral or vascular anomalies': 1, 'vertebral stenotic myelopathy': 11, 'Vertebral anomaly 1': 1, 'cranio-vertebral junction anomalies': 8, 'vertebral level injury': 1, 'RVF': 6, 'skeletal and vertebral defects': 2, 'reflux in the jugular or vertebral vein': 1, 'osteoporotic vertebral, hip and non-vertebral fractures': 1, 'vertebral arch fracture': 6, 'burst injury of the vertebral': 1, 'vertebrate hoarding': 1, 'vertebral Fx': 1, 'VFx': 1, 'vertebral osteoarthropathy': 4, 'vertebral haemangioma of Th11': 1, 'auditory and vertebral anomalies': 1, 'PVR': 1, 'vertebral bleeding': 1, 'in vertebral': 1, 'Metastatic vertebral lesions': 1, 'craniofacial, vertebral anomalies': 1, 'Vertebral haemangiomatosis': 1, 'vertebral or disco-vertebral lesion of the spine': 2, 'interforaminal vertebral artery anomalies': 1, 'craniofacial, tracheal, pulmonary, vertebral, renal, lower limb anomalies': 1, 'vertebral body and rib anomalies': 1, 'Jarcho-Levine syndrome': 4, 'nonvertebral or vertebral fracture': 3, 'vertebral dysmorphism': 2, 'skeletal or vertebral disease': 1, 'VC': 2, 'vertebral morphological anomalies': 1, 'vertebral bony abnormalities': 3, 'craniofacial, tracheal, pulmonary, vertebral, renal and lower limb anomalies': 1, 'Vertebral Metastatic Lesions': 1, '-vertebral and vertebral fractures': 4, 'scapular and vertebral defects': 1, 'Scapular and vertebral defects': 1, 'vertebral, epiphyseal and metaphyseal anomalies': 2, 'archosauromorph vertebral pathology': 1, 'Spondylocostal Dysostosis Type 3': 1, 'vertebral angionomas': 1, 'idiopathic vertebral sclerosis': 3, 'Vertebral Sclerosis': 2, 'costovertebral angle (CVA) pain': 1, 'Vertebral arthrodesis': 1, 'cardiac, vertebral or ophthalmological abnormalities': 1, 'AVFs': 6, 'vertebral slippages': 2, 'I-VFs': 1, 'i-VFs': 2, '-VFs': 1, 'vertebral spongiosis': 1, 'radial, renal and vertebral anomalies': 1, 'AVS': 1, 'vertebral discs': 3, 'congenital anomaly of the vertebral artery': 1, 'vertebral and other skeletal anomalies': 2, 'Benign vertebral fractures': 1, 'Benign vertebral lesions': 1, 'vertebral and other': 4, 'VERTEBRAL FRACTURES': 5, 'vertebral or discovertebral lesions': 1, 'vertebral disc injury': 2, 'thoracolumbar vertebral injury': 1, 'vertebral hypoperfusion': 2, 'VERTEBRAL SPINOUS PROCESSES': 1, 'maldevelopment of the costovertebral junctions': 1, 'Congenital anomalies of the vertebral arteries': 1, 'Vertebral necrosis': 1, 'the vertebral': 3, 'vertebral pedicle duplication': 1, 'Duplication of Vertebral Pedicles': 1, 'orthopedic and vertebral anomalies': 1, '-vertebral disc herination': 1, 'vascular anomalies of the vertebral disc': 1, 'Congenital vertebral deformities': 4, 'nonvertebral or vertebral fractures': 1, 'fracture of vertebral bodyPosterior': 1, 'vertebral replacement': 4, 'vertebral disorders and injuries': 1, 'vertebral myelopathies': 1, 'Vertebral canal impingement': 1, 'gibbus with vertebral beaking': 1, 'VERTEBRAL OSTEOARTHROPATHY': 1, 'loss of vertebral strength': 1, 'of the vertebral arch': 2, 'vertebral arteriostenosis': 1, ', and vertebral fractures': 4, 'multiple vertebral defects': 1, 'cervicodorsal vertebral anomalies': 1, 'Spondylocostal dysostosis 2': 3, 'vertebral fractureb': 3, 'vertebral fracturec': 4, 'vertebral osteoclastoma': 1, 'deformity of the vertebral alignment': 1, 'Vertebritis': 1, 'left vertebral disease': 1, 'vertebral or hip/vertebral fracture': 1, 'Vertebral kyphotic deformity': 1, 'costo-vertebral limitation': 1, 'vertebral fracturea': 3, 'vertebral by fractures': 1, 'VERTEBRAL PEDICLES': 1, 'Vertebral pathologies': 4, '-TRAUMATIC VERTEBRAL NECROSIS -': 1, 'of vertebral vascularity': 1, 'tail vertebral disease': 1, 'Traumatic Vertebral Fractures': 2, 'vertebr al fracture': 1, 'thoracic and vertebral anomalies': 1, 'TLVF': 1, 'vertebral/hip anomalies': 3, 'vertebral lamina fractures': 2, 'vertebral, spinal, skeletal, cardiovascular, and gastrointestinal anomalies': 1, 'T12 vertebral fractures': 1, 'Costovertebral tenderness4': 1, 'OPERATIVE TREATMENT OF VERTEBRAL': 1, 'dystrophic vertebral defects': 1, 'Vertebral fusion anomalies': 4, 'pain in the costovertebral angle': 1, 'vertebral complaints': 2, 'vertebral gibbus': 1, 'ankylosis in the costovertebral joints': 1, 'costovertebral joint fusion': 3, 'hyperostosis of costovertebral joint': 1, 'costovertebral synostosis': 1, 'vertebral platyspondylia': 2, 'vertebral hyperextension injuries': 1, 'lumbosacral vertebral anomalies': 3, 'lumbosacral vertebral anomaly': 1, 'VI of OVFs': 1, 'congenital spinal cord and vertebral anomalies': 1, 'rib and vertebral body anomalies': 4, 'Vertebral and spinal related anomalies': 1, 'costovertebral angle pain or': 3, 'Vertebral Defects': 3, 'vertebral level of injury': 2, 'VERTEBRAL BONE': 1, 'costovertebral and thoracic conditions': 1, 'vertebral and renal anomalies': 5, 'vertebral bursts': 1, 'vertebral and the': 1, 'rib and vertebral anomaly': 1, 'vertebral and more specifically': 1, 'mono-vertebral lesion': 1, 'Thoracolumbar Vertebral Fractures': 4, 'decreased vertebral': 2, 'facio-auriculo-vertebral anomaly': 1, 'Vertebral arch defects': 1, '-related metastatic vertebral lesions': 1, 'osteolytic vertebral fracture': 1, 'vertebral deterioration': 2, 'MVZ': 3, 'vertebral canal compromise': 1, 'vertebral morphometric fractures': 2, 'vertebral neoplastic lesions': 3, 'rib, sternal, and vertebral anomalies': 1, 'osteomalacic vertebral fracture': 1, 'vertebral-arch defects': 3, 'than vertebral': 1, 'Vertebral Dystrophic': 1, 'vertebral dystrophies': 1, 'Vertebral scalloping': 2, 'vertebral dystrophic changes': 1, "Jarcho-Levin's": 1, 'vertebral fracture injury': 3, 'Cranio - vertebral anomaly - type II basilar invagination': 1, 'loss in vertebral': 1, 'dysostosis 6': 1, 'Vertebral lumbalgias': 1, 'NVFs': 10, 'Spondylocostal Dysostosis type 3': 2, 'Spondylocostal Dysostosis 3': 2, 'Vertebral bulge': 1, 'non-vertebral skeletal anomalies': 2, 'vertebral/musculoskelettal disorders': 1, 'Pigmenti Jarcho-Levin syndrome': 1, 'vertebral limbus fracture': 2, 'Adjacent Vertebral Diseases': 1, 'vertebral fracturesn': 1, 'Vertebral fracturesn': 1, 'vertebral fracturesMedian': 1, 'VIS damage': 1, 'Vertebral Joint Problems': 1, 'aortic and vertebral injury': 1, 'vertebral corpus deformity': 1, 'vertebral corpus defects': 1, 'biconcave vertebral deformity': 1, 'costovertebral joint dislocation': 6, 'vertebral disc replacement': 3, 'CVJ lesions': 1, 'ankylosis of the CVJ': 1, 'SCDO3': 3, 'Spondylocostal Dystosis Type 3': 1, 'vertebral fractureParental': 1, 'vertebral, cardiac, renal and limb anomalies': 3, 'vertebral joint injuries': 1, 'Modest left costovertebral angle tendernessMild': 1, 'vertebral-basilar vasculopathy': 1, 'familial spondylothoracic dysostosis': 1, 'vertebral blockade': 2, 'anomalies in vertebral columns': 1, 'anomalies of intestines and vertebral column': 1, 'COSTOVERTEBRAL ANGLE PAIN': 1, 'vertebral or spinal cord anomalies': 4, 'Vertebral fracture deformities': 1, 'Vertebral and Vertebral Fractures': 1, 'VMs': 2, 'and Vertebral malformation': 1, 'vertebral level fracture': 1, 'vertebral shape abnormalities': 1, 'Thoracic Vertebral Fracture': 7, 'Costovertebral dysplasia': 7, 'vertebral arteria lusoria': 3, 'vertebral cortical defect': 1, 'Vertebral and intervertebral defects': 1, 'VERtebral fractures': 1, 'VERTEBRAL PEDICLES PATHOGNOSTIC': 1, 'vertebral nerve disorders': 1, 'non-vertebral) fractures': 1, 'vertebral and craniofacial deformities': 1, 'vertebral only disease': 1, 'VA disease': 2, 'fracture shaped vertebral deformity': 1, 'FSVD': 1, 'VDs': 6, 'spondylothoracic dysotosis': 1, ', vertebral, or': 1, 'vertebral corrosion': 1, 'vertebral and clinical': 5, 'Vertebral junction disease': 1, 'Bellusaurus IVPP': 1, 'vertebral conditions': 1, 'vertebral numerical anomaly': 1, 'lytic vertebral and': 1, 'vertebral segmental anomalies': 2, 'ophthalmological and vertebral defects': 1, 'congenital thoracic vertebral deformity': 2, 'vertebral (V) fracture': 1, 'vertebral (': 8, 'Lytic vertebral lesions': 3, 'vertebral, non vertebral and hip fractures': 2, 'vertebral hump': 4, 'spinal and vertebral anomalies': 3, 'L5 vertebral slippage': 1, 'vertebral anomalies syndrome': 3, 'orofacial and vertebral anomalies': 1, 'thoracolumbar vertebral deformity': 1, 'chest wall, craniofacial, vertebral, and lung anomalies': 1, 'vertebral tiny fracture': 1, 'vertebral peudarthrosis': 1, 'vertebral and cranial abnormalities': 2, 'L4 vertebral fracture': 6, 'digit and vertebral malformations': 4, 'and vertebral malformations': 1, 'CLONED NON-VERTEBRATE': 1, 'juvenile vertebral deformity': 1, 'vertebral sacrifice': 2, 'vertebral marrow changes': 1, 'Vertebral Lesions': 7, 'thoracolumbar vertebral bursh fracture': 1, 'vertebral or non-vertebral bone fracture': 2, 'spondylothoracic': 2, 'Vertebral Fracturea': 1, 'vertebral element fractures': 1, 'bony vertebral abnormalities': 3, 'vertebral non-traumatic fracture': 1, 'spondylocostal dysostosis type 2': 2, 'vertebral and genital anomalies': 2, 'vertebral dysraphic anomalies': 2, 'vertebral, renal and other anomalies': 1, 'cranial and vertebral defects': 2, 'vertebral platyspondyly': 7, 'Vertebral clefts': 1, 'vertebral osteomyeltis': 3, 'vertebral syndesmophytes': 3, 'recessive disorder Complex Vertebral Malformation': 1, 'SMALL VERTEBRATES': 1, 'vertebral oedema': 3, 'fractured vertebral canale': 1, 'vHH': 1, 'lumbar vertebral anomaly': 3, 'low vertebral and sacral anomalies': 1, 'Vertebral and dental anomalies': 1, 'fracture of the vertebral epiphysis': 1, 'skeletal/costovertebral deformities': 1, 'vertebral:': 1, 'disk and vertebral abnormalities': 1, 'vertebral disk abnormality': 1, 'vertebral enoplate injury': 1, 'vascular anomalies of the VA': 1, 'inter)vertebral calcification': 1, 'vertebral mineralization': 2, 'vertebral deformation disease': 1, 'joint and vertebral fractures': 1, 'pontine vertebral artery (VA) anomaly': 1, 'Vertebral and rib anomalies': 1, 'con fractura vertebral': 1, 'biopsia vertebral': 1, 'conocida lesion vertebral': 1, 'Vertebral fracturereduction': 1, 'vertebral, cardiovascular, renal or limb anomalies': 1, 'Fractures of the vertebral limbus': 1, 'fractures of the vertebral limbus': 1, 'inflammatory vertebral lesions': 1, 'vertebral index': 1, 'Vertebral fracturesa': 2, 'VT': 9, 'Vertebral artery anomaly': 6, 'Cranio-vertebral Anomalies': 1, 'osteoporotic (vertebral and non-vertebral) fractures': 1, 'vertebral, non-vertebral, hip, wrist and other fractures': 1, 'vertebral and low-trauma non-vertebral fracture': 1, 'vertebral, non-vertebral or hip fracture': 1, 'vertebritis': 6, 'VERTEBRAL ANGIOGRAPHY': 2, 'vertebral pathologic changes': 1, 'CVLL': 2, 'vertebral shape anomalies': 3, 'vertebral fracturesMultiple': 1, 'vertebral,non-vertebral, and hipfractures': 1, 'vertebral, non-vertebral, and hipfractures': 1, 'Jarcho-Levin and Rokitansky syndromes': 1, 'vertebral, hip and non-vertebral fracture': 2, 'vertebral was destroyed': 1, 'vertebral affection': 2, 'cardiac, vertebral, and eye anomalies': 1, 'vertebral osteochondropathy': 1, 'T12 vertebral anomaly': 1, 'Extra vertebral calcification': 1, 'congenital malformation of the vertebral canal': 1, 'vertebral and extremity fractures': 2, 'congenital anomalies of vertebral body': 1, 'spinal/vertebral anomaly': 1, 'Spinal/vertebral anomaly': 1, 'spinal/vertebral anomalies': 2, 'inter-vertebral disc injuries': 1, 'ANCIENT VERTEBRATE': 1, 'vertebral impairment': 3, 'of vertebral posterior': 1, 'vertebral and visceral damage': 1, 'vertebral or skeletal fractures': 1, 'vertebral marrow adiposity': 1, 'vertebral fractures7': 1, 'vertebral fracture6': 1, 'Vertebral density loss': 1, 'vertebral density': 1, 'VD loss': 1, 'vertebral density loss': 1, 'vertebral notching': 1, 'vertebral dorsalgia': 1, 'vertebral and digital anomalies': 2, 'skeletal (vertebral) malformations': 1, 'vertebral anomalies and variable endocrine and T cell dysfunction': 1, 'vertebral transformation': 1, 'VF+': 1, 'Thoracolumbar Vertebral Fracture': 2, 'fracture of the superior vertebral disc': 1, 'vertebral or discovertebral lesion': 3, 'Costovertebral joint 4': 1, 'Costovertebral joint 7': 1, 'Costovertebral joint 1': 1, 'non-vertebral and vertebral fractures': 5, 'vertebral and epiphyseal changes': 1, 'cardiovascular, gastrointestinal and vertebral anomalies': 1, 'vertebral, cardiac, urological and otological anomalies': 1, 'Vertebral Artery Anomalies': 2, 'non-vertebral fractureVit D': 1, 'DUVS': 1, 'Vertebral Slippage': 1, 'vertebral and/or nonvertebral fracture': 1, 'vertebral metastatic fracture': 1, 'encephalic, vertebral, visceral or limb anomalies': 1, '-vertebral angle (CVA) tenderness': 1, 'vertebral benign lesion': 1, "L'hemangiome vertebral": 1, 'vertebral level injuries': 2, 'epiphyseal and vertebral malformations': 1, 'post-fracture vertebral changes': 1, 'Jarcho-Levin- Syndrome': 1, 'sclerosis of the vertebral endplate and vertebral body': 1, 'Vertebral slippage': 3, 'Congenital anomalies of the occipito-vertebral joint': 1, 'vertebral number variations': 1, 'Metastatic Vertebral Fracture': 2, 'vertebral arch': 3, 'Vertebral osseous haemangiomas': 1, 'anomalies of vertebral artery': 4, 'Posterior vertebral injury': 1, 'Vertebral osteoclastoma': 1, 'vertebral artery anomaly at the': 1, 'vertebral disk involvement': 2, 'vertebral arch anomaly': 1, 'vertebral/vascular anomalies': 1, 'axis and/or vertebral body anomalies': 1, 'vertebral centra anomalies': 1, 'spinal or vertebral anomalies': 2, 'vertebral and sacral anomalies': 2, 'thoracolumbar vertebral anomalies': 2, 'Vertebral fracture burden': 1, 'Vertebral Fracture Burden': 1, 'vertebral fracture burden': 1, 'digital and vertebral anomalies': 1, 'osteoblastic vertebral lesion': 2, 'thoracolumbar vertebrate fractures': 1, 'thoracolumbar vertebrate fracture': 2, '-vertebral clefts': 1, 'or vertebral (n': 2, 'Vertebral condition': 1, 'N vertebral condition': 1, 'vertebral or other fracture': 1, 'vertebral and other-related fractures': 1, 'malig- nant vertebral fracture': 1, 'the vertebral curve': 1, 'vertebral instabilityClinical': 1, 'spondylocostal dysostosis type 3': 4, 'Spondylocostal dysostosis 6': 2, 'SCDO4': 4, 'Autosomal recessive SCDO': 1, 'SCDO2': 1, 'Spondylocostal dysostosis 4': 3, 'Spondylocostal dysostosis type 6': 1, 'Spondylocostal dysostosis type 2': 1, 'SCDO6': 1, 'Spondylocostal dysostosis 3': 1, 'osteolytic vertebral fractures': 5, 'vertebral AVF': 1, 'Vertebral joint': 1, 'spinal cord and vertebral anomalies': 2, 'Vertebral radiologic lesions': 1, 'Costovertebritis': 1, 'costovertebritis': 1, 'vertebral body anomaly': 4, 'vertebral physis fracture': 1, 'vertebral or vertebral fractures': 1, 'vertebral manipulation': 4, 'vertebral) lesions': 1, 'Vertebral disproportion': 1, 'vertebral disproportion': 1, 'vertebral inflammatory lesions': 3, 'IVVP': 1, 'malformation of the occipito-vertebral joint': 1, 'vertebral and non-vertebral pathological fractures': 1, 'vertebral canal haemangioma': 1, 'congenital vertebral disease': 2, 'vertebral nerve blockade': 1, 'Vertebral traction': 1, 'vertebral and lower extremity defects': 1, 'costovertebral deformities': 2, 'thoracical vertebral malformations': 1, 'SCD type 4': 1, 'SCD type 3': 1, 'Vertebral bone oedema': 2, 'amyelic vertebral fractures': 3, 'vertebral physeal fracture': 2, 'EO-AVF': 1, 'EO-AVFs': 1, 'Adjacent Vertebral Fracture': 1, 'sVF': 1, 'vertebral capillary damage': 1, ', jaw, and vertebral axis anomalies': 1, 'deformities of vertebral centra': 1, 'cranial and vertebral axis anomalies': 1, 'Vertebral changes': 2, 'Vertebral Fracture^': 1, 'cortex of vertebral': 1, 'Costovertebral degenerative changes': 1, 'Vertebral Epiphyses': 1, 'distal vertebral hypoplasia': 1, 'vertebral transverse fractures': 1, 'abnormalities of the vertebral centrum': 1, 'vertebral/endplate anomalies': 1, 'congenital vertebral development anomaly': 1, 'vertebral transposition': 3, 'renal and sometimes vertebral anomalies': 1, 'Jeholornis prima IVPP': 1, 'IVPP::is': 1, 'multiple combined anomaly of the vertebral vessels and': 1, 'anomaly of the right vertebral artery': 1, 'vertebral limbus': 1, 'avulsion of the vertebral limbus': 1, 'Vertebral distraction': 1, 'Para-vertebral swelling': 1, 'Vertebral Nonunion': 1, 'costovertebral angle knocking pain': 1, 'IVPP V 18139.20': 1, 'vertebral kyphotic deformations': 1, 'vertebral fracture.8': 1, 'thoracic costovertebral dysplasia': 1, 'vertebral fracture clefts': 1, 'Vertebral fracture cleft': 1, 'vertebral dissemination': 3, 'vertebral fracture of thoracolumbar junction': 1, 'VDI': 1, 'FSVDs': 2, 'Fracture shaped vertebral deformities': 2, '-VF': 1, 'vertebral traumatic fractures': 1, 'deformity of the vertebral canal': 1, 'pyogenic vertebral osteomylitis': 1, 'vertebral hypoplastic': 1, 'hypoplastic vertebral': 1, 'costovertebral tunnel': 1, 'vertebral process injuries': 2, 'VM Vertebral Malformation': 1, 'hip, non-vertebral, vertebral, and wrist fractures': 1, 'spondylothoracic dysostosisform': 1, 'vertebral morphological defects': 1, 'decrease in vertebral': 1, 'vertebral and muscular anomalies': 1, 'vertebral and overall fracture': 1, 'SAIV': 1, 'vertebral congenital anomalies': 2, 'to vertebral circumference': 1, 'abnormalities of vertebral': 1, 'vertebral arch anomalies': 2, 'multiple rib and vertebral anomalies': 3, 'vertebral brocostal malformations': 1, 'vertebral deformity or': 1, 'Vertebral Dislocation': 3, 'impaired vertebral function': 1, 'vertebral movement imbalance': 1, 'Vertebral fractures': 1, 'costovertebral paraganglioma': 1, 'skeletal and vertebral anomalies': 1, 'vertebral skeletal fractures': 1, 'non-vertebral (': 1, 'vertebral or spine anomalies': 1, 'vertebral angiogaphy': 1, 'vertebral radiological deformities': 1, 'Posterior vertebral element fractures': 1, 'Vertebral Lesion': 2, 'vertebral disease of': 1, 'vertebral fracture/disc injury': 1, 'vertebral and extravertebral disease': 1, 'pain of the costovertebral angle': 1, 'or non-vertebral fractures': 1, 'Congenital Thoracic Vertebral Malformations': 2, 'vertebral congenital malformation': 1, 'congenital thoracic vertebral malformations': 3, 'costal and vertebral anomalies': 4, 'and Vertebral': 1, 'vertebral, and extremities fractures': 1, 'Vertebral arteria lusoria': 2, 'VCR': 1, 'Non-vertebral': 1, 'Vertebral pseudometastases': 1, 'Vertebral canal haematoma': 4, 'VCH': 1, 'V.F.s': 1, 'limb and vertebral column anomalies': 1, 'brain and vertebral anomalies': 1, 'vertebral disability': 1, 'vertebral condition': 3, 'Osteotomized vertebral': 2, 'thoracolumbar (TL) vertebral fractures': 1, 'vertebral column anomaly': 1, 'vertebral hermangiomata': 1, 'VU': 2, 'vertebral and discovertebral lesions': 1, 'Vertebral osteomyelitisBursitis': 1, 'Vertebral fracturen': 1, 'Vertebral arthropathy': 1, '- - - - - - Non-vertebral fracture': 1, 'vertebral osteal lesion': 1, 'autosomal recessive spondylocostal dysostosis 3': 2, 'benign vertebral lesion': 1, 'biconcave VF': 1, 'EXTRAPERITONEAL VERTEBRAL': 1, 'anomalies of the vertebral artery': 6, 'congenital vertebral bone anomalies': 1, 'VF deformities': 1, 'ostial lesion of the vertebral': 1, 'vertebral muscle damage': 1, 'vertebral metastas': 1, 'vertebral and adjacent fractures': 2, 'Vertebral Disorders': 2, 'anomalies of vertebral column, ribs and hips': 1, 'Vertebral Anomaly': 2, 'vertebral amyloidomas': 1, 'vertebral, hip, and non-vertebral fracture': 1, 'vertebral) fracture': 2, 'vertebral deposits': 1, 'autosomal recessive spondylocostal dysostosis type 3': 1, 'Vertebral fractureMotor': 1, 'vertebral biconcave deformity': 2, 'deficiency of VLK': 1, 'ochronotic vertebral disease': 1, 'vertebral and disk deformities': 1, 'osseous and especially vertebral abnormalities': 1, 'vertebral variations': 3, 'vertebral and a nonvertebral fracture': 1, 'craniofacial and vertebral deformities': 2, 'vertebral slippage reduction': 1, 'C1 vertebral anomalies': 1, 'abnormality of the vertebral canal': 1, 'vertebral, anorrectal': 1, 'Costovertebral hydatid involvement': 1, 'Cardiac, vertebral and palatal anomalies': 1, 'cervicothoracic vertebral malformations': 1, 'vertebral and/or spinal anomalies': 1, 'vertebral stenotic myelopathy (': 1, 'vertebral (specifically tail) deformities': 1, 'Vertebral Malformations': 6, 'facet and costovertebral joint degeneration': 1, 'vertebral or conus anomaly': 1, 'vertebral, digital and genital anomalies': 1, 'Vertebral and Non-vertebral fracture': 1, 'and shear vertebral injuries': 1, 'Vertebral Injury': 1, 'intra-vertebral damage': 1, 'limb or vertebral fractures': 1, 'Limb or vertebral fractures': 1, 'vertebral osteopathies': 1, '/non-vertebral fractures': 1, 'defects of the vertebral arch': 1, 'Jarcho - Levin syndrome': 1, ', facial, vertebral': 1, 'vertebral spine anomalies': 1, 'VERtebral FRACtures': 1, 'vertebral neural malformations': 1, 'Vertebral/spinal anomalies': 1, 'vertebral arthroplasties': 1, 'lumbar/sacral vertebral anomalies': 1, 'Vertebral osteomylitis': 1, 'CVFs': 4, 'vertebral burst': 1, 'costovertebral injuries': 1, 'Dislocation of the costovertebral joint': 1, 'thoracic costovertebral joints fracture-dislocations': 1, 'dislocations of thoracic costovertebral joints': 1, 'dislocations of multiple thoracic costovertebral joints': 1, 'vertebral bundle damage': 1, 'spondylothoracic and spndylocostal JLS': 1, 'Juxta-vertebral lesions': 2, 'juxta-vertebral lesions': 2, 'Juxta-vertebral Lesions': 1, 'spinal vertebral body anomalies': 1, 'vertebral fractures:0': 1, 'costovertebral joint dysfunctions': 1, 'Costovertebral joint dysfunction': 1, 'vertebral refractures': 3, 'vertebral factures': 5, 'dislocation of costovertebral joints': 3, 'vertebral imbalances': 1, 'costovertebral angle tendernessAcute': 1, 'increase in vertebral': 1, 'ligamentous and vertebral lesions': 1, 'anomalies of the extracranial vertebral arteries': 1, 'vertebral centra deformity': 1, 'Vertebral Centra Deformities': 1, 'vertebral disc reductions': 1, 'osteoporotic vertebral and non-vertebral fractures': 3, 'vertebral malsegmentation defects': 2, 'AMONG VERTEBRATE': 1, 'VERTEBRAL-': 1, 'Vertebral pseudolesion': 1, 'vertebral pseudolesion': 1, '-vertebral angle': 2, 'VF-': 1, 'vertebral, and nonvertebral fracture': 1, 'facial and vertebral anomalies': 2, 'posterior vertebral abnormalities': 1, 'spondylothoracic deformities': 1, 'vertebral joint deformities': 1, 'postosteoporotic vertebral fractures': 1, 'OF VERTEBRAL DISK': 1, 'traumatic lesions of vertebral ligaments': 1, 'Vertebral/Skeletal anomalies': 1, 'costo-vertebral fractures': 1, 'costovertebral fracture': 1, 'ear and vertebral anomalies': 1, 'costovertebral arthritis': 3, 'arthritis of the costovertebral joint': 1, 'chiropractic vertebral': 1, 'Chiropractic Vertebral': 1, 'vertebral body segmentation anomaly': 1, 'dystrophic vertebral': 1, 'dystrophic vertebral changes': 1, 'vertebral, anal, and cardiac anomalies': 1, 'vertebral than': 1, 'thoracic (T6-T11) vertebral malformations': 1, 'vertebral or ligamentous injury': 1, 'vertebral ligament damage': 1, 'unilateral vertebral defects': 1, 'benign vertebral fracture': 2, 'VERTEBRATE LENS': 1, 'costovertebral abnormality': 1, 'Costovertebral abnormality': 1, 'congenital rib and vertebral anomalies': 1, 'vertebral (V) and renal (R) anomalies': 1, 'Vertebral myxochondrosarcoma': 1, 'VERT': 1, 'and sporadic vertebral malformations': 1, 'ear, jaw, and vertebral anomalies': 1, 'vertebral arteriocervical spondylopathy': 1, 'and vertebral alterations': 1, 'vertebral and occular anomalies': 1, 'VSAO': 2, 'VBA': 2, 'vertebral ou femoral por': 1, 'femoral and vertebral defects': 1, 'vertebral fracture2': 1, 'vertebral developmental errors': 1, 'vertebral abnormal movement': 1, 'Vertebral deformity fractures': 1, 'Vertebral myelopathy': 2, 'vertebral hyperossification': 2, 'costovertebral joint (CVJ) osteoarthritis': 1, 'CVJ osteoarthritis': 1, 'vertebral associated anomalies': 1, 'malformation of the vertebral processes': 1, 'Congenital Vertebral Malformation': 2, 'dysplastic vertebral epiphysis': 1, 'HVS': 1, 'vertebral and limb fracture': 2, 'vertebral disc involvement': 2, 'costovertebral humpback': 2, 'vertebral anomalies with hemivertebrae': 1, 'IVPP V19049': 1, 'vertebral-basilar deficiency': 1, 'cortical fracture of the vertebral': 1, 'vertebral anatomy abnormalities': 1, 'obliteration of vertebral canal': 1, 'vertebral and hepatic lesions': 1, 'vertebral remodelling': 5, 'vertebral, non-vertebral and femoral fragility fractures': 1, 'vertebral lytic disease': 1, 'vertebral mineral loss': 1, 'post-vertebral lesions': 1, 'Vfs': 1, 'Vertebrate Toxicity': 1, 'dysplastic vertebral arch or': 1, 'SEQUELAE OF VERTEBRAL': 1, 'vertebral curve': 1, 'deformities of the vertebral canal': 1, 'vertebral and/or vertebral fractures': 1, 'vertebral hamangioma': 1, 'costovertebral lesions': 2, 'vertebral compromise': 1, 'vertebral and non-vertebral (appendicular bone) fractures': 1, 'vertebral Doppler abnormalities': 1, 'Vertebral Doppler abnormalities': 1, 'Vertebral Doppler abnormalitya': 1, 'vertebral Doppler abnormality': 1, 'Vertebral Doppler abnormality': 1, 'Vertebral hemangiomatosis': 1, 'vertebral, renal, and cardiac anomalies': 1, 'VEA': 1, 'vertebral chondrodysplasia': 1, 'vertebral and gastrointestinal anomalies': 2, 'vertebral and sternal anomalies': 2, 'dental and skeletal (mostly vertebral) anomalies': 1, 'Rib and vertebral anomalies': 1, 'Vertebral paramorphism': 1, 'vertebral skeletal anomalies': 2, '1 or 3 vertebral anomalies': 1, 'vertebral malsegmentation disorders': 1, 'Vertebral and nonvertebral fracture': 3, 'autosomal recessive vertebral disorder': 1, 'osteporotic vertebral fractures': 2, 'Vertebral stiffness': 1, 'VERtebral fracture': 3, 'vertebral radiculopaties': 1, 'OP vertebral fractures': 1, 'vertebral or femoral': 2, 'vertebral and discal lesions': 1, 'vertebral and non vertebral fractures': 2, 'Lower costovertebral arthritis': 1, 'Complex Vertebral Malformations': 1, 'vertebral pachyostosis': 1, 'Post vertebral fracture': 1, 'Vertebral fracture or injury': 1, 'L5 vertebral lesion': 1, 'multiple anomalies of the thoracic vertebral columns': 1, 'vertebral calcification defects': 1, 'fracture of the vertebral elements': 1, 'vertebral columnar injury': 1, 'fracture of the costovertebral complex': 1, 'VERtebral Fracture': 1, 'vertebral fractures21': 1, 'Jarcho-Levin-like syndrome': 1, 'osteoblastic vertebral lesions': 3, 'Vertebral metastatic disease': 2, 'VMD': 1, 'anomalies of vertebral bodies': 1, 'vertebral radiographic fracture': 1, 'extra-vertebral avulsion': 1, 'Extra-vertebral avulsion': 1, 'vertebral corpi': 1, 'Vertebral or non-vertebral osteoporotic fractures': 1, '(but not vertebral) fractures': 1, 'vertebral fracturesa': 1, 'Costovertebral pain': 1, 'vertebral, cardiac, and renal anomalies': 2, 'Vertebral oedema': 1, 'vertebral and palatal defects': 2, 'spinal or vertebral anomaly': 1, 'vertebral canal malformation': 1, 'WAYS OF ITS EVOLUTION IN VERTEBRATES': 1, 'Spondylocostal and Spondylothoracic Dysostosis': 1, 'Spondylothoracic Dysostosis': 1, 'vertebral developmental defects': 1, 'FVAAs': 1, 'Dangerous FVAAs': 1, 'dangerous vertebral artery anomalies at': 1, 'Dangerous vertebral artery anomalies at': 1, 'vertebral-basilar system disease': 1, 'Vertebral absence': 2, 'vascular anomalies of the vertebral artery': 1, 'Degeneration of the costovertebral articulation': 1, 'degeneration of the costovertebral articulation': 1, 'vertebral and central nervous system anomalies': 1, 'vertebral or femoral fracture3': 1, 'vertebral and especially nonvertebral fractures': 1, ', and vertebral deconditioning': 1, 'cleft of the vertebral arch': 1, 'Costovertebral angle': 2, 'vertebre cervicale': 1, 'TVN': 1, 'renal, craniofacial, axillary, tracheal and vertebral anomalies': 1, 'intracranial or vertebral injuries': 1, 'vertebral haemangiosarcoma': 1, 'Vertebral and skeletal anomalies': 1, 'arthritis of facet, costovertebral or': 1, 'VERTEBRATE ANATOMY': 3, 'vertebral, anal, cardiac, tracheal, renal and limb anomalies': 1, 'vertebral L5 fracture': 1, 'traumatic vertebral lesion': 1, 'vertebral movements': 1, 'vertebral, hip, non-vertebral, and wrist fractures': 1, 'vertebral-basilar ischaemia': 1, 'vertebral canal violation': 1, 'Disc and vertebral body anomalies': 1, 'retardation of vertebral maturation': 1, 'vertebral listhesis': 2, 'costovertebral joint disruption': 3, 'peribronchial and vertebral lesions': 1, 'bleeding to vertebral canal': 1, 'vertebral reflux': 1, 'vertebral or other structural anomalies': 1, 'costovertebral joints arthritis': 1, '- vertebral fracture': 1, 'ostelytic lesion of T9 vertebral': 1, 'vertebral heamangiomas': 1, 'vertebral arthropathy': 5, 'vertebral deformities.2': 1, 'Non-vertebral Fracture': 3, 'reduction of vertebral': 2, 'V-deformity': 2, 'costovertebral joint derangement': 2, 'vertebral split fracture': 1, 'VERTEBRAL MALFORMATION': 2, 'cranial and vertebral abnormalities': 2, 'VF vertebral fracture': 1, 'arteria vertebral esquerda': 3, 'vertebral than non-vertebral fracture': 1, 'loss of the vertebral alignment': 1, 'vertebral laminar malformations': 1, 'suprapubic/costovertebral pain': 1, 'craniofacial and vertebral anomalies': 2, 'anomalies of vertebral/spinal': 1, 'vertebral cerebrospinal injury': 1, 'vertebral cerebrospinal injuries': 1, 'IVPP V 27126a': 1, 'atlantal vertebral malformation': 2, 'Vertebrate Cytotoxicity': 1, 'vertebral, rib anomalies': 1, 'posterior vertebral defect': 2, 'Vertebral duplication': 2, 'Vertebral Duplication': 1, 'vertebral space reduction': 4, 'abnormalities in vertebral patterning': 1, 'vertebral corpus defect': 1, 'vertebral fracture73': 1, 'vertebral centra deformities': 1, 'vertebral centra malformations': 1, 'vertebral centrum deformities': 1, 'hip, non-vertebral and vertebral fractures': 1, 'facial, vertebral, and systemic anomalies': 1, 'Vertebral lesions of convulsive': 1, 'cerebral or vertebral anomalies': 1, 'vertebral fracture or disease': 1, "vertebral 'fracture": 1, 'vertebral and tibia lesions': 1, 'Non-Vertebral fractures': 1, 'Fractures of the vertebral lamina': 1, 'malformation of the occipito-vertebral junction': 1, 'abnormality of the occipito-vertebral junction': 1, 'vertebral hydatitosis': 1, 'intra-abdominal, vascular and vertebral congenital anomalies': 1, 'renal, vertebral and diaphragmatic anomalies': 1, 'osteolytic vertebral involvement': 1, 'vertebral, cardiac, anal anomalies': 1, 'congenital vertebral anomalies of the': 1, 'facial, vertebral, and genital anomalies': 2, 'thoracic vertebrate fractures': 1, 'VLs': 1, 'vertebral, cardiac or renal anomalies': 1, 'Costovertebral fracture dislocations': 1, 'Loss of Vertebral': 1, 'OVFs': 2, 'Osteoprotic vertebral fractures': 1, 'craniofacial and vertebral skeletal anomalies': 1, 'CV clinical vertebral': 1, 'craniofacial and/or vertebral anomalies': 1, 'vertebral and nonspine fractures': 1, 'Cranio-vertebral junction anomaly': 1, 'vertebrate fracture': 2, 'VUs': 2, 'brain, cardiac, renal, vertebral, skeletal and spinal cord anomalies': 1, 'vertebral pathologies and anomalies': 1, 'disc and vertebral abnormalities': 1, 'Ipsilateral vertebral artery anomalies': 1, 'Vertebral fractute and dislocation': 1, 'Vertebral fractute': 1, 'vertebral spondyloarthrosis': 1, 'Vertebral FracturesStatus': 1, 'Craniofacial and vertebral injury': 1, 'vertebral and radial anomalies': 1, 'vertebral and non': 1, 'MVFs': 5, 'sacral vertebral anomaly': 1, 'abnormalities of vertebral alignment': 1, 'vertebral fracturesControversial': 1, 'vertebral malformations/hypoplasia': 1, 'vertebral fracturesThe': 1, 'vertebral arthropathies': 1, 'Arteria vertebral esquerda': 1, 'of vertebral facets': 1, 'suprapubic and costovertebral pain': 1, 'Congenital vertebral dislocation': 2, 'and sporadic vertebral malformation': 1, 'VM': 3, 'Congenital anomalies of cranio vertebral junction': 1, 'vertebral canal deformities': 1, 'vertebral and urinary': 1, 'vertebral or cutaneous deformity': 1, 'vertebral diskopathies': 1, 'posterior vertebral element injury': 1, 'anomalies of the distal vertebral column': 1, 'vertebral ostemyelitis': 1, 'vertebral index fracture': 1, 'vertebral artery and other vascular anomalies': 1, 'ankylosis of the costovertebral articulations and': 1, 'VS': 2, 'vertebral arterial anomalies': 1, 'vertebral fractures of': 1, 'SPECIES OF LIVING VERTEBRATES': 1, 'vertebral, non-vertebral, and hip fractures18': 1, 'vertebral stenoocclusive disease': 1, 'congenital CV junction anomalies': 1, 'Cranio-vertebral anomalies': 1, 'Cranio-vertebral (CV) junction anomalies': 1, 'Diskogenic vertebral sclerosis': 1, 'diskogenic vertebral sclerosis': 1, 'Vertebral refracture': 2, 'vertebral traumatism': 1, 'DIFFERENT VERTEBRATES': 2, 'vertebre L5': 1, 'vertebral fracture (VF) deformity': 1, 'cardiac, vertebral and renal anomalies': 2, 'traumatic VF': 1, 'flexion-distraction VF': 1, 'vertebral or ligamentous injuries': 1, 'Malformation of the occipito-vertebral joint': 1, 'costovertebral osteoarthritis': 1, 'ophthalmic and vertebral anomalies': 1, 'vertebral and no-vertebral fractures': 1, 'vertebral, radiographic vertebral and wrist fracture': 1, 'Vertebral ostial lesions': 1, 'non-vertebral (NV) fractures': 2, 'vertebral fractures14': 1, 'VIP': 1, 'VIP (type 1 or type 2)': 1, 'vertebral marrow': 2, 'uro-genital or spino-vertebral anomalies': 1, 'and vertebral sclerosis': 1, 'paravertebral or vertebral lesions': 1, 'cervico-thoracic vertebral anomalies': 2, 'reduction of vertebral curves': 1, 'hypoplasia of the vertebral arch': 1, 'fracture of the T12 vertebral and interspinous ligament injury': 1, '-5 vertebral': 1, 'IVPP V22647': 1, 'vertebrate disorders': 1, 'non- vertebral fractures': 2, 'vertebral mal-alignment': 1, 'myelomatous vertebral deposits': 1, 'vertebral anthrosis': 1, 'Vertebral canal compromise': 1, 'Cerebral vertebral junction fractures': 1, 'vertebral-A injury': 1, 'rupture of posterior vertebral osteoporotic vertebral fracture': 1, 'Congenital anomalies of the vertebral column': 1, 'vertebral hyperextension fracture': 1, 'non-vertebral (NV)': 1, 'Vertebral alterations': 1, 'craniofacial or vertebral lesions': 1, 'leg and vertebral deformities': 1, 'costovertebral fusion': 1, 'Vertebral segment anomalies': 2, 'jarcho levin syndrome': 1, 'cranio-vertebral junction (CVJ) anomalies': 2, 'spinal, sacral and vertebral anomalies': 1, 'mineralised vertebral lesion': 1, 'vertebral and non-vertebral osteoporotic fractures': 2, 'extra vertebral calcifications': 1, 'Familial Jarcho-Levin syndrome': 1, 'Vertebral beaking': 2, 'vertebrate toxicity': 1, 'Vertebral Fracture Non-': 1, 'vertebral spondylotic': 1, '-vertebral lesion': 1, 'Non-vertebral and Vertebral Fracture': 1, 'vertebr': 1, 'Jarcho-Levin spondylothoracic dysostosis': 1, 'fractured vertebral alignment': 1, 'vertebral and spinal-related anomalies': 1, 'vertebral dysplastic changes': 2, 'vertebral or nonvertebral': 1, 'vertebral lesion at L5': 1, 'vertebral skeletal problems': 1, 'vertebral endplate anomalies': 1, 'costovertebral junction masses': 1, 'thoracolumbar vertebral disk disease': 1, 'vertebral) malformations': 1, 'vertebral diseases22': 1, 'Multiple vertebral necrosis': 1, 'Costovertebral defects': 3, 'vertebral calcifications': 1, "vertebral bodies' anomalies": 1, 'vertebral transitional anomalies': 1, 'Vertebral osteolytic defects': 1, 'vertebral osteolytic defects': 1, 'Vertebral osteolytic defect': 1, 'vertebral osteolytic defect': 1, 'vertebral and periprostetic fractures': 1, 'vertebral or femoral)': 1, 'vertebral hemangiolymphangioma': 1, 'vertebral, anal and renal anomalies': 1, 'vertebral and hindlimb malformations': 1, 'diseases of vertebral canal': 1, 'vertebral and hindgut malformation': 1, 'Thoracolumbar vertebral fractures': 3, 'vertebral or total fractures': 1, 'Vertebral Derotation': 1, 'BAVD': 1, 'Vertebral epiphysitis': 2, 'vertebral, maxilla': 1, 'vertebral fracture nonunion': 4, 'vertebral or digit abnormalities': 1, 'fractures posterior vertebral': 1, 'VERTEBRAL BLOCK': 1, 'VA groove anomaly': 1, 'diseases of the vertebral epiphyses': 1, 'vertebral and dental abnormalities': 2, 'type III vertebral defects': 1, 'vertebral and non-vertebral osteomyelitis': 2, 'cervicothoracal vertebral anomalies': 2, 'costo-vertebral (CV) joint arthropathies': 1, 'CV joint arthropathies': 1, 'Costo-vertebral arthropathy': 1, 'CV arthropathies': 1, 'vertebral fracturesC': 1, 'vertebral fractures': 1, 'unilateral hypoplastic vertebral arch': 1, 'multiple costovertebral malformations': 1, 'vertebral and eye anomalies': 1, 'congenital vertebral malformation disorders': 1, 'TRANSOMATIC VERTEBRAL': 1, 'mandibulo vertebral malformation': 1, 'thoracic vertebral malformation': 4, 'ankylosis of costovertebral joints': 1, 'vertebral veins': 1, 'and thoracolumbar vertebral pathologies': 1, 'Vertebral fractures or deformities': 1, 'uperior adjacent vertebral fracture': 1, 'fracture of vertebral levels': 1, 'vertebral metasis': 1, 'vertebral, non-vertebral, and overall fractures': 1, 'Spondylothoracic dysplasia/Dysostosis': 1, 'Vertebral and paravertebral lesions': 2, 'T11 vertebral lesion': 1, 'vertebrate pests': 2, 'Musculoskeletal Vertebral anomalies': 1, 'Rib or vertebral anomalies': 2, 'costovertebral junction': 1, 'VLK-deficiency': 1, 'vertebral, anal, cardiovascular, tracheo-oesophageal, renal and limb anomalies': 1, 'vertebral morphologic variation': 1, 'vertebral expansion': 1, 'suprapubic or costovertebral angle pain': 1, 'skeletal/vertebral anomalies': 1, 'vertebral or non-hip non-vertebral': 1, 'transverse dorsolumbar vertebral fracture': 1, 'vertebral or cord abnormalities': 1, 'vertebral marrow reflux': 1, 'fracture of the vertebral lamina': 3, 'hip, vertebral or non-vertebral fracture': 1, 'Vertebral or other fractures': 1, 'costovertebral joint involvement': 2, 'costovertebral joint abnormality': 1, 'Costovertebral joint abnormalities': 1, 'Costovertebral joint involvement': 1, 'costovertebral joint abnormalities': 1, 'congenital vertebral malformations at': 1, 'vertebral gumma': 2, 'vertebral and all-type fractures': 1, 'Non-Vertebral Fracture': 3, 'vertebral and all-type fracture': 1, 'anomalies of vertebral deformities': 1, 'malformation of vertebral anomalies': 1, 'vertebral or intraspinal anomalies': 1, 'una fractura vertebral': 1, 'vertebrate fractures': 1, 'Vertebral and Paravertebral Lesions': 1, 'vertebral and paravertebral lesions': 3, '-I vertebral anomalies': 1, 'VERTEBRATE NONHOMOLOGOUS': 1, 'vertebral photopenia': 2, 'vertebral dicalcification': 1, 'MV': 1, 'NMV': 1, 'renal and lumbosacral vertebral anomalies': 1, 'lumbar, sacral, and vertebral anomalies': 1, 'Vertebral alteration': 2, 'oculo-auriculo-vertebral anomaly,': 1, 'T9 vertebral fracture': 1, 'vertebral fracturesPM': 1, 'Vertebral and eye anomalies': 1, 'and vertebral anomalies': 1, 'Vertebral pedicle hypoplasia': 1, 'dental, and vertebral anomalies': 1, 'disc and vertebral pathologies': 1, 'Congenital malformations of the accipito-vertebral joint': 1, 'HELICASE DOMAINS OF VERTEBRATE': 1, 'IVPP V 27941/46': 1, 'Vertebral hemoangiomas': 1, 'vertebral involvement by': 1, 'No Vertebral Fracture': 1, 'costovertebral joints abnormalities': 1, 'lytic vertebral involvement': 1, 'vertebral malsegmantation': 1, 'non-vertebral (nvFr) fractures': 1, 'of the vertebral nerve': 1, 'vertebral tissue': 1, 'dental, cardiac, and vertebral anomalies': 1, 'vertebral anomalies and lower extremity anomalies': 1, 'or non-vertebral fracture': 2, 'Vertebral Arch Anomalies': 1, 'vertebral disk injuries': 1, 'Vertebral (': 1, '-vertebral and lower extremity fractures': 1, 'vertebral and lower extremity fractures': 1, 'Vertebral-related diseases': 1, 'vertebral-related disorders': 1, 'Apophysitis of vertebral transverse processes': 1, 'Jarcho-Levin syndromeKaryotype': 1, 'Jarcho-Levin syndrome 1': 1, 'Spondylothoracic dysostosisNeonatal': 1, 'multiple vertebral deformities': 2, 'spina bifida Spondylothoracic dysostosis 1': 1, 'C1-2 vertebral anomalies': 1, 'rib and vertebral anomaly syndromes': 1, 'fracture of the vertebral pedicle': 1, 'L4-5 vertebral fracture': 1, 'VERTEBRATE FOSSILS': 1, 'Vertebral fracture-deformation': 1, 'Spinal and costovertebral joint fusion': 1, 'and post-vertebral fracture': 1, 'vertebral hypertostosis': 1, 'VERTEBRAL REALIGNMENT': 1, 'IVPP V 11954.1': 1, 'absence of a vertebral pedicle': 1, 'malformations of the occipito-vertebral hinge': 1, 'vertebral and discs': 1, 'vertebral traumatization': 1, 'vertebral joint swelling': 1, 'vertebrate malformation': 2, 'anomalies of the vertebral arteries': 5, 'MVD': 3, 'sandwich vertebral fracture': 1, 'vertebral, non-vertebral, hip, and wrist fractures': 1, 'autosomal recessive vertebral dysotosis': 1, 'cardiac, vertebral, renal, and pulmonary anomalies': 1, 'vertebrate malformations': 1, 'vertebral steomyelitis': 1, 'vertebral traumatic fracture': 2, 'ligamentous or vertebral disk injury': 1, 'vertebral, and': 1, 'pulmonary and vertebral': 1, 'vertebral rib anomalies': 1, 'vertebral and intraspinal abnormalities': 3, 'vertebral-medullary anomaly': 1, 'gastrointestinal, vertebral and cardiac anomalies': 1, 'congenital vertebral anomalies/malformations': 1, 'costovertebral knock pain': 1, 'abnormal vertebral angulation': 1, 'vertebral ABC': 2, 'vertebral vacuum phenomenon': 1, 'vertebral fractureAge': 1, 'Vertebral intraspongiosis': 1, 'inter-vertebral disk disease': 1, 'craniofacial and vertebral hypoplasia': 1, 'clefts in the vertebral arch': 1, 'VERTEBRAL VEINS': 1, 'multiple skeletal anomalies of the vertebral column': 1, 'vertebral or ligaments anomalies': 1, 'vertebral or non': 1, 'V - Vertebral malformations': 1, 'VCA': 2, 'vertebral, non-vertebral, and wrist fractures': 1, 'vertebral and dental anomalies': 1, 'vertebral and nonvertebral) fractures': 1, 'VHU': 1, 'Vertebral amyloidoma': 1, 'cranial and vertebral sclerosis': 1, 'IVPP V8143.1': 1, 'vertebral and non-vertebral injuries': 1, 'PVDP': 1, 'vertebral fracture 3': 1, 'fracture of vertebral D4': 1, 'VERTEBRAL PROCESSES': 1, 'jarcho-levin syndrome': 1, 'congenital costovertebral disorder': 1, 'thoracic 8th vertebral fracture': 1, 'NF': 1, 'vertebral fractureBMD': 1, 'systemic and vertebral malformations': 1, 'vertebral disk alterations': 1, 'metastatic vertebral disease': 2, 'systemic or vertebral disease': 1, 'type 1 vertebral anomaly': 1, 'Vertebral and Nonvertebral Fracture': 1, 'Injuries of the first costovertebral articulation': 1, 'Vertebral Arch': 1, 'posterior vertebral arch defects': 1, 'posterior vertebral arch defect': 1, 'costovertebral joint lesion': 1, 'costovertebral joint lesions': 2, 'Costovertebral joint lesion': 1, 'Facet joint and costovertebral lesions': 1, 'Costovertebral lesion': 1, 'Costovertebral joint lesions': 1, 'vertebral lamina defect': 1, 'Vertebral lamina defect': 1, 'Vertebral fractures and deformity': 1, ') or vertebral (n': 1, 'vertebral junction': 2, 'Costovertebral fusion': 1, 'vertebral anomalies and': 2, 'vertebral leaks': 1, 'vertebral segmentation anomaly or fusion': 1, 'costovertebral dysfunction': 1, 'VERTEBRATES OF': 1, 'abnormal vertebral movement': 1, 'vertebral, cardiac and intestinal anomalies': 1, 'vertebral and ventricular septal anomalies': 1, 'VERTEBRAL OSTEOARTHROPATHIES': 1, 'vertebral deformities in': 1, 'vertebral elements': 1, 'spondylocostal dysostosis-4': 1, 'vertebral venous': 1, 'PVO': 1, 'vertebral, anal and cardiac anomalies': 1, 'Vertebral body anomalies of the': 1, 'vertebral and peripheralfractures': 1, 'vertebral compressionKyphoscoliosisSevere': 1, 'vertebral planar fracture': 1, 'vertebral/nonvertebral fracture': 1, 'vertebral fusions and anomalies': 1, 'vertebral disk pathology': 1, 'POLYARTHROPATHY WITH VERTEBRAL LOCALIZATION': 1, 'metastatic vertebral fracture': 1, 'vertebral and joint anomalies': 1, 'costovertebral disorder': 1, 'nonunion of the vertebral fracture': 1, 'vertebral morphology': 1, 'ligamentous or vertebral injury': 1, 'vertebral vascular proliferative disorders': 1, 'shear injury to the vertebral joint': 1, 'suprapubic and/or costovertebral pain': 1, 'vertebral fractures and deformity': 2, 'Rib, and Vertebral Anomalies': 1, 'vertebral fractures58': 1, 'burst injury to the vertebral': 1, 'vertebral and nonvertebral': 2, 'Renal, vertebral and airway structural anomalies': 1, 'Erosive arthritis of the costovertebral joint': 1, 'cerebral or vertebral injuries': 1, 'vertebrate anomalies': 2, 'vertebral neoplastic disease': 1, 'vertebral or disc space abnormality': 1, 'VETERAN': 1, 'intra-vertebral clefts': 1, 'vertebral, non-vertebral and femoral fractures': 1, 'Vertebral disorder': 1, 'vertebral osteolytic fracture': 1, 'Jarcho': 1, 'vertebral arthrodesis': 1, '/vertebral abnormalities': 1, 'Lumbo-costovertebral syndrome': 2, 'cardiac, eye, and vertebral anomalies': 1, 'vertebral, cardiac and renal anomalies': 2, 'IVD': 1, 'bleeding into the vertebral canal': 1, 'vertebral and discal damages': 1, 'midline vertebral fusion anomalies': 1, 'oculo-auriculo-vertebral (Goldenhar) anomaly': 1, 'Spinal/vertebral anomalies Scoliosis': 1, 'Limbus Vertebral Fracture': 1, 'Limbus vertebral fracture': 1, 'limbus vertebral fracture': 1, 'vertebral fracture;NR': 1, 'costovertebral agenesis': 1, 'VERTEBRAL MORPHOMETRICS OF': 1, 'Frontal vertebral cleft': 1, 'vertebral eburnation': 1, 'vertebral aponeurosis': 1, 'vertebral fracture deformities': 3, 'congenital anomaly of the vertebral column': 1, 'vertebral/dental anomalies': 1, 'vertebral refracturing': 1, 'vertebral and gastroesophageal anomalies': 1, 'costovertebral malformation': 2, 'vertebral (V) and non-vertebral (NV) fractures': 1, 'anomalies of the vertebral joints': 1, 'Costovertebral Joint Arthritis': 1, 'of costovertebral joint': 1, 'L4 posterior vertebral defect': 1, 'vertebral and subclavian arterypseudoaneurysms': 1, 'vertebral fractures1': 1, 'Vertebral paramorphias': 1, 'vertebral structural damage': 1, 'Spondylothoracic Dysotosis': 1, 'thoracic CVM': 1, 'contiguous vertebral malformations': 2, 'vertebral and disc deformity': 1, 'CVD': 2, 'congenital vertebral dislocation': 3, 'vertebral disk lesions': 1, 'avulsion of the posterior vertebral apophysis': 1, 'Vertebral arch fractures': 1, 'vertebral and tail malformations': 1, 'or vertebral fracture': 1, 'vertebral and non-vertebral (but not hip) fractures': 1, 'vertebral alignment disorders': 1, 'renal, limb, and vertebral anomalies': 1, 'cardiac or vertebral anomaly': 1, 'vertebral canal deformity': 1, 'vertebral fractures.5': 1, 'congenital and developmental vertebral abnormalities': 1, 'VERTEBRAL FORMULA OF DIPLODOCUS': 1, 'Vertebral to subclavian transposition': 1, 'vertebral translation': 1, 'AVI': 2, 'polyostotic vertebral lesions': 1, 'Spondylocostal Dysostosis type 2': 1, 'Spondylocostal Dysostosis type 4': 1, 'vertebral bony and vascular anomalies': 1, 'congenital vertebral artery anomaly': 1, 'vertebral palsy': 2, 'vertebral and traumatic fractures': 1, 'lytic vertebral': 1, 'vertebral pedicle lesions': 1, 'vertebral or non-VFs': 1, 'Osseous vertebral involvement': 1, 'Vertebral Augmentation': 1, 'costovertebral subluxation': 1, 'vertebral pathological': 3, 'vertebral disc defects': 1, 'of injured vertebral': 1, 'fractured vertebral defect': 1, 'vertebral rotatory deformity': 1, 'LVF': 1, "Jarcho's Syndrome": 1, 'Myelo-vertebral malformations': 1, 'Nonunion vertebral fractures': 1, 'anomaly of the left vertebral artery': 1, 'thoracic vertebral (T6-T12) fracture': 1, 'Congenital Vertebral Anomaly': 1, 'VF.The': 1, 'fractures de vertebres cervicales': 1, 'vertebral, rib, and limb anomalies': 1, 'CVM (': 1, 'complex vertebral malformation) abnormality': 1, 'vertebral ostial disease': 1, 'vertebral fracture"#2': 1, 'anterior vertebral injury': 1, 'vertebral hemagioma': 1, 'vertebral and costovertebral bone destruction': 1, 'Vertebral Curves': 1, 'vertebral curves': 2, 'Left Vertebral': 1, 'Vertebral, pseudoradicular': 1, 'Costovertebral and urogenital malformations': 1, 'coccygeal vertebral fracture': 1, 'COSTOVERTEBRAL': 1, 'Spondylocostal Dysostosis 4': 1, 'vertebral and cutaneous anomalies': 1, 'MF vertebral involvement': 1, 'IVPP OV': 1, 'vertebral distraction': 1, 'rib and vertebral segmentation anomalies': 1, 'malformed vertebral centra': 1, 'osseous vertebral anomalies': 1, 'emisomal, uropoietic and vertebral anomalies': 1, 'vertebral damages': 1, 'Vertebral Defect': 3, 'vertebral abscessFluconazole': 1, 'IVD pathology': 1, 'IVD pathologies': 1, 'vertebral disc (IVD) pathology': 1, 'congenital vertebral malformations(s)': 1, 'Metastatic vertebral fractures': 1, 'genital, vertebral, cardiac or tracheoesophageal anomalies': 1, 'vertebral pedicle damage': 1, 'vertebral hyperlordosis': 1, 'Vertebral frActures': 1, 'vertebral-fractures': 1, 'arteria dolicomega vertebral': 1, 'VT:0000432': 1, 'traumatic vertebral lesions': 4, 'Spinal vertebral anomalies': 1, 'left vertebral': 1, 'costovertebral cyst': 1, 'vertebral, and renal anomalies': 1, 'vertebral joint injury': 1, 'vertebral disk problems': 3, 'AIR-BREATHING VERTEBRATES': 1, 'Costovertebral anomaliesa': 1, 'vertebral carcinoma': 1, 'Congenital Malformations of Vertebral Articular Processes': 1, 'vertebral fracture': 1, 'Bilateral congenital anomalies of the extracranial vertebral artery': 1, 'Congenital anomalies of the vertebral artery': 1, 'congenital anomalies of the extracranial vertebral arteries': 1, 'vertebral skeletal and muscular pathologies': 1, 'Extracranial vertebral disease': 1, 'anomalies of the upper thoracic vertebral bodies': 1, 'Cranio-vertebral boundary anomaly': 1, 'vertebral vascular anomalies': 1, 'costovertebral arthropathies': 1, 'ADDING VFA': 1, 'PVF': 1, 'VERTEBRAL LESIONS': 1, 'vertebral or other congenital anomalies': 1, 'vertebral and other fracture': 2, 'post vertebral fracture': 1, 'post vertebral and other fracture': 1, 'vertebral, Fx fracture': 1, 'and vertebral osteopathies': 1, 'vertebral spongiosa': 1, 'vertebral demineralisation': 1, 'multiple vertebral defect': 1, 'vertebral and non-hip/non-vertebral fractures': 1, 'Tuberculous Vertebral Disease': 1, 'CMV': 2, 'vertebral fracture block': 1, 'vertebral bone oedema': 1, 'vertebral fractureHemiplegia': 1, 'vascular vertebral pathologies': 1, 'P-VFs': 1, 'MIOCENE MARINE VERTEBRATES': 1, 'vertebral thoracic fractures': 2, 'vertebral panoramica': 1, 'IVPP V26840.1': 1, 'IVPP V26838.1': 1, 'skip vertebral lesions': 1, 'Vertebral arch fracture': 1, 'cardiac, eye and vertebral anomalies': 1, 'vertebral fractures of the thoracolumbar': 1, 'vertebral centra malformation': 1, 'vertebral clefts and': 1, 'Thoracic vertebral malformation': 2, 'vertebral or other skeletal anomalies': 1, 'vertebral arthopathy': 1, 'vertebral osteomyelitisGram': 1, 'discal and vertebral dysfunctions': 1, 'vertebral hemangimoa': 1, 'LVM': 1, 'vertebral recompression fracture': 1, 'Vertebrate Fracture': 1, 'Vertebral or paravertebral': 1, 'vertebral and foregut anomalies': 1, 'Vertebral anomalies Overlap malformations': 1, 'Vertebral anomalies Overlap syndrome': 1, 'Vertebral anomalies in one c': 1, 'skeleton vertebral anomalies': 1, 'Th9 vertebral fracture': 1, 'Vertebrate toxicity': 1, 'renal, cardiac, and vertebral anomalies': 1, 'vertebral and epiphyseal anomalies': 1, 'FORM OF VERtebral malformation': 1, 'vertebral, rib, or sternal anomalies': 1, 'vertebral, rib, and sternal anomalies': 1, 'vertebral fracturehas': 1, 'Vertebral artrosis': 1, 'spondylothoracic and spondylocostal dysostosis': 1, 'VERTEBRAL OSTEOTOMY': 1, 'thoracolumbar vertebral lesions': 1, 'non-vertebral anomalies': 1, 'vertebral anomaly of sacrum': 1, 'Vertebral Collapse of Vertebral Metastases': 1, 'vertebral and paraspinal lesion': 1, 'vertebral tilt': 1, 'vertebral osteogenesis': 1, 'SMALLEST LIVING VERTEBRATE': 1, 'congenital vertebral complications': 1, 'congenital vertebral diseases': 1, 'vertebral but': 1, 'anomaly of the vertebral canal': 1, 'de aneurisma dissecante da arteria vertebral': 1, 'VTO': 1, 'vertebral fractures or': 1, 'Defect of vertebral arch': 1, 'vertebral, intraspinal, or paraspinal abnormalities': 1, 'Jarcho-Levins': 1, '-associated vertebral fractures': 2, 'VEs': 1, 'Vertebral spiculation': 1, 'Vertebral Osteodiskitis': 1, 'hip non-vertebral and vertebral fractures': 1, 'VS-L': 1, 'vertebral fracture38': 1, 'vertebral fracture22': 1, 'vertebre fracturee': 1, 'vertebre': 2, 'fracture des vertebres adjacentes': 1, 'vertebral osteotomy': 1, 'vertebral arch pedicle injury': 1, 'vertebral and/or': 2, 'thoracolumbar vertebral injuries': 1, 'Thoracolumbar Vertebral Injuries': 1, 'vertebral canal widened partly': 1, 'Spondylothoracal dysplasy': 1, 'vertebral versus nonvertebral fractures': 1, 'vascular, vertebral and ocular anomalies': 1, 'Vertebral asoma': 2, 'vertebral duplication': 1, 'vertebral mestastases': 1, 'congenital lumbar vertebral anomaly': 1, 'Lumbar vertebral anomalies': 1, 'lumbar and caudal vertebral anomalies': 1, 'Tail vertebral anomalies': 1, 'arteria vertebral concomitante': 1, 'arteria vertebral indica': 1, 'muscular or vertebral anomalies': 1, 'vertebral and hindlimb defects': 1, 'vertebral or extravertebral fractures': 1, 'STEM-GROUP VERTEBRATES': 1, 'Neurodevelopmental Disorder with Brain Anomalies and with or Without Vertebral or Cardiac Anomalies': 1, 'vertebrate CoV': 1, 'vertebral (and nonvertebral) fractures': 1, 'CV': 1, 'CV fracture': 1, 'costovertebral sulcus tumours': 1, 'IDS': 1, 'vertebral spinal anomalies': 1, 'vertebral, non-vertebral, and hip fracturesGIO': 1, 'Vertebral arch clefts': 1, 'vertebral and cephalic deformities': 1, 'Vertebral Fracture Associated': 2, 'Vertebral, ocular and cardiac anomalies': 1, 'sans vertebres': 1, 'VERTEBRATE HOSTS': 1, 'non-vertebral fracturesa': 1, 'spondylocostal dysostosis 6': 1, 'vertebral marrow involvement': 1, 'vertebral translation injury': 1, 'Vertebral 1': 1, 'Vertebral and Intraspinal Anomalies': 1, 'Vertebral and intraspinal anomalies': 1, 'neural and vertebral malformations': 1, 'Fracture of vertebral': 1, 'vertebral fractures\\': 1, 'spondylothoracic or spondylocostal dysostosis': 2, 'vertebral aches': 1, 'Costovertebral arthritis': 1, 'vertebral and non-vertebral bone metastasis': 1, 'vertebral, nonvertebral': 1, 'vertebral or intraspinal lesion': 1, 'CVM human disease': 1, 'PVD': 1, 'VFAs': 1, 'Multiple vertebral segmentation anomaly': 1, 'sacral and vertebral anomalies': 2, 'T11 vertebral anomaly': 1, 'Vertebral Disease': 1, 'vertebral pathological entities': 1, 'hyperostosis of the thoracic costovertebral joints': 1, 'vertebral/cranial dislocation': 1, 'cervicothoracic vertebral abnormality': 1, 'traumatic vertebral fractures type A.': 1, 'traumatic vertebral fractures type A': 1, 'vertebral type A fractures': 1, 'spondylocostal dysostosis 4': 1, 'anomalies of ears, eyes, face and vertebral': 1, 'AV': 3, 'vertebral fractureswhen': 1, 'vertebres vivants': 1, 'vertebral MR abnormalities': 1, 'loss of vertebral disk': 1, 'odontoid and vertebral artery canal anomalies': 1, 'vertebral defects or anomalies': 1, 'vertebral malformations.31': 1, 'arteria vertebral izquierda': 3, 'space-occupying lesions of the vertebral canal': 1, 'osteolytic vertebral deposits': 1, 'VFs.21': 1, 'vertebral Fractures': 1, 'Arthritis of the first costovertebral joint': 1, 'arteria vertebral esta': 1, 'vertebral neoplastic diseases': 1, 'Vertebral split fractures': 1, 'vertebral morphology disorders': 1, 'vertebral and thoracolumbar injuries': 1, 'vertebral disc pathologies': 1, 'Vertebral or': 1, 'vertebral and discal abnormalities': 1, 'vertebral, costal, and pelvic anomalies': 1, 'vertebral blush': 1, 'Vertebral Blush': 1, 'Vertebral para-morphism and dysmorphism': 1, 'VERTEBRAL TRACTION': 1, 'vertebral, non-vertebral, hip and wrist fractures': 1, 'vertebral weakening': 1, 'Vertebral Loss': 1, 'vertebral and urorectal defects': 1, 'vertebral and vascular anomalies': 3, 'facial and vertebral fractures': 1, 'vertebral blocking': 1, 'vertebral artery groove (VAG) anomalies': 1, 'VA groove (VAG) anomaly': 1, 'VAG anomaly': 1, 'vertebral artery groove anomaly': 1, 'VAG anomalies': 1, 'V-deformity vertebral deformity': 1, 'fracture of vertebral pedicle': 1, 'vertebral basilar system disease': 1, 'vertebral artery groove anomalies': 1, 'vertebral fractures:4': 1, 'injury of the vertebral disc': 1, 'OF4 vertebral fractures': 1, 'anomalies of cranio-vertebral junction': 1, 'vertebral imperfections': 1, 'vertebral deficiency': 1, 'thoracic vertebral involvement': 2, 'vertebral osteoarthropathies': 1, 'vertebral sequelae': 2, 'mesenchymal vertebral lesion': 1, 'vertebral deformity angulation': 1, 'Vertebral Fracture Risk': 1, 'congenital craniocervical vertebral fusion anomalies': 1, 'vertebral anomalies Dysplasia': 1, 'vertebral or non-vertebral bone fractures': 1, 'LVT': 1, 'agenesis of the vertebral arcs': 1, 'sacral/vertebral anomalies': 1, 'sacral or vertebral anomalies': 1, 'IVPP V': 1, 'tuberculous vertebral disease': 1, 'vertebral spondyloses': 1, 'posterior vertebral arch fracture': 1, 'congenital anomalies of the VA': 1, 'thoracolumbar junction vertebral fractures': 1, 'vertebral patterning defect': 1, 'cranial-facial and vertebral malformation': 1, 'vertebral osteomyelitus': 1, 'L4-L5 vertebral fracture': 1, 'Fracture of the vertebral limbus': 1, 'vertebral reversal': 1, 'Vertebral Reversal': 1, 'reduction of vertebral and non-vertebral fractures': 1, 'Vertebral cryptococosis': 1, 'extra-thoracic vertebral fractures': 1, 'vertebral derotation and': 1, 'costovertebral gutter tumours': 1, 'congenital retroisthmic cleft of the vertebral arc': 1, 'congenital thoracic vertebral malformation': 1, 'vascular abnormalities of vertebral circulation': 1, 'vertebral-related deformities': 1, 'vertebral hyperplastic sclerosis': 1, 'Vertebral laminar sclerosis': 1, 'vertebral fracturesHigh': 1, 'vertebral anomalies of the foramen transversarium': 1, 'vertebral artery and bony anomaly': 1, 'lesion in the vertebral canal': 1, 'thoracic congenital vertebral malformation': 1, 'vertebral disc alterations': 1, 'vertebral deficiencies': 1, 'Multiple Vertebral Disease': 1, 'Costovertebral joint problems': 1, 'vertebral) fractures': 2, 'malformations of the vertebral units': 1, 'genital or vertebral anomalies': 1, 'AVDs': 1, 'Multiple vertebral deformities': 1, 'Myelo-vertebral abnormalities': 1, 'Vertebral fracture/': 1, 'vertebral fracture[s': 1, 'non-vertebral fractureRecommendations': 1, 'cord or vertebral involvement': 1, 'costovertebral angle pain or tenderness4': 1, 'Vertebral disk calcification': 1, 'Vertebral haematoma': 1, 'renal/vertebral anomalies': 1, 'femoral/vertebral': 1, 'vertebral, anal, renal and limb anomalies': 1, 'vertebral anomalies Mental deficiency': 1, 'vertebral and costal malformative anomalies': 1, 'craniofacial vertebral anomalies': 1, 'vertebral developmental anomalies': 1, 'vertebral disk problem': 1, 'Vertebral column anomalies': 2, 'vertebral anomaliesThe': 1, 'vertebral segmental anomaly': 1, 'vertebral fracturesPresent': 1, 'craniofacial, vertebral, ocular and cardiac anomalies': 1, 'vertebral Chance fracture': 1, 'Multiple vertebral defect': 1, 'congenital renal, vertebral, and cerebral/cerebellar anomalies': 1, 'vertebral and non vertebral fracture': 1, 'fracture of the vertebral isthmus': 1, 'CVJ anomaly': 1, 'vertebral echinococcal involvement': 1, 'kyphotic juvenile vertebral alteration': 1, 'Vertebral dysplasiasand': 1, 'Cervicothoracic vertebral defects': 1, 'cranio-vertebral anomaly': 1, 'dislocation of the costovertebral joint': 2, 'Vertebral lipoma': 1, 'vertebral or skull anomalies': 1, 'Arthritis of costovertebral joints': 1, 'vertebral and paravertebral disease': 1, 'vertebral and paravertebral diseases': 1, 'femoral or vertebral': 1, 'vertebral anomaly or': 1, 'Vertebral osteochondropathies': 1, 'absence of vertebral centra in': 1, 'vertebral isthmus injury': 1, 'malformations of vertebral bodes and': 1, "Jarcho-Levin's syndrome": 1, 'dysostosis multiplex.2, 3': 1, 'hip, non-vertebral, and vertebral fractures': 1, 'vertebral and facial abnormalities': 1, 'abnormal vertebral shape': 1, 'VERTEBRATE CLOTTING': 1, 'vertebral and "other': 1, 'abnormalities of the cranial vertebral junction': 1, 'vertebral and non-vertebral fracture reduction': 1, 'vertebral (2 or more) fracture': 1, 'Sandwich vertebral changes': 1, 'multiple vertebral and non-vertebral fractures': 1, 'Jarcho-Levin syndromeCerebrocostomandibular syndromeNeu-Laxova syndromeDiGeorge syndromeSDAM': 1, 'vertebral and pelvic anomalies': 1, 'vertebral anomalies hypoplasia of maxilla and mandible': 1, 'Hypoplastic vertebral': 1, 'post-vertebral facture': 1, 'VERTEBRAL VEIN': 1, 'vertebral and disk lesion': 1, 'Costovertebral erosion': 1, 'vertebral and scapular anomalies': 1, 'vertebral neoplastic': 1, 'congenital malformation of the costovertebral joints 1': 1, 'Costovertebral and sternoclavicular joint involvement': 1, 'non-fracture short vertebral': 1, 'vertebral canal impingement': 1, 'vertebral rather than nonvertebral fractures': 1, 'dislocation of the costovertebral joints': 2, 'AVT, %': 1, 'Apical vertebral translation': 1, 'MITOCHRONDRIA OF VERTEBRATE': 1, 'vertebral bony anomaly': 1, 'vertebral, hepatobiliary and renal anomalies': 1, 'liver, heart, ocular, and vertebral anomalies': 1, 'cranial, vertebral,': 1, 'vertebral and clivus': 1, 'vertebral biconcave deformities': 1, 'vertebral, femoral, or both': 1, 'vertebral ostemoyelitis': 1, 'of the vertebral joints': 1, 'and vertebral deficiency': 1, 'vertebral level fractures': 1, 'caudal vertebral anomalies': 1, 'thoracolumbar vertebral malformations': 2, 'vertebral developmental malformations': 1, 'fractures of vertebral arches': 1, 'fractures of the vertebral arch': 1, 'vertebral swelling': 2, 'vertebral body segmentation anomalies': 2, 'heart, facial, or vertebral anomalies': 1, 'Magerl type A vertebral fractures': 1, 'vertebral osreomyelitis': 1, 'vertebral (D12) fracture': 1, 'disc, ligamentous and vertebral injuries': 1, 'vertebral or non-vertebral osteomyelitis': 1, 'multi-vertebral malformation': 1, 'vertebral canal fracture': 1, 'vertebral with lower extremities fractures': 1, 'complex vertebral malformation': 1, 'Complex vertebral malformation': 1, 'posterior vertebral damage': 1, 'vertebral and non-vertebral or limb fracture': 1, 'Posterior vertebral translation': 1, 'vertebral recollapse fractures': 1, 'Malformations of the occipito-vertebral joint': 1, 'upper thoracic vertebral fracture': 1, 'rib/vertebral anomalies': 1, 'vertebral, clinical, and nonvertebral fractures': 1, 'abnormalities in the vertebral disk': 1, 'vertebral-vertebral fistula': 1, 'vertebral or other clinical fractures': 1, 'Lumbosacral transitional vertebral (LTV) anomalies': 1, 'vertebral anomalyOsteochondrosis-': 1, 'vertebral bone developmental anomalies': 1, 'congenital cranio-vertebral junction (CVJ) anomalies': 1, 'VERTEBRAL MALFORMATIONS': 1, 'vertebral nerve damage': 2, 'Vertebral fractures in': 1, 'facioauricular vertebral spectrum': 1, 'eye and vertebral anomalies': 1, 'vertebral fractureHR': 1, 'Vertebral halisteresis': 1, 'vertebral recompression': 1, 'vertebral radiolucency': 1, 'vertebral strength reduction': 1, 'vertebral transverse process epiphysis': 1, 'Disco-vertebral necrosis': 1, 'anomaly of the VA': 1, 'vertebral type A fracture': 1, 'Spinal or costovertebral lesions': 1, 'vertebral and all fractures': 1, 'vertebral hyperintensities': 1, 'Vertebral artery anomaly and injury': 1, 'Vertebral Artery Anomaly': 1, 'vertebral artery (VA) anomaly and injury': 1, 'vertebral abnormities': 1, 'abnormal vertebral remodeling': 1, 'clefting of vertebral corpora': 1, 'T10 vertebral deformity': 1, 'vertebral fractures and': 1, 'spondylothoracic dystrophy': 2, 'butterfly vertebral anomaly': 1, 'Inflammatory vertebral lesions': 1, 'vertebral, non-vertebral and femur fractures': 2, 'Traumatic vertebral fracture': 1, 'vertebral shape deformity': 1, 'Vertebral fract': 1, 'disease of the VBC': 1, 'Vertebral Basilar Disease': 1, 'Diseases of the vertebral basilar circulation': 1, 'Diseases of the Vertebral Basilar Circulation': 1, 'VBC': 1, 'diseases of the VBC': 1, 'VBS': 1, 'vertebral fracture at': 1, 'costovertebral osteolysis': 1, 'penoscrotal and vertebral anomalies': 1, 'vertebral column and skeletal anomalies': 1, 'Jack vertebral': 1, 'Vertebral damage': 1, 'Congenital vertebral and urinary malformations': 1, 'herniation of the vertebral canal': 1, 'vertebral and chest wall anomalies': 1, 'vertebral, renal and cardiac anomalies': 1, 'osteonecrotic vertebral fractures': 1, 'vertebre borgne metastatique': 1, 'and clinical vertebral) fractures': 1, 'chordal and vertebral abnormalities': 1, 'and vertebral defects': 1, 'anomalies of VA': 1, 'Congenital deficiency of the vertebral pedicle': 1, 'vertebral or auditory defects': 1, 'VERTEBRAL ART': 1, 'subclavian and/or vertebral lesions': 1, 'vertebral deconditioning': 1, 'vertebral or other clinical': 1, 'of vertebral reduction': 1, 'ischemic vertebral fracture': 1, 'metastatic vertebral involvement': 1, 'Craniovertebral or vertebral malformations': 1, 'anomalies of vertebral and long bone': 1, 'fractura vertebral radiografica': 1, 'vertebral radiographic deformity': 1, 'costovertebral luxation': 1, 'CONGENITAL VERTEBRAL MALFORMATIONS': 1, 'Congenital vertebral anomalies of L7 and S1': 1, 'type 4 SCDO': 1, 'SCDO type 2': 1, 'Type 4 SCDO': 1, 'Type 2 SCDO': 1, '3 SCDO': 1, 'SCDO type 1 and 2': 1, 'RF-TVA': 1, 'congenital anomaly of C1 vertebral body': 1, 'vertebral hyperotosis': 1, 'multiple osteolytic vertebral lesions': 1, 'vertebral ostepenia': 1, 'vertebral, anomalies': 1, 'of right vertebral': 1, 'vertebral and all non-vertebral fractures': 1, 'canal vertebral diminui': 1, 'vertebral osteomyelistis': 1, 'vertebral bone/rib anomalies': 1, 'Vertebral Fracturesa': 1, 'vertebral staphylococcia': 1, 'vertebral bony anomalies': 1, 'VERTEBRAL LAMINA': 1, 'spondylothoracic dysplasia/dysostosis': 1, 'VERTEBRATE LOCALITIES': 1, 'or vertebral anomalies': 1, 'vertebral or limb abnormalities': 1, 'bowel and vertebral injuries': 1, 'scapular vertebral segmentation anomalies': 1, 'vertebral or neural pathologies': 1, 'vertebral arch deformities': 1, 'costovertebral ossification': 1, 'costovertebral ossification defect': 1, 'cardiac and vertebral abnormalities': 1, 'Vertebral Variations': 1, 'abnormality of the vertebral pattern': 1, 'Vertebral osteoarthropathy': 1, 'gastrointestinal, diaphragmatic, vascular, vertebral, and cardiac anomalies': 1, 'palatal and vertebral skeletal defects': 1, 'pyogenic vertebral ostemomyelitis': 1, 'vertebral (skeletal) anomaly': 1, 'intraforaminal vertebral artery anomalies': 1, 'vertebral GCTB': 1, 'vertebral and disc abnormalities': 1, 'vertebral fracture.116': 1, 'subaxial vertebral hypoplasia': 1, 'osteoprotic vertebral fractures': 1, 'vertebral fractureLower': 1, 'osteopathic vertebral lesion': 1, 'spondylothoracic dysplasias': 1, 'NewVF': 1, 'vertebral and non-vertebral and hip fracture': 1, 'vertebral, and limb fractures': 1, 'vertebral dysmorphologies': 1, 'midline vertebral defects': 1, 'Thoracic vertebral involvement': 1, 'VAP': 1, 'non-vertebral fracture reduction': 1, 'congenital anomalies of cranio-vertebral junction': 1, 'Congenital CVJ anomalies': 1, 'vertebral and non vertebral (including hip) fractures': 1, 'vertebral fractures23': 1, 'vertebral fractureAn': 1, 'porotic vertebral fractures': 1, 'vertebral, but not nonvertebral, fractures': 1, 'dislocation of the vertebral': 1, 'vertebral or disc problems': 2, 'spondylothoracic/spondylocostal dysplasia': 1, 'Vertebral fractureN': 1, 'Vertebral photopenia': 1, 'vertebral or disc deformity': 1, 'costovertebral joints': 1, 'Sandwich vertebral': 1, 'sandwich vertebral': 1, 'vertebral venous expansion': 1, 'vertebral ligament injury': 1, 'vertebral Chance fractures': 1, 'limitation of vertebral movement': 1, 'Vertebral fractureSpinal injury': 1, 'Congenital aortic arch and vertebral artery anomalies': 1, 'costovertebral pressure pain': 1, 'Jarcho-Levin syndromes': 1, 'malformations at the cranial-vertebral junction': 1, 'injury of vertebral': 1, 'Costovertebral': 1, 'dislocation of one or multiple costovertebral joint': 1, 'costovertebral joint dislocations': 1, 'Traumatic costovertebral joint dislocation': 1, 'dislocation of the costovertebral joint of ribs': 1, 'costovertebral dislocations': 1, 'dislocation of the costovertebral articulation': 1, 'vertebral, cardiac, and possible renal anomalies': 1, 'hypomobility of costovertebral articulations': 1, 'posterior vertebral defects': 1, 'anal or vertebral anomalies': 1, 'vertebral arrosion': 1, 'vertebral and recurrent fractures': 1, 'vertebral (morphometric) fractures': 1, 'intra-vertebral cleft': 1, 'Costovertebral and/or suprapubic pain': 1, 'vertebral transverse apophyses': 1, 'Vertebral infectionsare': 1, 'fratura de coluna vertebral': 1, '(non-vertebral) fractures': 1, 'Fractured vertebral': 1, 'vertebral osteomyelitisStaphylococcus epidermidis': 1, 'vertebral, ribs anomalies': 1, 'Spondylothoracic dysplasia (STD) syndrome': 1, 'CVJ dislocation': 1, 'fourth and sixth costovertebral dislocation': 1, 'dislocation of the left fourth and sixth CVJs': 1, 'costovertebral joint injuries': 1, 'dislocations of the costovertebral joints': 1, 'CVJ dislocations': 1, 'fourth or sixth CVJ dislocation': 1, 'costovertebral joints malalignment': 1, 'CVJ fracture-dislocations': 1, 'CVJ': 1, 'costovertebral joint (CVJ) dislocations': 1, 'Injury to the costovertebral joints': 1, 'CVJ fracture-dislocation': 1, 'CVJ injuries': 1, 'left fourth and sixth CVJ dislocation': 1, 'craniofacial and vertebral ossification anomalies': 1, 'left costovertebral angle pain': 1, 'vertebral ostelytic lesions': 1, 'vertebral functional': 1, 'Vertebral type 2': 1, 'Vertebrate anomaly': 1, 'scapular or vertebral fractures': 1, 'VERTEBRAL ARTERIOGRAPHIES': 1, 'craniocervical vertebral anomalies': 1, 'postoperative adjacent vertebral fracture': 1, 'vertebral lumbosciatica': 1, 'VVP': 1, 'vertebral or lower extremity fractures': 1, 'vertebral or sacral anomaly': 1, 'digital, vertebral': 1, 'Posterior inter vertebral disease': 1, 'vertebral ostenecrosis': 1, 'ischemic vertebral-basilar episode': 1, 'Congenital vertebral diseases': 1, 'Vertebral arch nonfusion': 1, 'VAN': 1, 'vertebral arch nonfusion': 1, 'osteoporotic vertebral, non-vertebral, and hip fractures': 1, 'congenital anomaly of VA': 1, 'congenital VA anomalies': 1, 'Congenital vertebral artery anomaly': 1, 'vertebral vertebral fracture': 1, 'Vertebral /': 1, 'thoracolumbar vertebral malformation': 1, 'Costovertebral arthropathy': 1, 'Costovertebral joint erosion': 1, 'TL vertebral fractures': 1, 'thoracolumbar (TL) vertebral fracture': 1, 'disco-vertebral disorders': 1, 'disco-vertebral disease': 1, 'congenital anomalies of the bony vertebral column': 1, 'VERTEBRATE EVOLUTION': 1, '(vertebral) fracture': 1, 'Vertebral reticulohistoplasmocytoma': 1, 'vertebral, and distal': 1, 'clinical vertebral fracture': 1, 'and Vertebral Anomalies': 1, 'Bony vertebral anomalies': 1, 'VFs;Incident': 1, 'vertebral-to-': 1, 'Costovertebral and costo-transverse joint arthritis': 1, 'vertebral and numerical or structural rib anomalies': 1, 'aneurisma de arteria vertebral': 1, 'Angiografia digital de Arteria Vertebral izquierda': 1, 'Arteria vertebral': 1, 'arteria vertebral proximal al aneurisma': 1, 'T10 vertebral fracture': 2, 'vertebral dystrophia': 1, 'vertebral and associated anomalies': 1, 'reduction of both vertebral and non-vertebral fractures': 1, 'heart, vertebral, diaphragmatic, and spleen anomalies': 1, 'vertebral, anal, cardiac, renal, and limb anomalies': 1, 'iVFs': 1, 'thoracic congenital vertebral malformations': 1, 'Developmental anomalies of the distal vertebral artery and': 1, 'vertebral osteomyelytis': 1, 'posterior vertebral dislocation': 1, 'Costovertebral Joints': 1, 'vertebral anomalies and fractures': 1, 'intestinal, renal, cardiac, vertebral and limb anomalies': 1, 'VERTEBRAL DYSTROPHIES': 1, 'vertebral truncations': 1, 'deformity of VFs': 1, 'TVF': 3, 'vertebral alteration': 1, 'vertebral hypermineralisation': 1, 'genital, vertebral, or cardiac anomalies': 1, 'Vertebral Involvement': 1, 'Avulsion of the posterior vertebral epiphysis': 1, 'vertebral aneurism': 1, 'VERTEBRAL FRACTURE': 1, 'vertebral softening': 1, 'vertebral metastatic fractures': 1, 'Vertebral type': 1, 'costo-sternal and vertebral anomalies': 1, 'vertebral-myelic lesions': 1, 'vertebral fracture of upper': 1, 'Vertebral fracture Other': 1, 'VE': 1, 'osteroporotic vertebral fracture': 1, 'non -vertebral fracture': 1, 'Transitional vertebral anomaly': 1, 'vertebral blowout fractures': 1, 'thoracolumbar junction vertebral fracture': 1, 'craniofacial-vertebral anomalies': 1, 'split vertebral fracture': 1, 'Vertebral fractures1': 1, 'REPSIRATORY TISSUE OF VERTEBRATES': 1, 'Vertebral segmentation anomalies': 1, 'CNS, renal, TEF, vertebral, limb, and cardiac anomalies': 1, 'costo-vertebrate anomalies': 1, 'cervicothoracic vertebral deformities': 1, 'congenital lumbar vertebral anomalies': 1, 'S1 vertebral corpus fusion anomaly': 1, 'congenital vertebral body anomaly': 1, 'Vertebral Body Anomaly': 1, 'vertebral corpus developmental anomaly': 1, 'vertebral corpus fusion anomaly': 1, 'vertebral morphological deformities': 1, 'vertebral or extra-vertebral injuries': 1, 'dystrophic vertebral deformity': 1, 'T9 vertebral anomaly': 1, 'ankylosis of both intervertebral and costovertebral joints': 1, 'vertebral number variation': 1, 'eye, ear, facial and vertebral anomalies': 1, 'LVN': 1, 'internal genital and vertebral anomalies': 1, 'Vertebral anomalies and variable Endocrine and T-cell Dysfunction': 1, 'vertebral deformity or fracture': 1, 'anteroposterior dislocation of thoracic vertebral': 1, 'osteoarthritis of the costovertebral joints': 1, 'vertebral anomalies 1': 1, 'multi-vertebral malformations': 1, 'vertebral malformation defects': 1, 'vertebral losses': 1, 'of vertebral disc': 1, 'ILVA anomaly': 1, 'costovertebral or costotransverse joint dysfunction': 1, 'vertebral and thoracic alterations': 1, 'vertebral rotation1': 1, 'inflammatory vertebral lesion': 1, 'traumatic vertebral pathology': 1, 'traumatic vertebral deformity': 1, 'vertebral anomalies and scoliosis': 1, 'urinary and vertebral defects': 1, '-vertebral fracturea': 1, "hypoplastic VA's": 1, 'posterior limbus vertebral lesions': 1, 'Posterior limbus vertebral lesions': 1} | vertebral fractures |
Disease | MESH:C535782 | {'Spondyloenchondrodysplasia': 51, 'spondyloenchondrodysplasia': 88, 'SPENCD': 34, 'enchondromatous-like lesions': 1, 'Spondyloenchondromatosis': 5, 'spondyloenchondrodysplasia with': 2, 'spondyloenchondromatosis': 11, 'enchondromatous': 2, 'Cheiro-spondyloenchondromatosis': 1, 'enchondromatous lesions': 6, 'Enchondromatous lesions': 2, 'enchondromatous process': 1, 'SPondyloENChonDrodysplasia': 1, 'SED': 1, 'enchondromatous involvement': 1, 'SPENCD disorder related': 1, 'inherited disease spondyloenchondrodysplasia': 1, 'SPENCD disease': 1, 'spondyloenchondrodysplasia, type IV': 1, 'Spondyloenchondrodysplasia (type IV': 1, 'Spondyloenchondrodysplasia with': 2, 'SPENCD) syndrome': 1, 'SEM': 1, 'SPENCD skeletal dysplasia': 1, 'Spondyloenchondrodysplasia or type IV': 1, 'enchondromatous conditions': 1, 'Familial Spondyloenchondrodysplasia': 1, 'SPENCD syndrome': 1, 'immuno-osseus dysplasia spondyloenchondrodysplasia': 1, 'SPENCD-associated lupus': 1, 'immuno-osseous dysplasia spondyloenchondromatosis': 1, 'enchondromatous lesions in': 1, 'glomerulopathy Spondyloenchondrodysplasia': 1, 'spondylometaphyseal enchondromatous': 1, 'Enchondromatous involvement of': 1} | spondyloenchondrodysplasia |
Disease | MESH:C535783 | {"Petersen's defect": 72, 'Petersen defect': 17, 'mesenteric and Petersen defects': 7, "mesenteric and Petersen's defects": 3, "pseudo-Petersen's defect": 1, '-Petersen Osteotomy': 5, '-Petersen': 23, 'LP': 1, 'autosomal recessive spondyloepimetaphyseal dysplasia': 3, 'Petersen herniation': 2, 'Petersen': 4, "and Petersen's defects": 3, "Petersen's": 5, 'mesenteric or Petersen defect': 1, 'Whyte-Hemingway': 2, 'Mesenteric and Petersen defects': 1, 'PD': 3, 'PI': 1, 'Petersen`s defect': 1, 'Petersen s defect': 1, "petersen's defect": 1, 'Hedley-Whyte-type': 1, 'MLP': 1, 'autosomal-recessive spondyloepimetaphyseal dysplasia': 2, "or Petersen's defect": 1, 'recessive spondyloepimetaphyseal dysplasias': 2, 'autosomal recessive SEMD': 1, '-Petersen osteotomy': 2, "-Petersen's": 2, 'PETERSEN': 1, "mesenteric and Petersen's defect": 1, 'and Petersen defects': 1, 'whyte matter lesions': 1, '-Petersen and Ponte': 1, 'Petersen mesenteric defect': 2, "patent Petersen's defect": 1, "Petersen's defects": 1, "-Petersen's cup": 1, '-Petersen mold': 1, "Petersen's syndrome": 1, 'Mesenteric and Petersen defect': 1, 'spinal disorders spondyloepimetaphyseal dysplasia': 1, 'autosomal recessive Spondyloepimetaphyseal dysplasia': 1, 'Petersen Defect': 1} | Petersen's defect |
Disease | MESH:C535784 | {'dislocated dysplasia': 3, 'dislocation dysplasia': 1, 'Dysplasia or dislocation': 1, 'dysplasia or dislocation': 1, 'dysplasia/ dislocation': 1, 'Spondyloepimetaphyseal dysplasia with multiple dislocations': 1, 'SEMDJL': 1, 'spondyloepimetaphyseal dysplasia with joint dislocations, leptodactylic type': 1, 'dysplasia and dislocation': 4, 'spondyloepimetaphyseal dysplasia with multiple dislocations': 3, 'leptodactylic type': 2, 'Hall-type spondyloepimetaphysial dysplasia': 1, 'SEMD with multiple dislocations': 1, 'dislocating dysplasia': 1, 'dislocated dysplasia hips7': 1, 'dysplasia dislocation': 1, 'Skeletal dysplasia with multiple dislocations': 1, 'Skeletal dysplasias with multiple dislocations': 1, 'skeletal dysplasia with multiple dislocations': 1, 'Hall type spondyloepimetaphyseal dysplasia': 1} | dysplasia and dislocation |
Disease | MESH:C535785 | {'NANS-deficient': 2, 'NANS deficiency': 8, 'NANS type': 1, 'NANS-mediated disease': 1, 'NANS-congenital disorder of glycosylation': 1, 'NANS-CDG': 6, 'CDG': 1, 'NANS': 15, 'GENEVIEVE': 2, 'NANS-': 3, 'NANS-deficiency': 4, 'Camera-Genevieve type spondyloepimetaphyseal dysplasia': 1, 'NANS.no': 1, 'NANS 2019': 1} | NANS |
Disease | MESH:C535786 | {'SPONASTRIME Dysplasia': 3, 'SPONASTRIME dysplasia': 12, 'spondylar and metaphyseal lesions': 5, 'sponastrime dysplasia': 3, 'endochondromatous nonossifying metaphyseal and spondylar lesions': 1, 'metaphyseal and spondylar lesions': 2, 'Sponastrime dysplasia': 8, 'SD': 2, 'spondylar and nasal alterations': 2, 'spondylar abnormalities': 1, 'metaphyseal alterations': 1, 'metaphyseal alterations of': 1, 'SPONASTRIME': 2, 'Spondylar and Nasal Changes': 1, 'SPONASTRIME) dysplasia': 1, 'SPOndylar and NAsal changes': 1, 'SPONASTRIME syndrome': 1, 'Sponastrime Dysplasia': 1} | SPONASTRIME dysplasia |
Disease | MESH:C535787 | {'CS type C and type A.': 1, 'pap.': 2, 'Had pap': 1, 'Lum Pap': 1, 'Pap Papanicolaou': 1, 'CS': 471, 'pap': 218, 'Pap': 166, 'CHS': 6, 'Chondroitin': 6, 'TARS': 9, 'OSCS': 22, 'FucCS': 5, 'pap abnormality': 1, 'CS-E': 7, 'Pap III or worse': 1, 'Pap III': 10, 'De-Toledo': 1, 'PAPs': 83, 'TSHA': 5, 'CH': 6, 'CAD': 1, 'Oncofetal Chondroitin Sulfate': 2, 'OCS': 5, 'Toledo-Luc': 1, 'Type II KS': 1, 'IP': 1, 'C4S': 2, 'Pap I-II': 1, 'OPGMN': 1, 'OGMN': 1, 'PGMN': 1, 'CHONDROITIN SULFATES': 1, 'Pap abnormalities': 33, 'VAR2CSA': 4, 'SCS': 3, 'Pap(1) Nx': 1, 'Pap stain': 1, 'pap muc': 1, 'muc/pap': 1, 'fCS': 2, 'Pap abnormality': 20, 'CS-D Chondroitin-4,6-O-sulfate 4S, 6S': 1, 'CS-T': 1, 'CS-C': 7, 'Pap x400': 3, 'MACS-C': 1, 'MACS-A': 1, 'Pap 3B': 1, 'Pap V': 6, 'pap I': 1, 'pap III': 1, 'PaP': 5, 'Toledo': 8, 'Toledo type brachyolmia': 1, 'CPF': 1, 'ofCS': 1, 'abnormal pap': 3, 'ChS': 4, 'CSD': 3, 'Chn': 1, 'C6S': 4, 'Pap cytological abnormalities': 1, 'pAP': 3, 'BC': 10, 'CS PRETREATED': 1, 'paps': 6, 'THA': 1, 'SeCS': 2, 'Paloma Toledo': 1, 'CS GAG CHAINS': 1, 'HSIL pap': 1, 'Chondroitin sulfate-deficient': 1, 'CHONDROITIN': 9, 'CHONDROITIN SULFATE C': 1, 'Pap IIw': 1, 'PROMOTION EFFECT OF CHONDROITIN SULFATE ON PROLIFERATION OF MYOBLASTS': 1, 'pAPS': 7, 'PAp': 4, 'pap.:luminal': 1, 'pap-tub': 3, 'Pap - Papanicolaou': 19, 'sulfate transporter dysplasia': 1, 'Pap-II': 1, 'FucCS type I': 1, 'CSA': 2, 'CS type A': 1, 'HACS': 1, 'Chondroitin-6-sulfate': 1, 'type-III KS': 1, 'tub1-pap-muc': 1, 'CHONDROITIN SULFATE AND NEURAMINIC ACID': 1, 'INTRACELLULAR CHONDROITIN SULFATE': 1, 'HCP': 1, 'Chondroitin-4-sulfate': 2, 'IDURONIC ACID MOIETY OF CHONDROITIN SULFATE B': 1, 'CS-A': 7, 'Pap 3b and 4': 1, 'BIOSYNTHASE CHONDROITIN': 1, 'DS': 3, 'Toledo-Tehuantepec deficiency': 1, 'CS.NM': 1, 'pap abnormalities': 3, 'Chondroitin-4-sulphate': 1, 'V6.pap': 1, 'CSMA': 2, 'EFFECTS OF CHONDROITIN SULFATE': 1, 'EFFECT OF OESTROGEN ON CHONDROITIN SULPHATE': 1, 'pap touse': 1, 'hpCS': 1, 'PG-CS': 1, 'Toledo compromise': 1, 'CSC': 6, 'Pap II': 4, 'chondroitin-4-sulfate': 1, 'Pap III-p': 2, 'CHONDROITIN SULPHATE': 3, 'Toledo infection': 1, 'Bi-Pap': 1, 'PEPTIDES OF CHONDROITIN 4- OR 6-SULFATE': 1, 'We-Pap': 1, 'EFFECT OF CHONDROITIN': 1, 'Pap II-p': 2, 'Pap IIID1': 3, 'sulfate transporter related dysplasias': 1, 'SODIUM CHONDROITIN SULFATE': 1, 'Toledo-Aceves': 1, 'Pap Brush': 1, 'chondroitin': 1, 'Chondroitin Sulfate': 1, 'Parma pap': 1, 'CHPF': 3, 'pap)': 1, 'PaPs': 1, 'CSs': 1, 'CS tumor': 1, 'Pap V.': 1, 'Pap smeara': 1, 'IPUL-CST': 1, 'ChPF': 1, 'FCS': 3, 'CS-D': 2, 'ACSSD': 1, 'D-ACSSD': 1, 'Pap-BT': 1, 'Paps': 5, 'Abnormal Paps': 1, 'abnormal Paps': 2, 'CHONDROITIN SULFATE': 6, 'Chondroitin 4- and 6-sulfate': 1, 'chondroitin 4- and 6-sulfate': 1, 'Pap IIID2': 2, 'Pap Abnormal': 1, 'C4ST deficiency': 1, 'ST': 1, 'Stegen-Toledo': 1, 'Toledo Cell Toxicity': 1, 'CHOND4': 1, 'BIOSYNTHESIS CHONDROITIN': 1, 'abnormal Pap': 1, 'Idiopathic PAPs': 1, 'QR.pap': 1, 'Lowgrade Paps': 1, 'BIOSYNTHESIS OF CHONDROITIN SULFATE': 1, 'MT': 1, 'C6S.': 2, 'poly chondroitin recurrent': 1, 'NSOSCS': 1, 'URINARY ELIMINATION OF CHONDROITIN SULFATE B': 1, '-Paps': 1, 'Toledo-Ponce': 1, 'ANTI-INFLAMMATORY PROPERTIES OF CHONDROITIN SULFATE': 1, 'CHONDROITIN SULFATE AS PREVENTATIVE THERAPY': 1, 'CS-deficient': 1, 'EFFECT OF EXTRACELLULAR CHONDROITIN SULFATE': 1, 'mielie pap': 2, 'Pap syndrome': 1, 'Pheochromocytoma Chondroitin sulfate andheparan sulfate': 1, 'mPAP': 1, 'CSE': 1, 'Pap I': 2, 'pap carcinoma': 1, 'Pap V-p': 1, 'Pap II-a': 1, 'c-pap': 1, 'CS insufficiency': 1, 'CS Insufficiency': 1, 'holothurian FCS': 1, 'FCSs type II': 1, 'Pap 3b or worse': 1, 'CC-Pap RCCs': 1, 'C6ST-1 deficiency': 1, 'PaP-': 1, 'Pap - Papnicolaou': 1, 'Pap-Fol': 1, 'ISOLATION OF CHONDROITIN': 1, 'CALCIUM CHONDROITIN SULFATE': 1, 'CHONDROITIN SULFATE-CHLOROQUINE': 1, 'CA': 1, 'HERG-Pap': 1, 'MALL-Pap': 1, 'CHONDROITIN-4-SULFATE': 1, 'Ch6S': 1, 'Ch4S': 1, 'ChSs': 1, 'ChSE': 1, 'Pap smear (Pap) abnormalities': 1, 'Chitosan-Chondroitin': 1, 'pap-illitis': 1, 'Congenital disorders of CS': 1, 'Congenital Disorders of Chondroitin Sulfate Deficiency': 1, 'Toledo Congenital': 1, 'pap-illomavirus': 1, 'of the urinary CS': 1, 'CS-MA': 1, 'Abnormal Pap': 2, 'chondroitin abnormalities': 1, 'CS type B': 1, 'tubulo-pap': 1, 'CS-': 1, 'Pap-Fed': 1, 'CS-E.': 1, 'CS-A.': 1, 'Toledo tumor': 1, 'Pap- Papanicolaou': 1, 'Pap 4': 1, 'pap I-III': 1, 'CHONDROITIN SULFATE ON': 1, 'Pap lesions': 1, 'Pap II-': 1, 'INTRACELLULAR SYNTHESIS OF CHONDROITIN SULFATE': 1, 'Cerro Toledo obsidian': 1, 'Toledo Rhyolite': 1, 'CT': 1, 'Pap III and': 1, 'Dysplasia sulfate transporter': 1, 'Arthrum HCS': 1, 'CS-type C': 1, 'sHS': 1, 'chondroitin deficiency': 1, 'Pap Abnormality': 2, 'CSA-PNPs': 1, 'cytologic (Pap) abnormalities': 1, 'derm Epidermis Pap': 1, 'sulfate transporter dysplasias': 1, 'CHONDROITIN-4': 1, 'Pap-Gruppe III-': 1, 'Pap-Gruppen': 1, 'Pap II-e': 1, 'Pap V-g': 1, 'Pap I and II': 1, 'Toledo tumors': 1, 'GCF CS': 1, 'SODIUM CHONDROITIN SULFATE ON': 1, 'CS-B': 1, 'TOLEDO': 1, 'Chondroitin sulfate Disease': 1, 'CSCL': 1, 'Pap 100X.': 1} | CS |
Disease | MESH:C535788 | {'sedative use disorder': 105, 'S-H': 1, 'SED': 599, 'sed': 164, 'spondyloepiphyseal dysplasia congenita': 190, 'Sed': 18, 'sedative-related disorder': 1, 'Sedative Hypnotics': 5, 'SEDC': 111, 'brachiaticae similis sed ramis': 1, 'Sedative Disorder': 1, 'SEDATIVE AOLAN': 1, 'SEDATIVES-HYPNOTICS': 1, 'sedative': 271, 'congenital spondyloepiphyseal dysplasia': 16, 'sedative/hypnotic use disorder': 6, 'Congenital spondyloepiphyseal dysplasia': 7, 'teratogenic sedative': 1, 'Sedative dependence': 21, 'Spondyloepiphyseal dysplasia congenita': 66, 'Sedative': 83, 'sedative addiction': 6, 'SEDs': 28, 'congenital hypoplasia, dysplasia': 1, 'SEDM': 1, 'Sedative-Use Disorder': 1, 'ANTICHOLINERGIC-SEDATIVE COMBINATION': 1, 'PSUE': 1, 'and sedative use disorders': 2, 'sedative abuse': 28, 'sedative dependence': 33, 'EIS': 1, 'sedative-hypnotic overdose': 1, 'OF HYPNOTICS AND SEDATIVES': 1, 'AHS': 2, 'SE': 1, 'SH': 5, 'SHA': 3, 'Sedative, Hypnotic and Anxiolytic Use Disorder': 1, 'Sedative wariness': 1, 'decrea-sed': 3, 'DIS': 1, 'sedative use': 10, 'SEDATIVES': 9, 'narcotic and sedative withdrawal syndrome': 1, '-SED': 1, 'SEd': 1, 'Sedative Dependence': 20, 'SeD': 23, 'Skeletal Defect Strickler syndrome type I Spondyloepiphyseal dysplasia': 1, 'sedative-hypnotic syndrome': 2, 'sedative use disorders': 38, 'Sedative use': 4, 'SHD': 2, 'spondyloepiphyseal dysplasia congenital': 17, 'sedative*.mp': 1, 'SED 41': 1, 'SED 43': 1, 'DSM-IV sedative and/or tranquilizer use': 1, 'Sedative Use Disorder': 16, 'ST use disorder': 1, 'tranquilizer or sedative use disorders': 1, 'sedative disorder': 5, 'Sedative-Hypnotic Activity': 2, 'SEDATIVE AGENTS': 1, 'Anxiogenic and Sedative': 1, 'ASH': 4, 'SEDATIVE AND ANALGESIC MEDICATIONS': 1, 'autosomal dominant spondyloepiphyseal dysplasia congenita': 2, 'Spondyloepihpyseal dysplasia congenita': 1, 'sedative-hypnotic-use disorder': 1, 'sedative problems': 1, 'congenital dysplasia syndrome': 2, 'dysplasia coxae congenita': 5, 'SED-GIH': 5, 'SLM': 1, 'sAH': 1, 'nsAH': 1, 'sedative hypnotic use disorderPending': 1, 'sedative hypnotic use disorder': 1, 'CP.12.sed': 1, 'CP12.sed': 1, 'SED) congenita': 1, 'SED congenita': 23, 'MECHANISM OF THE SEDATIVE ACTION OF NICOTINAMIDE': 1, 'U]sed': 1, 'Sedative Use': 2, 'SEDATIVE THERAPY WITH CENTALUN': 1, 'Sedative use disorder': 29, 'sedative drug misuse': 1, 'congenital dysplasia disease': 2, 'sedative abuse or': 1, 'sedative-hypnotic use disorder': 7, 'SB': 1, 'SED with': 1, 'SED with progressive arthropathy': 1, 'NONBARBITURATE SEDATIVE': 2, 'spondyloepiphyseal dysplasia (SED) congenita': 7, 'SED stigmata': 1, 'sedative and stimulant use disorder': 1, 'Sedative misuse': 3, 'dysplasia luxans coxae congenita': 1, 'SEDC-M': 3, 'Spondyloepiphyseal Dysplasia Congenita': 14, 'SEDC-S': 1, 'Gull_B_sed': 1, 'Gull_C_sed': 1, 'SED-O': 1, 'sedative dependency': 1, 'SED&FR': 2, 'Sedative-Hypnotic': 9, 'OSHA': 1, 'lat_sed': 1, 'TSSp': 2, 'Sedative hypnosis': 1, 'Sedative abuse': 11, 'SL': 3, 'sed stipitis': 1, 'STATUS OF HYPNOTICS AND SEDATIVES': 2, 'SED with metatarsal shortening': 3, 'Sedative Dependenced': 1, 'spondyloephyseal dysplasia congenita': 1, 'Spondyloephyseal dysplasia congenita': 1, 'Sedative Hypnotic Related Disorders': 1, 'Sedative and Hypnotic': 1, 'Sedative hypnotic-related disorders': 1, 'holotypus sed': 1, 'SEDATIVE MEDICATIONS': 1, 'and sedative': 2, 'sedative dependence disorders': 1, 'Anxiolytic and sedative': 1, 'anxiolytic and sedative': 1, 'sedative-hypnotic use disorders': 2, 'diebus (344) sed alternis apposuimus DTR': 1, 'Sedative Addiction': 1, 'sedative withdrawal syndrome': 2, 'Sedative Misuse': 3, 'Sedative withdrawal syndrome': 1, 'Sedative disorder': 1, 'hypersensitive to sedative effects': 1, 'sedative, cocaine, and cannabis use disorder': 1, 'SED_A': 1, 'SED_B': 1, 'COMMONLY USED SEDATIVES AND ANALGESICS': 1, 'sedc': 4, 'Sed Disease': 1, 'SADs': 2, 'inc. sed.': 2, 'NEW SEDATIVE THERAPEUTIC METHOD IN PEDIATRICS': 1, 'Sedative Abuse': 7, 'spondyloepiphesial dysplasia congenita': 1, 'Dysplasia spondyloepiphysaria congenita': 2, 'CENTRAL SEDATIVE TREATMENT IN VEGETATIVE DYSTONIA AND': 1, 'COMPOSITUM AS SEDATIVES': 1, 'Sedative behavior': 1, 'Sleep sedative': 1, 'Spondyloepiphyseal dysplasia congenital': 5, 'Sedative effects': 3, 'sedative adverse': 1, 'achondrogenesis type II-SED congenita': 1, 'sedative overdose': 6, 'sedative overdosage': 1, 'sed quis custodiet ipsos custodes': 1, 'opioid or sedative withdrawal syndrome': 1, 'sed their HIV status? (SE-SCC': 1, 'SEDc': 5, 'SEDC with': 1, 'narcotic sedative': 1, 'congenital dysplasia diseases': 2, 'stimulant and sedative': 1, 'and sedative abuse': 1, 'stimulant and sedative abuse': 2, 'EFFECTS OF SEDATIVES': 1, 'depres-sed': 1, 'cocaine and sedative use disorders': 1, 'heroin and sedative use disorders': 1, 'heroin, cocaine and sedative use disorders': 1, 'Spondyloepiphyseal dysplasia congenital - SEDC': 1, 'Spondyloepiphyseal dysplasia congenita syndrome': 2, 'sedative/tranquilizer use disorder': 4, 'AEWP-sed': 1, 'AEL-sed': 1, 'Sedative-Hypnotics': 2, 'sedative-hypnotics': 1, 'Sedative-hypnotics': 1, 'sedative (': 1, 'SED-': 8, 'Fo.sed': 1, 'Spondyloepihyseal Dysplasia Congenita': 1, 'Sedative-related disorders': 3, 'Sedative overdosage': 1, 'sEDS': 1, 'Dysplasia spondylometa-epiphysaria congenita': 1, 'dysplasia spondyloepiphysaria congenita': 2, 'ASAs': 1, 'ASA': 1, 'NERVE SEDATIVE': 1, 'opiate or sedative use disorders': 2, 'NBSH': 2, 'sED': 3, 'NEURO-SEDATIVE ANESTHETICS': 1, 'Tonic or sedative': 1, 'DEEP SEDATIVES': 1, 'EFFECTIVENESS OF SEDATIVES': 1, 'SHs': 2, 'SED dysplasia': 1, 'Sedative-': 3, 'SDBI': 1, 'Sedative Hypnotic Medications': 1, 'SEDATIVE HYPNOTIC/': 1, 'digestive, and sedative diseases': 1, 'SEDATIVE MISUSE PREVALENCE': 1, 'BSH': 1, 'spondyloepiphisal dysplasia congenita': 1, 'hypnotic/sedative use disorders': 1, 'hypnotic or sedative use disorder': 1, 'sedative symptoms': 1, 'SIGNIFICANCE OF PRESCRIPTION-FREE SEDATIVES AND HYPNOTICS': 1, 'Sedative, Hypnotic, or': 1, 'Sedative/tranquilizer and stimulant use disorders': 2, 'SEDATIVE PENTOBARBITAL CALCIUM': 1, 'sed-F CAAATATATTGATATAATGA': 1, 'Heterozgyous spondyloepiphyseal dysplasia congenita': 1, 'Spondyloepiphiseal dysplasia congenita': 1, 'sedative disorders': 1, 'or sedative': 1, 'T-SED': 1, 'NPUSH': 1, 'NMSU': 1, 'sedative and': 1, 'cardiac and sedative problems': 1, 'Sedative drug': 1, 'Congenital SEDs': 1, 'sedative/tranquilizer misuse': 1, 'Sedative, hypnotic': 1, 'sedative/': 2, 'sed hyphis et cellulis conidiogenis hyalinis': 1, 'sed conidiis 3-4': 1, 'SEDC-SEMD': 1, 'covid.sed.hu': 1, 'BARBITURATE-FREE SEDATIVES': 1, 'ClinicalRandomi-sed 2': 1, 'congenital syndromes and dysplasias': 1, 'hepatic, sedative': 1, 'Hypoglycemia Sedatives': 1, 'Constipation Sedatives': 1, 'COL2 SED congenita': 1, 'Spondyloepiphysea l dysplasia congenita': 1, 'SEDATIVE': 5, 'sedative-related disorders': 2, 'SED-SEE': 1, 'PRE-OPERATIVE SEDATIVE': 1, 'SUD': 1, 'MODERATE SEDATION WITH SEDATIVES': 1, 'VARIOUS SEDATIVES': 1, 'spondyepiphyseal dysplasia congenita': 1, 'Spondyloepiphyseal dysplasia congenita': 1, 'Sedative Poisoning': 1, 'congenital spondyloepiphyseal': 1, 'PSYCHIC EFFECT OF SEDATIVES UNDER NORMAL AND STRESS CONDITIONS': 1, 'Sedative/Tranquilizer': 1, 'sedative-hypnotic withdrawal syndromes': 1, 'Sedative polypharmacy': 1, 'SEDATIVE drugs': 1, 'SED tarda and congenita': 1, 'sedative/tranquilizer': 2, 'OTHER SEDATIVE': 1, 'DUhTP sed': 1, 'DUC sed': 1, 'vitae sed scientiam discimus': 1, 'Sedative abuse/dependence': 1, 'Sedative-Hypnotic Use Disorder': 1, 'DAILY INTERRUPTION OF SEDATIVE INFUSIONS': 1, 'Sedative Infusions': 2, 'sedative adverse effects': 1, 'PI_sed': 1, 'NON-SEDATIVE PHENOTHIAZINE DERIVATIVES': 1, 'SPA abuse': 1, 'SPA': 1, 'and sedative diseases': 1, 'sedative diseases': 1, 'SYMPTOMATIC USE OF THE HYPNOTIC AND SEDATIVE CENTALUN IN INTERNAL DISEASES': 1, 'sed Se increases activity. Se deficiency': 1, 'SED injuries': 1, 'USE OF NEURO-SEDATIVES': 1, 'USE OF SEDATIVES': 1, 'opiate or sedative': 1, 'Sedative-Tranquilizer Misuse': 1, 'sedative medication': 1, 'PHARMACOLOGY OF SEDATIVES AND ANALGESICS': 1, 'opiate and sedative use disorders': 1, 'SeD sexual dysfunction': 1, 'SED congenital': 1, 'sedative and stimulant use disorders': 1, 'sed-sej': 1, 'TREATMENT OF SEDATIVE-HYPNOTIC POISONING': 1, 'SEDATIVE ACTION OF RESERPINE': 1, 'sedative poisoning': 1, 'SED-C': 2, 'SED-HF': 1, 'Sedative use disorders': 5, 'Spondyloepiphyseal dysplasia (SED) congenita': 1, 'ACUTE POISONING WITH HYPNOTICS AND SEDATIVES': 1, 'HYPNO-SEDATIVE COMBINATION': 1, 'sedative related disorders': 1, 'sedative drug poisoning': 1, 'SEDATIVE-HYPNOTIC': 2, 'Hypnotic-sedatives COVID': 1, 'ED-SED': 1, 'ADDICTION TO SEDATIVES': 1, 'SEDC MIM': 1, '1hr_sed': 1, 'sed habitu suffruticoso': 1, 'Sedative effect': 1, 'opiate and sedative-use disorder': 1, 'CUS': 1, 'apsy-sed': 1, 'SEDATIVE PREMEDICATION': 1, 'Congenital hypoplasia and dysplasia': 1, 'Sedative Choice': 1, 'Sedative-use disorder': 1, 'SED MIR140': 1, 'SF': 1, 'sedative hypnotic': 1, 'sedative hypnosis': 1, 'Top-N gzip sed': 1, 'NONBARBITURATE SEDATIVES': 1, 'sedative or': 1, 'EVALUATION OF THE SEDATIVE ACTION': 1, 'spondyloepiphysial dysplasia congenita': 1, 'sedatives use': 1, 'Sedative use disorder[N': 1, 'Sedative Medication': 1, 'sedatives use disorder': 2, 'PSYCHO-SEDATIVE': 1, 'hypoplastic dens SED': 1, 'sedative abuse/': 1, 'Sedative-Hypnotic Medications': 1, 'SEDATIVE EFFECT OF': 1, 'SPDs': 1, 'SPD': 1, 'SeD septal defect': 1, 'SDT': 1, 'congenital-onset dysplasia': 1, 'sedative hypnotic disorder': 1, 'sedatives': 4, 'addiction to sedatives': 2, 'vascular SED': 1, 'cocaine, opioid, sedative': 1, 'SEDATIVE EFFECT ON': 1, 'SEDC type II collagenopathy': 1, 'colhounii similis sed macroconidiis cylindricis utrinque rotundatis': 1, 'Sedative comedicationa': 1, 'sedative or hypnotic dependence': 1, 'Dysplasia coxae congenita': 2, 'DSM-IV Sedative use disorders': 1, 'autosomal dominant SED congenita': 1, 'sedative-hypnotic': 1, 'Spondyloepiphyseal dysplasia (congenita, tarda)': 1, 'Sedative/hypnotic dependence': 1, 'Spondyloepiphyseal Dysplasia congenita': 1, 'spondyloepiphyseal dysplasia congenital syndrome': 1, 'Thrombo sed': 1, 'Spondyloepiphyseal Dysplasia Congenital': 1, 'Sedative Agent Choice': 1, 'Sedative medications abuse': 1, 'IDENTIFICATION OF SEDATIVES IN AQUEOUS SOLUTIONS': 1, 'Sedative-related disorder': 1, 'NMUSH': 1, 'Sedative problems': 1, 'Dysplasia spondyloepiphysealis congenita': 1, 'AS': 1, 'Sedative Substance': 1, 'Sedative Substance Involvement': 1, 'CLASSIC SEDATIVE': 1, 'Sed-MI': 1, 'Sed-': 1, 'DSM-5 sedative use disorder': 1, 'and sedative use': 1, 'opioid or sedative': 1, 'sedative misuse': 3, 'Hypnotic/sedative drug': 1, 'HYPNOTIC SEDATIVE DRUG': 1, 'Sedative, Hypnotic, and Anxiolytic Use Disorder': 1, 'Sedative, Hypnotic, or Anxiolytic Use Disorder': 1, 'DAILY INTERRUPTION OF SEDATIVES': 1, 'sedative abuse disorder': 1, 'amphetamine and sedative use disorders': 1, 'Sedative Hypnotic Prescriptions': 1, 'Spondoephisyseal Dysplasia Congenita': 1, 'RASS': 1, 'sedative-use disorders': 1, 'tranquilizer/ sedative use disorder': 1, 'tranquilizer/ sedative use': 1, 'SEDATIVE PREMEDICATION IN LAPAROSCOPY': 1, 'sed quia non audemus': 1, 'spondyloepiphyseal dysplasia congenita Spranger-Wiedemann': 1, 'SEDC-SW': 1, 'F-sed': 1, 'spondyloepiphyseal dysplasia congenita and tarda': 1, 'AASDs': 1, 'EFFECTS OF SEDATIVE': 1, 'spondylometepiphyseal dysplasia congenita': 1, 'Spondylometepiphyseal dysplasia congenita': 1, 'sedative abuse/dependence': 1, 'spondyloepiphyseal dysplasia with congenital joint': 1, 'ASDs': 1, 'sedative/hypnotic/': 1, 'PLANT SEDATIVES': 1, 'Sedative Hypnotic Medication': 1, 'Sedative and': 1, 'congenital hypoplasia or dysplasia': 1, 'SEDATIVES,': 1, 'sedative withdrawal': 1, 'ASW': 1, 'MGRSSI': 1, 'cardiac sedative': 1, 'SeD.': 1, 'SEDC disease': 1, 'SEDC bone': 1, 'sedative or hypnotic use disorders': 1, 'sedative/traquilizer use disorder': 1, 'Acces- sed': 1, 'SEDATIVE MISUSE MOTIVES': 1, 'cocaine, amphetamine, sedative, and other': 1, 'SED_POD': 1, 'SED_PAT': 1, 'SED_CLR': 1, 'DCC syndrome': 1, 'spondyloepiphyseal dysplasia congenital type': 1, 'sedative/hypnotic abuse': 1, 'achondrogenesis type II-spondyloepiphyseal dysplasias (SED) congenita': 1, 'SEDATIVE SOURCES': 1, 'SHE': 1, 'sed cellulis inflatis': 1, 'SPASMOLYTIC-SEDATIVE': 1, 'SEDC-mild': 1} | SED |
Disease | MESH:C535789 | {'Humerospinal dysostosis': 3, 'Chondrodysplasia with multiple dislocations': 2, 'omani': 8, 'Omani': 51, 'humero-ulnar incongruence': 3, 'humero-ulnar conflict': 2, 'skeletal-related': 10, 'FHC': 1, 'fistule humero-cephalique': 2, 'clavicula pro-humero suspension': 1, 'multiple dislocations': 26, 'humero-ulnar arthrodesis': 1, 'humero-unlar defects': 1, 'skeletal-related diseases': 18, 'collagen-related skeletal dysplasias': 1, 'skeletal related diseases': 4, 'skeletal-related injury': 2, 'Multiple dislocations': 1, 'humero-ulnar joint incongruence': 1, 'humero-ulnar dislocation': 2, 'OMR': 5, 'RMRP-related skeletal dysplasia': 1, 'MULTIPLE CONGENITAL DISLOCATIONS': 1, 'Multiple Congenital Dislocations': 1, 'Volar dislocation of multiple metacarpals': 1, 'dislocations of multiple metacarpals': 1, 'SED Omani type Ehlers-Danlos syndrome': 1, 'humero-spinal dysostosis': 13, 'Omani family disorder': 1, 'Omani frankincense': 1, 'pathologic humero-acromial joint': 1, 'Multiple metacarpal dislocations': 1, 'skeletal and skeletal-related diseases': 1, 'Multiple congenital dislocation': 1, 'non-skeletal-related diseases': 1, 'non-skeletal-related disorders': 1, 'Citizen Omani': 1, 'humero-ulnar instability': 2, 'skin-related or musculo-skeletal related ailments': 1, 'PAPSS2-related skeletal dysplasias': 1, 'humero-radialis internus': 1, 'humero-radialis lateralis': 1, 'humero-carpi ulnaris': 1, 'multiple dislocation': 5, 'Omani Families': 1, 'humero-ulnar dysplasia': 1, 'Humero-scapular periarthrosis': 1, 'Spondyloepiphyseal dysplasia Omani': 2, 'Multiple congenital dislocations': 2, 'clavicula pro humero': 3, 'CPH': 4, 'humero-peroneal': 2, 'SED Omani type': 2, 'Omani type': 2, 'skeletal related': 2, 'Multiple dislocations of the carpometacarpal': 1, 'SLC26A2-related dysplasia': 1, 'multiple carpometacarpal dislocations': 1, 'Multiple carpometacarpal dislocations': 1, 'skeletal-related ailments': 1, 'CI': 1, 'humerospinal dysostosis': 3, 'spondyloepiphyseal dysplasia Omani': 1, 'spondyloepiphyseal dysplasia Omani type': 6, 'skeletal related disease': 1, 'multiple dislocations in thumb': 1, 'SED with congenital joint dislocations': 1, 'SED Omani type,': 1, 'Omani Rial': 2, 'humero-humeral': 1, 'humero-anconeal incongruency': 1, 'humero-anconeal incongruity': 2, 'Omani Rials': 2, 'skeletal-related disease': 7, '-humero-peroneal muscles': 1, 'Humero-anconeal incongruity': 1, 'Humero-': 2, 'humero-': 2, 'HA lesion': 1, 'humero-anconeal lesion': 1, 'humero-ulnar incongruency': 1, 'multiple exostotic chondrodysplasia': 2, 'congenital multiple dislocations': 1, 'skeletal dysplasias and related diseases': 1, 'BE-related dysplasia': 1, 'chrondrodysplasia with multiple dislocations': 1, 'multiple fingers dislocation': 1, 'skeletal-related lesion': 1, 'Syndrome of humero-scapular pseudoperiarthrosis': 1, 'Skeletal-related defects': 1, 'humero-ulnar incongruity': 2, 'X-linked humero-peroneal muscular dystrophy': 1, 'humero-ulnaire': 1, 'related dysplasia': 1, 'COL21A-related dysplasias': 1, 'COL2A1-related dysplasia': 2, 'COL2A1-related Dysplasia': 1, 'Spondyloepiphyseal dysplasia Omani type': 1, 'multiple dislocations Humerospinal dysostosisLarsen syndrome': 1, 'chondrodysplasia with multiple dislocations': 4, 'multiple congenital dislocations': 2, 'Humero-spinal dysostosis': 3, 'humero-ulnar impingement': 1, 'spondyloepiphyseal dysplasia (SED) Omani type': 2, 'humero-peroneal predominant skeletal myopathy': 1, 'humero-peroneal preponderance': 1, 'Congenital multiple dislocations': 1, 'zanniyan omani': 1, 'HM': 2, 'SED-Omani type': 1, 'humero-metacarpal': 1, 'arab omani': 1, 'Omani PH1': 1, 'Omani-type spondyloepiphyseal dysplasia': 2, 'SED Omani': 1, 'humero-scapular periarthropathy': 2, 'skeletal dysplasia-related disease': 1, 'humero': 1, 'OMANIS': 1, 'multiple-ligament injured (dislocated': 1, 'humero-scapular peri-arthropathy': 1, 'Omani rial': 1, 'Humero-Spinal Dysostosis': 1, 'Humero-ulnar incongruence': 1, 'Humero-ulnar incongruency': 1, 'SLC26A2-related dysplasias': 1, 'atrophy of face and humero-scapular girdles': 1, 'fractura de humero': 1, 'Clavicula pro humero': 1, 'humero-scapular paralysis': 1, 'multiple dislocations of the large': 1, 'Periarthropathia humero scapularis': 1, 'PHS': 1, 'humero-scapular periarthroses': 1, 'humero-ulnar epiphysis': 1, 'periarthropathia humero-scapularis': 1, 'skeletal developmental-related disease': 1, 'multilineage-related dysplasia': 1, 'periarthrosis humero-scapularis': 1, 'humero-ulnar rotation': 1, 'axial humero-ulnar rotation': 1, 'OAP': 1, 'chondrodysplasia with multiple dislocation': 1, 'multiple finger dislocations': 1, 'OMANI WOMEN': 1, 'OMANI CHILDREN': 1, '-humero-': 1, 'carbohydrate sulfotransferase 3-related skeletal dysplasia': 1, 'Chondrodysplasias With Multiple Dislocations': 1, 'Chondrodysplasias with multiple dislocations': 1, 'chondrodysplasias with multiple dislocations': 1, 'CMD': 1, 'Omani Type': 1} | Omani |
Disease | MESH:C535791 | {'short or bowed forearms': 1, 'bowing of the forearm': 5, 'forearm bowing': 6, 'bowing of forearm and tibia': 1, 'radial bowing of the forearm': 2, 'bowing of forearm': 2, 'bowed forearms': 1, 'plastic bowing of the forearm': 2, 'bowing) of the forearm and/': 1, 'short or bowed forearm': 1, 'radial bowing of the forearms': 1, 'Plastic bowing of the forearm': 1, 'bowing deformities of the forearms': 1, 'Bowing of forearms': 1} | forearm bowing |
Disease | MESH:C535792 | {'odontochondrodysplasia': 26, 'dentinogenesis dysplasia': 2, 'ODCD': 12, 'Odontochondrodysplasia': 8, 'spondylometaphyseal dysplasia with dentinogenesis imperfecta': 1, 'odontochondrodysplasia cases 3, 6, and 10': 1, 'Odontochondrodysplasia-associated': 1, 'Odontochondrodysplasia Skeletal dysplasia': 1} | odontochondrodysplasia |
Disease | MESH:C535793 | {'posterolateral corner injuries': 100, 'PLC': 168, 'and posterolateral corner': 3, 'posterolateral corner': 14, 'corner fractures': 41, 'corner stone': 58, 'to the PLC': 3, 'injury to the posterior lateral corner': 1, 'Corner': 132, 'posterolateral corner-injured': 1, 'posteromedial corner injury': 8, 'PLC injuries': 137, 'posterolateral corner injury': 122, 'CORNER': 14, 'Cutting Corners': 6, 'Posterolateral corner injuries': 13, 'corner injury': 10, 'PLC lesions': 12, 'Corner stones': 3, 'VC': 3, 'mood cornered problems': 1, 'postero-lateral corner ligament deficiency': 1, 'metaphyseal corner fracture': 7, 'Cornering color SU(5': 1, 'Ficus tinctoria Corner': 1, 'PLC disruption': 1, 'PLC injury': 102, 'Corner recognition': 1, 'PLC instability': 12, 'rotational PLC instability': 1, 'PLC structures injury': 1, 'Posterolateral corner injury': 12, 'Clinical Corner': 1, 'corner': 38, "Carleton's Corner": 1, 'Quiz Corner - A': 1, 'corner stones': 10, 'corner vascularisation': 1, 'Corner vascularisation': 1, 'postero-lateral corner (PLC) tears': 1, 'LCL/PLC injuries': 2, 'arenaria Corner': 1, 'Corner and var': 1, 'Posterolateral Corner Injury': 7, 'TMC Corner': 3, 'Spondylo-metaphyseal dysplasia corner fracture': 1, 'spondylo-metaphyseal dysplasia Sutcliffe type': 1, 'spondylo-metaphyseal dysplasia corner fracture': 1, 'Spondylo-metaphyseal dysplasia Sutcliffe type': 1, 'Corner fractures': 4, 'Endplate corner fractures': 1, 'injuries to the posterolateral corner': 2, 'Injuries of the PLC': 2, 'Corner Instability': 1, 'posterolateral corner (PLC) injuries': 26, 'posterolateral corner deficiency': 8, 'Posterolateral corner (PLC) injuries': 11, 'Fanelli Type B posterolateral corner injuries': 1, 'Harris Corner': 2, 'posterolateral corner (PLC) injury': 24, 'Corner cutters': 1, 'medial collateral ligament, posterolateral corner': 1, 'AD': 1, 'SMD-CF': 3, 'SMD-corner fracture': 1, 'SMD with corner fractures': 2, 'MCL-PMC complex injury': 1, 'MCL-PMC': 1, 'inferior corner fracture': 1, 'posteromedial corner (PMC) injury': 2, 'PLC tears': 8, "'s PLC": 1, 'injury to the PLC': 12, 'Injuries to the posterolateral corner': 12, 'corner tears': 2, 'spondylometaphyseal dysplasia Sutcliffe type': 1, 'corner fracture': 26, 'Spondylometaphyseal dysplasia Sutcliffe': 2, 'Corner fracture': 3, 'Spondylometaphyseal dysplasia Sutcliffe type': 1, 'Moss Corner': 1, '-Friendly Corner': 1, 'Friendly Corner': 3, 'Postero-Lateral Corner (PLC) injuries': 1, 'postero-lateral corner injuries': 1, 'CCML': 4, 'Corner Fractures': 2, 'Corner Injuries': 1, 'PLC Injury': 1, 'Corner Injury': 1, 'CA': 1, 'PMC tear': 1, 'PMC injury': 6, 'metaphyseal corner fractures': 6, 'Four Corners epidemic': 1, "Sutcliffe's metaphysial dysostosis": 1, '2CF or 3CF': 1, 'CORNER BOX': 1, 'CC': 7, 'Corner mold': 1, 'corner mold': 1, 'Corners': 18, 'corners': 1, 'Thelephorales Corner': 1, 'NBCC': 2, 'corner preference': 1, 'Corner preference': 1, 'CL': 1, 'posteromedial corner injuries': 7, 'PFL PLC': 1, 'Friend in the Corner': 1, 'Injuries to the PLC': 9, 'Four Corners disease': 3, 'inflammatory corner lesions': 2, 'Posterolateral corner instability': 1, 'ulnar corner fractures': 1, 'ORTCs': 1, 'corner-cutting': 1, 'Corner Boundary Condition': 1, 'posterior lateral corner injury': 3, 'Sutcliffe': 3, 'or corner fractures': 1, 'posterolateral corner (PLC)': 1, 'corner injuries': 9, 'Corner var': 1, 'posterolateral corner injuryCompared': 1, 'Corner lesions': 2, 'posterolateral corner injured': 1, 'PC': 1, 'Comfort Corner': 1, 'CORNER FOR': 1, 'CT': 1, 'PMC': 13, 'Corner injuries4': 1, 'corner damage': 1, 'Corner Sign': 1, 'Posterolateral corner (PLC) instability': 1, 'PLC tear': 10, 'PLC-injured': 1, 'CI': 1, 'posterolateral/posteromedial corner injuries': 1, 'PMC injuries': 11, 'FCHD': 1, 'PMC injured': 1, 'posterior medial corner (PMC) injuries': 1, 'Posterolateral corner': 6, 'Corner - Friend': 1, 'Posterolateral corner loss': 1, 'injuries to the PLC': 8, 'ligamentous disruption to the PLC': 1, 'Injury to the posterolateral corner': 6, 'Corners of the': 1, 'drooping of the corners': 1, 'Posterolateral Corner': 9, 'CAQ Corner': 4, 'Cornelian Corner': 2, 'A posterolateral corner injury': 1, 'Posterior Lateral Corner': 1, 'posterior lateral corner ligamentous complex': 1, 'posterior lateral corner complex': 1, 'trengganuensis Corner': 1, 'instabilities of the posterolateral corner': 1, 'injury of postero-lateral corner': 1, 'PLC of': 1, 'vertebral corner lesion': 2, 'vertebral corner lesions': 4, 'to the posteromedial corner': 1, 'Corner spalling': 1, 'Posterolateral and Posteromedial Corner Injuries': 2, 'corner-stones': 3, 'posterolateral corner complex injury': 1, 'Posterolateral Corner (': 1, 'Posterolateral Corner) injuries': 1, 'PLC) injuries': 1, 'posterolateral corner depression': 1, 'PLC complex injury': 1, 'bicruciate and PLC injuries': 1, 'drooping of the corner': 1, 'FC': 1, 'NSE': 2, 'oral corner deformity': 1, 'posterolateral/posteromedial [PM] corner injuries': 1, 'Isolated posterolateral corner (PLC) tears': 1, 'PLC-': 4, 'triangular corner fractures': 1, 'Injury to the PLC': 8, 'One-Corner Problems': 1, 'Lateral collateral or posterolateral corner injury': 1, 'cutting corners': 1, 'posterolateral corner injuryLoss': 1, 'corner-stone': 2, 'Unclear Corner': 1, 'HCCR': 1, 'posterolateral corner-deficient': 1, 'Cage Corner': 1, "Auntie's Corner": 1, 'LCL/PLC injury': 2, 'LCL and PLC injury': 1, 'VCFD': 3, 'Corner Convenience': 1, 'DCC': 1, 'injury of the posterolateral corner': 1, 'scapular corner': 1, 'injury to the posterolateral corner': 3, 'Deflexula major Corner': 1, 'Deflexula Corner': 1, 'posterolateral corner) injury': 1, 'Corner Fracture': 3, 'PLC and LCL injuries': 1, 'III posterolateral corner (PLC) injuries': 1, 'injuries of the PMC': 1, 'PLC-deficient': 13, 'Fracture of a Corner of a': 1, 'Corner leak': 1, 'PSCL': 2, 'posterior shiny-corner lesion': 2, 'Posterior shiny-corner lesion': 1, 'PCL/posterolateral corner (PLC)-deficient': 2, 'posterolateral corner (PLC) deficiency': 2, 'glenoid corner fracture': 1, 'PLC deficiency': 11, 'PLC structure injuries': 1, 'deficiency of PLC': 1, 'PLC deficient': 2, 'PLC structure deficiency': 1, 'Deficiency of the PLC': 2, 'spondylometaphyseal dysplasia with "corner fractures"': 1, 'FCPs': 1, 'CORN': 1, 'type B CILs': 1, 'CIL': 9, 'type B CIL': 2, 'posterior vertebral corner abnormalities': 1, 'CILs': 7, 'type A CILs': 3, 'type A CIL': 1, 'Type B CILs': 1, "Vertebral 'corner' defect": 1, 'corner depression': 2, 'injuries to the posterior lateral corner': 1, 'PL corner injury': 2, 'posterolateral corner (PLC) tears': 1, 'DHC': 1, 'DHC swelling': 1, 'Hales Corners': 1, 'Cochrane Corner': 3, 'Injuries of the posterolateral corner': 5, 'Romanus corner lesions': 1, 'Palmar ulnar corner fractures': 1, 'posterolateral corner (': 3, 'PLC) injury': 4, "Sutcliffe's disease": 1, 'HCD': 1, 'PMC instability': 1, 'Posteromedial corner injury': 1, 'PMC tears': 1, 'injury to the PMC': 1, 'Corners Illness': 1, 'complete posterolateral corner (PLC) tear': 1, 'FC viruses': 1, 'SMD-corner fracture type': 1, 'metaphyseal corner fractures of the': 1, 'corner lesions': 4, 'Postero Lateral Corner': 1, 'MCL or posteromedial corner (PMC) injuries': 1, 'Type 1 and 2 PLC': 1, 'of the PLC': 6, 'PLCR': 2, 'myoclonic corner jumping': 1, 'myoclonic corner': 1, 'PLC Injuries': 2, 'corner instability': 1, 'tears of posterolateral corner': 1, 'injuries of the PLC': 5, 'vertebral corner defect': 2, 'Corners States': 1, 'PLC lesion': 7, 'Corner Pooling': 1, 'BTCH': 1, 'Corner Puller': 1, 'Corner problem': 1, 'Corner Radius': 1, 'Corner Store': 11, 'Cornering Higgsinos': 1, 'Distal metaphyseal corner-type fracture': 1, 'PLC reconstruction': 1, '4CF': 1, 'injury PLC': 2, 'posterolateral corner injuries of': 1, '-lateral corner lesions': 1, 'Postero-lateral corner lesions': 1, '-corner lesions': 1, 'Posterolateral Corner Injuries': 7, 'posterior lateral corner (PLC) injuries': 1, 'corner inflammatory lesion': 1, 'Corner inflammatory lesion': 1, 'Cornered': 3, 'posteromedial corner (PMC) injuries': 1, 'NCD Corner': 1, 'Corner Compromise': 2, 'NS': 5, 'injuries to the PMC': 3, 'Injuries to the PMC': 2, 'spondylometaphyseal dysplasia-corner fracture type': 1, 'Posterior Shiny-Corner Lesion': 1, 'posterolateral corner ligament injuries': 1, 'Cutting Edge Corner': 1, 'NM Care Corner': 1, 'Corner stitch': 1, 'corner deficiency': 1, 'anterior inferior corner fractures': 1, 'posterolateral corner injury of the': 1, 'PLC abnormalities': 1, 'Bilateral medial corner fractures': 1, 'Metaphyseal corner fracture': 2, 'Metaphyseal corner fractures': 4, 'spondylometaphyseal dysplasia corner fracture': 1, 'CNSI': 1, 'spondylometaphyseal dysplasia, corner fracture type': 1, 'SMDCF': 1, 'Downturned corners of the': 1, 'HC': 2, 'posterolateral corner instability': 3, 'corner store': 3, 'posteromedial and posterolateral corner injuries': 2, 'Posteromedial/posterolateral corner injuries': 1, 'Pooh Corner': 1, 'Shaft Corner': 1, 'MCL and PMC injuries': 1, 'osteoligamentous posterolateral corner injury': 1, 'the PLC': 1, 'injury of PLC': 1, 'fatty corner': 1, 'Cornering': 2, 'C-C': 1, 'frontal or corner fracture': 1, 'injury to the posterior lateral corner (PLC)': 1, 'Corner Stores': 3, 'posterolateral corner fracture': 1, 'Corner stone of': 1, 'Aligner Corner': 1, 'Spondylometaphyseal Dysplasia Corner Fracture': 1, 'Spondylometaphyseal dysplasia corner fracture': 1, 'Eye Corners': 1, 'LCL and PLC injuries': 1, 'damage to the PLC': 1, 'corner pseudo-fractures': 1, 'PLC) of': 3, 'Sutcliffe type spondylometaphyseal dysplasia': 1, 'Posterolateral corner deficiency': 1, 'Corner-Sign': 1, 'Corner mesochaetae': 1, 'Sunny Corner': 1, 'Connection Corners': 1, 'III posterolateral corner injury': 1, 'multiligament and posterolateral corner (PLC) injuries': 1, 'posterolateral corner tear': 1, 'Posterolateral corner (PLC) lesions': 1, 'Posterolateral corner (PLC) injury': 2, 'Corner-stones': 1, 'vertebral corner inflammatory lesions': 4, 'Dorso-ulnar cortical corner fracture of': 1, 'four-corner syndrome': 1, ') posterolateral corner (PLC) injuries': 1, 'Corner Vowels': 1, 'Decorative Corner': 1, 'inflammatory vertebral corner lesions': 2, 'Four Corners': 1, 'Volar ulnar corner fractures': 1, 'Volar Ulnar Corner fractures': 1, 'Four corners disease': 1, 'PLC ligamentous injuries': 1, 'posterior-lateral corner (PLC) injury': 1, 'ORCs': 1, 'CR': 1, 'posterior lateral corner injuries': 1, 'spondylometaphyseal dysplasia - corner fracture type': 1, 'posterolateral corner (PLC) instability': 1, 'PLC/': 1, 'Corner damage': 1, 'downturned corners of the': 1, 'vertebral body corner lesions': 2, 'PLC avulsion type injuries': 1, 'PLC avulsion-type injuries': 1, "Kevin's Corner": 1, 'damage to the posterolateral corner': 1, 'B CILs': 2, 'DTC': 1, 'SEC': 1, 'posteromedial or posterolateral corner injuries': 1, 'Danger Corner': 1, "Children's Corner": 1, 'corner inflammatory lesions': 3, 'Corner-Move lures': 1, 'CP': 2, 'Corner Rhombus Shape LBP': 1, 'CRSLBP': 1, 'SMD corner fracture type': 1, 'corner fracture-like lesions': 1, "SMD 'Sutcliffe' type": 1, 'SMD corner fracture': 1, 'Corner fracture type spondylometaphyseal dysplasia': 1, 'posteromedial/posterolateral corner injuries': 1, 'Metaphyseal Corner Fracture': 1, 'Perforatae Corner': 1, 'Ficus delosyce Corner': 1, 'Corner ser': 1, 'Orthoneurae Corner': 1, 'Ficus subgelderi Corner': 1, 'dasycarpa Corner': 1, 'Ficus patellata Corner': 1, 'vertebral body corner fracture': 1, 'the PLC of the': 1, 'Posterolateral Corner Injured': 1, 'Corners disease': 1, 'corner loss': 1, 'PLC loss': 1, 'Corner Loss': 2, 'Posteromedial Corner': 2, 'ptosis of the corner': 1, 'deficit in SOR': 1, 'vertebral corner abnormalities': 1, 'FCA': 3, 'posterolateral corner lesion': 1, 'injury to the PLC of': 1, 'the posterolateral corner': 1, 'PLC,': 1, 'or posterolateral corner (PLC) injuries': 1, 'FCA nonunion': 1, 'Indoor Corners': 1, 'Posterolateral Corner (PLC) Injury': 1, 'Injury to the posterolateral corner (PLC) of the knee': 1, 'lateral collateral ligament or posterolateral corner injuries': 1, 'Corner and noncorner lesions': 1, 'injuries to the LCL and PLC': 1, 'Posterolateral corner (PLC) injuries of the knee': 3, 'Posterolateral Corner (PLC) injuries': 1, 'Unexplored Corner': 1, 'CS': 2, 'posterolateral corner syndrome': 1, 'NASH': 1, 'ECS': 1, 'CCR': 1, 'Corner defect': 1, 'PLC injures': 1, "Tally's Corner": 1, 'VCs': 1, 'VCs - 2 Syndesmophytes': 1, 'vertebral corpus corner degeneration': 1, 'Moncks Corner': 1, 'left Corner': 1, 'MR corner': 1, 'Corner stone': 4, "Poet's Corner": 1, 'Damage to the PLC': 1, 'corner kick': 1, 'Corner kick': 1, 'AYFC': 1, '-Corner Indentation Fracture': 1, 'Cube-Corner Indentation Fracture': 1, 'CCIF': 1, 'Midsubstance PLC tears': 1, 'Downturned corners of moutha': 1, 'sco': 1, 'corner defect': 2, 'B PLC injuries': 1, 'injuries to PLC': 1, 'type C PLC injuries': 1, 'PLC instabilities': 1, 'Corner Inflammatory Lesion': 1, 'SC': 1, 'Corner of the': 2, 'corner of the': 1, 'PMC.We': 1, 'posterolateral corner (PLC) damages': 1, 'fissured corners': 1, 'posterior lateral corner instability': 1, 'autosomal dominant spondylometaphyseal dysplasia Sutcliff type': 1, 'spondylometaphyseal dysplasia Sutcliff type FN1': 1, 'Posterolateral Corner Instability': 1, 'DUC': 1, 'Cornering stiffness': 1, 'PCS': 1, 'type B and type C PLC injuries': 1, 'Falling Corner Reflector': 1, 'AUTHORS CORNER': 1, 'vertebral corner': 1, 'injuries of the PMC of': 1, 'PMC Injury': 1, 'and PMC injuries': 1, 'of the PMC': 1, 'Corner accumulation': 1, 'ligamentous/posterolateral corner injuries': 1, 'corner lesion': 1, 'non-corner inflammatory lesions': 1, 'NIL': 1, 'Vertebral corner lesion': 1, 'posterior medial corner injuries': 1, 'eye-corner wrinkles': 1, 'of the posterolateral corner': 1, 'MAC': 1, "Four Corner's Disease": 1, 'PLC and': 1, 'NSCE': 1, 'injuries of the posterolateral corner': 1, 'PLCnr deficiency': 1, 'PLCnr injury': 1, 'lateral or posterolateral corner injury': 1, 'PLCnr': 1, 'PLCnr injuries': 1, 'roseus Corner': 1, 'Vertebral corner defect': 1, 'vertebral corner defects': 1, 'Corner shower': 1, 'Corner necrosis': 1, 'PCPL': 1, 'disruptions of posterolateral corner': 1, 'C/C': 1, 'Corner bulge': 1, 'medial/posteromedial corner injuries': 1, 'Posteromedial Corner Injuries of the': 1, 'lateral collateral ligament and posterolateral corner injuries': 1, 'medial collateral ligament and posteromedial corner (PMC) injuries': 1, 'Distal posterolateral corner injury': 1, 'STATISTIC CORNER 3': 1, 'Corner inflammatory lesions': 1, 'PLC deficiencies': 2, 'of posterolateral corner (PLC) injuries': 1, 'posterior-lateral corner (PLC) damage': 1, 'PLC damage': 1, 'vertebral corner sclerosis': 1, 'posterolateral or posteromedial corner injuries': 1, 'A CIL': 1, 'ulnar corner fracture': 1, 'Ulnar Corner': 1, 'ulnar corner': 1, 'FCF': 1, 'injury of the PLC': 1, 'HCCRs': 1, 'or posterolateral corner': 1, 'posterolateral corner (PLC) tear': 1, 'Corner point': 1, 'TYR-CORNER': 1, 'varus or posterolateral corner lesion': 1, 'corner ligamentous complex': 1, '-corner': 1, 'Corner Inflammatory Lesions': 1, 'Vertebral body corner': 1, 'corner inflammationc': 1, 'corner defects': 1} | PLC |
Disease | MESH:C535794 | {'algerian children': 1, 'AWMV': 1, 'DEVELOPMENT OF ALGERIAN MOSLEMS': 1, 'ALGERIAN': 4, 'AN ALGERIAN HOSPITAL MILIEU': 1, 'THE ALGERIAN REGION': 1, 'ALGERIAN DIABETIC PEOPLE ATTITUDE DURING RAMADAN': 1, 'ALGERIAN HABITS': 1, 'AD': 2, 'AN ALGERIAN MILIEU': 1, 'AL.II.1': 1, 'AL': 1, 'AA-FR': 1, 'AAL': 1, 'Spondylometaphyseal Dysplasia Algerian Type': 1, 'Spondylometaphyseal dysplasia Algerian type': 1, 'SMD-A': 1, 'SMD-A.': 1, 'ALGERIAN WAR': 1, 'algerian': 3, 'THE SERUM OF ALGERIAN MOSLEMS': 1, 'algerian allergic': 1, 'GALV-Nf': 1, 'CHARACTERIZATION OF AN ALGERIAN POPULATION': 1, 'AF': 1, 'AN ALGERIAN HOSPITAL': 1, 'algerian moslems': 1} | ALGERIAN |
Disease | MESH:C535795 | {'axial spondylometaphyseal dysplasia': 15, 'Axial FD': 1, 'axial SMD': 12, 'Axial spondylometaphyseal dysplasia': 10, 'Axial SMD': 3, 'axial spondylometaphyseal dysplasias': 1, 'SMD axial': 1, 'axial skeletal dysplasia': 2, 'AXSMD': 1, 'Axial Spondylometaphyseal Dysplasia': 3, 'axial spondylometaphyseal dyplasia': 1, 'axial dysplasia': 2, 'axial SMD with retinal degeneration': 1, 'axial spondylometaphyseal dysplasia70Involved': 1, 'axial and peripheral skeletal dysplasia': 1} | axial spondylometaphyseal dysplasia |
Disease | MESH:C535796 | {'EAC': 71, 'EAI': 51, 'EAI-Manila': 1, 'EANMAT': 4, 'EACMV-UG': 4, 'EA': 8, 'SPCSV-EA': 1, 'EACMV': 12, 'African HIV-1C': 1, 'East African': 1, 'OHCEA': 1, 'EACMV-UG 3': 1, 'EAH': 3, 'EACMV-UG2': 1, 'EACMCV': 4, 'EAI3': 1, 'NON-EAI': 1, 'East African Rift': 2, 'EAHB': 7, 'EA-IeDEA': 1, 'SEARCH': 1, 'EAI-IND': 1, 'East African trypanosomosis': 1, 'EARS': 1, 'East African Sleeping': 1, 'East African/Indian infection': 1, 'EAC MRH': 1, 'SEA': 4, 'East African disease': 3, 'East African zebu': 1, 'EAZ': 1, 'EAAI': 1, 'ESA': 1, 'EAC coliform': 1, 'East African (rhodesiense) disease': 1, 'tH': 1, 'ECSA': 4, 'East-African': 1, 'EAL': 1, 'ECSA-V': 1, 'EAI cluster 5': 1, 'EAA': 1, 'EACC': 4, 'EACMV infection': 1, 'EAI-5': 2, 'EACO': 1, 'East African trypanosomiasisAngiostrongyliasisRabies': 1, 'ECSA-IOL': 1, 'East African Diarrhea': 1, 'EAD': 1, 'EACMV infections': 1, 'EAI-infected': 1, 'EATI': 1, 'EACMMV': 1, 'EA & C': 1, 'EA strain m2-47': 1, 'EAH AAA': 1, 'EAI-MYS': 1, 'EAI-SOM': 1, 'EAI and': 1, 'EAC-MRH': 1, 'EAR': 1, 'EACMV - UG': 1} | EAC |
Disease | MESH:C535797 | {'SMDK': 21, 'Spondylometaphyseal dysplasia type Kozlowski': 1, 'spondylometaphyseal dysplasia Kozlowski type': 15, 'Spondylometaphyseal Dysplasia-Kozlowski Type': 1, 'spondylometaphyseal dysplasia-Kozlowski type': 4, 'Spondylometaphyseal Dysplasia Kozlowski': 1, 'SMD) Kozlowski type': 1, 'SMD-K': 2, 'spondylometaphyseal dysplasia Kozlowski': 4, 'Kozlowski type spondylometaphyseal dysplasia': 1, 'SMD-Kozlowski': 1, 'SMD-Kozlowski type': 1, 'spondylometaphyseal dysplasia, Kozlowski type': 1, 'Spondylometaphyseal dysplasia Kozlowski type': 1, 'Kozlowski-type spondylometaphyseal dysplasia': 2, 'SMD Kozlowski type': 1, 'Spondylometaphyseal dysplasias Kozlowski type': 1, 'Kozlowski spondylometaphyseal dysplasia': 1, 'Spondylometaphyseal dysplasia Kozlowski': 1, 'Kozlowski-type SMD': 1, 'Spondylometaphyseal Dysplasia, Kozlowski (SMDK) disease': 1, "Kozlowski's spondylometaphyseal dysplasia": 1} | SMDK |
Disease | MESH:C535798 | {'SMDS': 13, 'lethal dysplasias': 3, 'SSDM': 1, 'SSMD': 14, 'Sedaghatian type spondylometaphyseal dysplasia': 1, 'Sedaghatian-type spondylometaphyseal dysplasia': 15, 'Sedaghatian-type spinal metaphyseal dysplasia': 1, 'Sedaghatian type Spondylometaphyseal Dysplasia': 1, 'SSMD disease': 2, 'Sedaghatian disease': 2, 'Sedaghatian spondylometaphyseal dysplasia': 3, 'Spondylometaphyseal dysplasia Sedaghatian type': 1, 'Lethal Dysplasias': 1, 'Sedaghatian': 1, 'Sedaghatian-type Spondylometaphyseal Dysplasia': 5, 'SSMD-like symptoms': 1, 'Sedaghatian-': 1, 'Sedaghatian-type spondylometaphyseal dysplasia (': 1, 'SSMD) 2': 1, 'sedaghatian-type spondylometaphyseal dysplasia': 1, 'lethal metaphyseal chondrodysplasia': 1, 'Sedaghatian syndrome': 1, 'Moerman lethal dysplasia': 1, 'Sedaghatian-type spondylometaphyseal chondrodysplasia': 1, 'ADEs': 1, 'lethal dysplasia': 4, 'SMDS-12': 1, 'Sedaghatian type': 1, 'Congenital lethal chondrodysplasia': 1, 'congenital lethal chondrodysplasia': 1, 'Sedaghatian -type Spondylometaphyseal Dysplasia': 1, 'Sedaghatian-typespondylometaphyseal dysplasia': 1, 'Lethal Tissue Dysplasias': 1, 'lethal tissue dysplasias': 1, 'Congenital lethal metaphyseal chondrodysplasia': 1, 'spondylometaphyseal dysplasia Sedaghatian type': 1, 'spondylometaphyseal dysplasia Sedaghatian': 1} | Sedaghatian-type spondylometaphyseal dysplasia |
Disease | MESH:C535799 | {'Familial venous dysplasia': 1, 'SPD-OMIM 156550': 1, 'SPD-Torrance': 1, 'SPD': 5, 'spondyloperipheral dysplasia': 30, 'Spondyloperipheral dysplasia': 14, 'familial Mondini dysplasia': 1, 'familial muscular dysplasia': 1, 'familial amelodentinal dysplasia': 3, 'SPPD': 4, 'Familial frontal dysplasia': 1, 'Spondyloperipheral dysplasia Stickler syndrome': 1, 'Familial epiphysial dysplasia': 1, 'Spondyloperipheral dysplasia with short ulna': 1, 'familial dysplasia': 1, 'Familial amelodentinal dysplasia': 1, 'familial spondyloepi(meta)physeal dysplasia': 1, 'type Spondyloperipheral dysplasia Stickler syndrome': 1, 'familial polyepiphyseal dysplasia': 1, 'Familial spondyloepiphyseal dysplasia tarda': 1, 'SPPD spondyloperipheral dysplasia': 1, 'Familial Polyvalvular Dysplasia': 1, 'familial spondyloepiphyseal dysplasia tarda': 1, 'Spondyloperipheral Dysplasia': 1, 'spondyloperipheral dysplasia congenita': 1, 'Familial Mondini dysplasia': 1, 'familial venous dysplasia': 1, 'spondyloperipheral skeletal dysplasia': 1} | spondyloperipheral dysplasia |
Disease | MESH:C535800 | {'prion dementias': 11, 'type 1 or type 2 prions': 1, 'prion-based dementia': 2, 'Dementia and prions': 1, "'prion' dementias": 3, 'type 1 or type 2 human prions': 1, 'Prion dementia': 5, 'prion-linked dementia': 1, 'prion RPD': 1, 'Prion dementias': 2, 'non-prion sporadic rapid-progressive neurodegenerative dementia': 1, 'prion-associated dementia': 1, 'Long-standing prion dementia': 1, 'non-prion dementias': 1, 'inherited prion dementia': 4, 'vascular or prion dementia': 2, 'prion dementia': 7, 'npRPD': 2, 'vascular or prion associated dementia': 1, 'atypical prion dementia': 1, 'non-prion rapidly progressive dementia': 2, 'np-RPD': 1, 'non-prion RPD': 1, 'PD': 1, 'Dementias by prions': 1, 'prion" dementias': 1, 'Prion protein Dementia': 1, 'type 1 and type 2 prions': 1, 'non-prion dementia.3': 1, 'non-prion dementia': 1, 'Prion Dementia': 1, 'Prion diseases in dementia': 1, 'prion disease dementias': 1, 'Prion disease dementias': 1} | prion dementias |
Disease | MESH:C535801 | {'dyscephaly': 29, 'Kozlowski-Maroteaux-Spranger': 1, 'dyscephaly with': 1, 'DYSCEPHALY': 1, 'Spranger type II': 2, 'Dyscephaly': 8, 'SPRANGER FOR MODERN HUMANITIES': 1, 'Oculomandibular dyscephaly': 1, 'Spranger': 1, 'Cerebroarthrodigital syndrome': 1, 'spranger': 1} | dyscephaly |
Disease | MESH:C535802 | {'Fractures of the scapula': 59, 'Winged Scapula': 9, 'winged scapula': 187, 'maladie': 432, 'humerus, scapula': 1, 'chondromyxoid fibroma of the scapula': 3, "Sprengel's deformity": 163, 'scapula dyskinesis': 29, 'maladie coeliaque': 23, 'MC': 11, 'maladie coronarienne': 11, 'scapulae winging': 2, 'scapulae': 44, 'injury of the scapula': 3, 'fractured scapula': 14, 'fracture of the scapula': 68, 'scapula dyskinesia': 24, 'Postural abnormalities of the scapula': 1, 'Scapula dyskinesis': 5, 'scapula fractures': 176, 'scapula fracture': 214, 'neuropsychiatric maladies': 12, 'oral maladies': 16, 'scapula': 319, 'of the scapula': 48, 'maladie des tics': 16, 'snapping scapula syndrome': 63, 'impingement of the scapula': 2, 'maladies cardiovasculaires': 23, 'maladie psychique': 2, 'maladie pulmonaire': 24, 'Lacunar defects of the scapula': 1, '-maladies': 1, 'maladies-infectieuses': 5, 'snapping of the scapula': 10, 'Snapping scapula syndrome': 26, 'hypoplastic scapula': 21, 'hypoplastic scapulae': 52, 'hypoplasia of the scapula': 6, 'bony abnormalities in the scapula and acromion': 1, "SURGICAL TREATMENT OF SPRENGEL'S DISEASE": 3, 'Scapula': 138, 'scapula alata': 41, 'WS': 5, 'CDC': 1, 'maladies infectieuses nord-americain': 1, 'upward displacement of the scapula': 1, 'scapula/clavicle fractures': 1, 'downward rotation of the scapulae': 1, 'fractures of the scapula': 64, 'the scapula': 31, "Sprengel's shoulder": 16, 'neurodevelopmental malady': 3, 'maladies benignes': 1, 'maladies': 150, 'winging of the scapula': 28, 'sprengel deformity': 20, 'infection of the scapula': 2, 'deformities of the ribs, fibula, and scapula': 1, 'maladie bleue': 4, 'maladie arterielle': 5, 'Sprengel deformity': 172, 'maladie post-operatoire': 2, 'Zen malady': 1, 'fracture of the spine and scapula': 1, 'unstable scapula': 3, 'maladie cardiovasculaire': 10, 'Winged scapula': 53, 'asymmetrical winged scapula': 1, 'orthopaedic maladies': 3, 'maladi moun fou': 1, 'maladi peyi': 2, 'maladi bay': 1, 'Tropical malady': 1, 'maladie trophoblastique gestationnelle': 1, 'maladies trophoblastiques gestationnelles': 1, 'maladies trophoblastiques': 2, 'scapula and spine': 1, 'Metastatic disease of the scapula': 1, 'carcinoma of the scapula and spine': 1, 'avulsion injury of the scapula': 1, 'SICK scapula syndrome': 17, 'maladie de Carre': 2, 'Maladies de la paroi arterielle': 1, "Mortimer's malady": 3, 'Congenital elevation of the scapula': 22, 'scapula alata or': 1, 'injuries to scapula': 1, 'bilateral mild winged scapula': 1, 'HHF': 1, 'hypocalciurique familiale': 2, "L'hypercalcemie hypocalciurique familiale": 1, 'maladie benigne': 3, 'hypercalcemie hypocalciurique familiale': 1, 'instability about the scapula': 1, 'maladies nouvelles': 4, 'snapping scapula': 64, 'crepitus of scapula': 4, 'physical and emotional maladies': 1, 'scapula and clavicula': 1, 'maladies neurologiques': 6, 'maladie vasculaire': 7, 'maladies infectieuses': 168, 'maladie inflammatoire': 12, 'maladie infectieuse': 32, 'Couverture maladie universelle': 6, 'Sprengel anomaly': 27, 'Scapula fractures': 57, 'neurologic birth maladies': 2, 'Flying scapula': 3, "Lenin's malady": 2, 'congenital elevation of the scapula': 41, 'Maladie': 12, 'maladie actuelle': 2, 'hypoplasia of both scapulae': 1, 'hypoplasia of ilium and scapula': 1, 'neurological maladies': 50, 'maladie psychiatrique': 5, '-maladie': 13, 'fractured scapulae': 4, 'maladie multisystemique': 1, 'maladie de Gaucher de type 1': 1, 'Sprengel malformation': 4, 'maladie de Milroy': 1, 'MFC': 3, 'Maladie des feuilles cassantes': 1, 'ocular maladies': 9, 'bilateral winged scapula': 3, 'scapula pain': 11, 'trauma to scapula': 1, 'scapula defect': 2, 'Ipsilateral fracture of the clavicle and scapula': 1, 'ipsilateral fracture of the clavicle and scapula': 1, 'fracture of both scapulae': 1, 'Fracture of the scapula': 12, 'maladies emergentes': 13, 'fracture of the left scapula': 8, 'fracture clavicle and scapula': 1, 'winged scapulas': 1, 'Maladie de Morvan': 2, 'of the transverse ligament of the scapula': 1, 'et maladies': 5, "Sprengel's anomaly": 5, 'wing scapula': 3, 'maladie bipolaire': 1, 'longue maladie': 1, 'Snapping scapula': 25, 'maladies neurologiques hereditaires': 2, 'Dessine-moi ta maladie': 1, 'fracture of the scapula, clavicle or sternum': 2, 'scapula, clavicle or sternum fractures': 1, 'scapula, clavicle, or sternum fractures': 1, 'maladie chronique': 3, 'scapula misalignment': 1, 'Traumatic winging of the scapula': 2, 'craniofacial maladies': 1, 'Snapping Scapula': 6, 'nouvelle maladie': 7, "Etude de l'Histoire Familiale": 2, 'EHF': 3, 'asymmetry of the scapulae': 3, 'maladie diabetique': 1, 'carpal and scapula fractures': 1, 'Gestion de la maladie': 1, 'assurance maladie': 4, 'maladie metabolique': 2, 'hypoplastic clavicles and scapulae': 1, 'hypoplastic changes of: scapula, humerus': 1, 'winging of scapula': 14, 'scapulas': 13, 'Malady ya Souci': 1, 'resistance de la medecine familiale': 1, "Sprengel's Deformity of the scapula": 1, 'Mortimer malady': 2, 'fracture of collum scapulae': 1, 'MCV': 7, 'fractures of the left scapula and clavicle': 2, 'maladies renales': 30, 'biliary maladies': 3, 'extraarticular fractures of the scapula': 2, 'maladies coronaires': 2, 'scapula boney lesion': 1, 'sprengel shoulder': 2, 'Sprengel shoulder': 15, 'scapula notching': 10, "SPRENGEL'S": 1, 'pain near the scapula': 1, 'SMIT': 8, 'maladies infectieuses et tropicales': 19, 'Hand Maladies': 1, 'glenoid or scapula fractures': 1, 'physical malady': 3, 'maladie destructrice': 1, 'maladie principale': 1, 'maladies de systeme': 1, 'maladie celiaque': 1, 'muscle of the scapula': 1, 'osteonecrosis of the clavicle, scapula and humerus': 1, 'Fibro-osseous pseudotumor of the scapula': 1, 'osteoarthritic scapulae': 1, 'fracture of the coracoid process of the scapula': 5, 'maladie renale': 52, 'maladie renale chronique': 14, 'maladie cerebrovasculaire': 1, 'maladie coronaire obstructive': 1, 'maladie neurologique': 3, 'maladie hepatique': 12, 'maladie coronaire': 17, 'maladie cardiaque': 9, 'FSHD': 1, 'Fascio-scapula-humeral muscular dystrophy': 1, 'scapula impingement syndrome': 1, 'MRC': 9, 'tumors of the scapula': 16, 'scapula detachment': 1, 'hypoplasia of the left scapula': 1, 'depression of the scapula': 9, 'maladie universelle': 4, 'CMU': 9, 'Cover': 1, 'Sprengel syndrome': 1, 'MICI': 10, 'maladie inflammatoire chronique intestinale': 1, 'maladie de Hodgkin': 8, 'maladie de hodgkin': 2, 'MDH': 2, 'unilateral winging of the scapula': 2, 'Maladie de Parkinson': 3, 'inflammatory myofibroblastic tumor of the scapula': 1, 'throwing maladies': 1, 'Scapula fracture': 45, 'dysplastic scapula': 5, 'Chondromyxoid fibroma of the scapula': 4, 'depressed scapula': 5, 'physical maladies': 7, 'maladies chroniques': 6, 'displacement of the scapula': 7, 'Congenital superelevation of the scapula': 2, 'neurologic maladies': 7, 'malrotation of the scapula': 4, 'Cette maladie': 31, 'maladie de Creutzfelt-Jakob': 1, 'displaced fractures of the scapula': 4, 'Scapula Dyskinesis': 6, 'CeRMI': 1, 'maladies infectieuses emergentes': 10, 'Scapula dysfunction': 1, 'Benign tumor conditions of the scapula': 2, 'Familiale': 5, 'developmental anomaly of the scapula': 2, 'Scapula after Disease': 1, 'Malady': 3, 'malady': 36, 'swelling of the right scapula': 2, 'maladies infectieuses de': 1, 'maladie humaine': 5, 'Traumatic Avulsion of the Scapula': 1, 'familial malady': 1, 'SCAPULA': 12, '-maladie-': 1, 'Dislocation of the scapula': 4, 'Maremar': 1, 'Kalahasty malady': 1, 'Kalahasti malady': 2, 'necrotic hoof malady': 1, 'maladie hereditaire': 6, 'external rotation of scapula': 1, 'maladie residuelle': 2, 'SSS': 11, 'Snapping Scapula Syndrome': 13, 'maladie de HODGKIN': 1, 'maladie de Lyme': 7, 'La maladie de Lyme': 1, "Sprengel's Deformity": 10, 'maladie endotheliale': 1, 'Scapula alata': 18, 'winged scapula"': 1, 'maladie systemique sousjacente': 1, ') of the scapula or sternum': 1, 'of the scapula or sternum': 2, 'scapula dysfunction': 10, 'fractures ofthe scapula': 1, 'bone scapula': 1, 'fracture of scapula': 13, 'fracture of acromion of scapula': 1, 'skeletal maladies': 4, 'hypoplasia of the scapulae': 8, 'Hypoplastic scapula': 2, 'Fractures of spine of the scapula': 1, 'winging of the scapulae': 2, 'lesion of the scapula': 2, 'maladie de porcelaine': 1, 'maladie hydatique': 11, 'Tumors of the scapula': 4, 'maladies tropicales': 27, 'Sprengel disease': 3, 'maladie tumorale': 4, 'Clavicula/sterna/scapula fractures': 1, 'elevated scapula': 12, 'couverture maladie universelle': 3, 'scapula syndrome': 7, 'inborn maladies': 2, 'malady of humankind': 1, 'deformities of the scapula or thorax': 1, 'SICK scapula': 14, 'painful scapula non-union': 1, 'Unilateral winged scapula': 1, 'unilateral winged scapula': 1, 'neurological malady': 10, "Sprengel's deformities": 2, 'clavicule or scapula fracture': 1, 'maladies respiratoires': 5, 'left scapula fracture': 1, 'myocardial maladies': 1, 'genetic maladies': 14, 'Winging of the scapula': 11, "Sprengel's undescended scapula": 1, 'tilt of the scapula': 1, 'maladies hereditaires': 5, 'maladies neuromusculaires': 8, 'scapula and clavicular fracture': 2, 'abnormal rotation of the scapula': 2, 'fracture to the spine of the scapula': 2, 'trauma to the scapula': 3, 'maladie lupique': 9, 'maladie de Recklinghausen': 7, 'Hypoplastic angle of scapula': 1, 'renal maladies': 5, 'tumor of the scapula': 6, 'maladies coronariennes': 6, 'winging scapula': 20, 'Puncture of the scapula': 1, 'maladie est': 1, 'maladie nouvelle': 1, 'maladie chez': 1, 'emotional malady': 2, 'scapula spine fractures': 7, 'scapula spine fracture': 4, 'Scapula spine fracture': 1, 'radiation to scapula': 1, 'hypoplastic fibula and scapula': 1, 'maladies renales diagnostiquees': 1, 'Ramadan et maladie renale': 1, 'maladie coronaire atherosclereuse': 1, 'maladie cardiaque conditionne': 1, 'maladie des feuilles cassantes': 3, 'clavicle, scapula,': 4, 'maladie de Parkinson': 14, 'asymmetrical scapulae': 1, 'Physical maladies': 1, 'hypoplasia of iliac wings and scapulae': 2, 'restriction of the scapula': 2, 'Congenital high scapula': 4, 'inability to clear scapula': 1, 'sclerotic lesion of scapula': 1, 'Pagetic scapula': 1, 'primary bone tumor of the scapula': 1, 'CMUC': 2, 'maladie universelle et complementaire': 1, 'Congenital Elevation of the Scapulae': 2, 'of scapula': 24, 'lateral displacement of the scapula': 15, 'osteolytic scapula': 1, 'fractured portion of the scapula': 2, 'Perforation-like defect in the scapula': 1, 'fractures of the scapula and clavicle': 2, 'anomaly of the scapula': 5, 'scapula injuries': 5, "Sprengel's congenital deformity": 2, 'Scapula and': 1, 'maladie de': 6, 'Sprengel anomalies': 1, 'CMSDF': 1, 'neurological and neuropsychiatric maladies': 1, 'vascular and pulmonary maladies': 1, 'cranial maladies': 1, 'extremity, scapula': 1, 'CIM C50': 1, 'CIM': 1, 'internationale des maladies': 1, 'maladie thromboembolique': 7, 'Duplication of the scapula': 3, 'duplication of the right scapula': 1, 'autoimmune maladies': 16, 'Maladies infectieuses emergentes': 15, 'the Scapula': 1, 'bony abnormalities of the scapula': 1, 'ipsilateral scapula fractures': 1, 'Ipsilateral scapula fractures': 1, 'fracture of the costae or scapulae clavicle': 1, 'maladie ulcereuse': 3, "Maladie 'Syndrome": 1, 'tropical maladies': 4, 'Winging scapula': 6, 'geographic destruction of scapula': 1, 'Bilateral winged scapula': 1, 'bilateral winging of the scapula': 1, 'social maladies': 5, 'scapula deformity': 10, 'Left scapula deformity': 1, 'scapula winging': 7, 'tumors lesions of the scapula': 1, 'maladie experimentale': 1, 'maladie inflammatoire pelvienne': 3, 'dislocations of the scapula': 1, 'La Maladie de Parkinson': 1, 'scapula tumors': 6, 'maladies fibrotiques': 2, 'maladie de Behcet familiale': 1, 'Scapula lesions': 1, 'scapula cyst': 1, "maladie 'circule": 1, 'maladie professionnelle': 4, 'behavioral maladies': 7, 'and maladies': 1, 'maladies inflammatoires': 8, 'maladies cardiaques': 5, 'fractures of the acromion, clavicle, scapula and/': 1, 'scapula winging symptoms': 1, 'maladie ovarienne': 2, "Regie de l'assurance maladie du": 1, ', scapula, sternum': 3, 'reduction of the scapula alata': 1, 'fracture of the right scapula': 3, 'Congenital Elevation of Scapula': 2, 'Holiday maladies': 1, 'FMF': 3, 'fievre mediterraneenne familiale': 1, 'maladies infectieuses communautaires': 1, 'Dysfunction of the Scapula': 1, 'pseudowinging of scapula': 3, 'piscine maladies': 1, 'Maladies Mitochondriales': 1, 'maladies des femmes grosses': 2, 'neoplastic maladies': 1, 'maladie localisee': 1, 'maladie cancereuse': 11, 'Sprengel deformity of the shoulder': 3, 'deformed left scapula': 1, 'bony destruction of scapula': 1, 'maladies bucco-dentaires': 2, 'Scapulae': 6, 'violence familiale': 1, 'clavicle and scapula fracture': 5, 'scapulae alatae': 5, 'congenital maladies': 5, "' scapula": 1, 'maladie sociale': 1, 'fractures in the scapula': 1, 'maladie vesiculeuse': 1, 'angle of the scapula': 1, 'Angle of the Scapula': 1, 'citrus maladies': 2, 'maladie gestationnelle trophoblastique': 1, 'Painful crepitation of the scapula': 2, 'elevated scapulae': 1, 'sarcomas of the scapula': 1, 'fractures of the right scapula': 1, 'unstable fractures of the scapula': 1, 'des maladies': 1, 'Scapulas': 2, 'SD': 12, 'Sprengel Deformity': 11, "maladies de l'oeil": 1, 'winged-scapula': 2, 'maladies pulmonaires': 8, 'crepitation of the scapula': 1, 'maladie des industries electrique': 1, 'MK-sida': 1, 'MK': 7, 'maladie de kaposi': 8, 'maladie de Kaposi': 11, 'scapula rotation': 6, 'scapulae muscle': 3, 'evaluation of scapula': 1, 'displaced scapula fracture': 1, 'Maladie de Parkinson unilateral': 1, 'autosomal recessive malady': 3, 'scapula asymmetries': 1, 'Maladies emergentes infectieuses': 1, 'psycho-emotional maladies': 1, 'social malady': 10, "Sprengel's disease": 12, 'fractures of scapula': 3, 'and winged scapula': 1, 'Winging of scapula': 5, 'neoplasm of scapula': 2, 'maladie generale': 2, 'maladie qui': 2, "l'assurance maladie": 7, 'maladies de': 4, 'maladie de Castleman': 6, 'maladies infectieuses et tropicales emergentes': 2, 'behavioral malady': 1, 'impingement on the scapula': 1, 'knee and scapula deformities': 3, 'fracture of the body of the scapula': 3, 'MP': 5, 'Connaissance maladie ciblee': 1, 'malformations of the humerus and scapula': 1, 'maladies bulleuses': 7, 'system maladies': 1, 'Scapula lesion': 1, 'scapula lesion': 9, 'Hematogenous Osteomyelitis of the Scapula': 1, 'WINGED SCAPULA': 1, 'hepatic maladies': 4, 'La maladie de Grisel': 3, '-related maladies': 6, 'hand malady': 1, "L'addiction, une maladie": 1, 'Mobius, Sprengel': 1, 'scapula dysplasia': 4, 'scapula sarcoma': 1, 'scapula sarcomas': 1, 'maladies oculaires': 1, 'aching between the scapulae or in the arm': 1, 'Static winging of the scapula': 1, 'painful winged scapula': 1, 'painful scapula alata': 1, 'maladie serique': 2, 'maladie locale': 1, 'maladie potentiellement': 1, 'Spine of scapula': 3, 'instability of the scapula': 4, 'congenital high scapula': 17, 'Fractures of the scapula process': 1, 'acromial and scapula spine fractures': 2, 'maladies de Hodgkin': 1, 'Maladie de Hodgkin': 2, 'maladie de hodgkin mediastinale': 1, 'vascular maladies': 9, 'Maladie cancereuse': 1, 'Maladie ou syndrome': 1, 'maladies cutanees et syphilitiques': 1, 'skeletal injuries of the scapula': 1, 'maladie des': 4, "maladie inflammatoire de l'intestin": 2, 'MPC': 1, 'maladie pulmonaire chronique': 2, 'fracture in the scapula or the clavicle': 1, 'maladie pulmonaire fibrotique': 1, 'snapping scapulae': 2, 'maladie charbonneuse': 1, 'maladies animales': 3, 'coracoid process of scapula': 1, 'process of scapula': 1, "maladies inflammatoires chroniques de l'intestin": 4, 'maladie etait mystique': 1, 'terrible maladie': 1, 'maladies courantes': 1, 'MIE': 5, 'maladie infectieuse emergente': 1, 'maladie de Horton': 2, 'Arret maladie 1': 1, 'maladie de crohn': 4, 'Lateral winging of the scapula': 1, 'fracture of the coracoid process of the left scapula': 1, 'maladie maculaire': 1, 'high scapula': 5, "SPRENGEL'S DEFORMITY": 1, 'Lowering of the scapula': 1, 'elevated left scapula': 2, 'Congenital High Scapula': 1, 'swelling of right scapula': 2, 'rotation of the scapula': 4, 'Congenital elevated scapula': 3, 'notching of the scapula': 1, 'deficiency of right scapula adduction': 1, 'limitation of scapula elevation': 1, 'neuronal maladies': 5, 'maladie vasculaire peripherique': 2, 'maladie inflammatoire intestinale': 1, 'Rotation of the scapula': 1, 'maladies metaboliques': 3, 'maladie de Darier': 1, 'maladie respiratoire': 13, 'maladie pulmonaire obstructive chronique': 12, 'maladie endocrinienne': 2, 'Les maladies de la volonte': 1, 'maladie tropicale negligee': 4, 'maladie tropicale': 2, 'scapula protraction': 3, 'Fractures of the Scapula': 5, 'histoire familiale': 1, 'Maladies': 6, 'maladies tropicales negligees': 12, 'MTN': 12, 'maladies hepatiques': 4, 'hepatic and renal maladies': 1, 'defis de la medecine familiale rurale': 1, 'winged scapulae': 17, 'Scapula process': 1, 'scapula process fractures': 3, 'Pelvic Scapula': 1, 'maladies-et-traumatismes': 3, 'mythical malady': 1, 'maladies mentaux': 1, 'renal malady': 1, 'osteolytic lesion at the scapula': 1, 'intellectual and behavioral maladies': 1, 'SNIIR-AM': 1, 'couverture maladie': 1, 'hypercholesterolemie familiale de type IIa': 1, 'maladie maternelle': 3, 'clavicle or scapula fractures': 4, 'painful superior angle of the scapula': 1, 'snapping scapulas': 1, 'crepitus of the scapula': 3, 'prostration of the scapula': 1, 'hochgradige dislocation der scapula': 1, "Sprengel's deformity of the shoulder": 3, 'congenital elevation of scapula': 2, 'of the scapulae': 2, 'allied maladies': 1, 'maladie occasionne des': 1, 'Fractured scapula': 2, 'undescended scapula': 15, 'fractures of the scapulae': 2, 'fracture of the scapulae': 1, 'maladie ayant': 1, 'primary scapula tumor': 1, 'maladie thyroidienne': 3, 'defect of left scapula': 1, 'scapula Fractures': 1, 'winged scapula syndrome': 1, 'painful snapping of the scapula': 1, 'Epilepsie familiale': 1, 'maladie cerebrale': 2, 'Incisura scapulae syndrome': 1, "atteinte de l'arc aortique type MT": 1, 'Sprengel scapular deformity': 3, 'lytic destructive lesion of the scapula': 1, 'tubercular involvement of the scapula': 1, 'nerve maladies': 1, 'sthenurine scapula': 1, 'dyskinesis of the scapula': 3, 'Cnam': 2, 'scapula depression': 6, 'deformity of the winged scapula': 1, 'ANRS-MIE': 1, '-maladies infectieuses emergentes': 1, 'developmental maladies': 12, 'cohesinopathic maladies': 1, 'maladie peritoneale': 1, 'coracoideus of the scapula': 1, 'scapula posterior depression': 1, 'ossification of the left scapula': 1, 'fracture of the clavicle or scapula': 2, 'raised scapula': 2, 'maladie unilaterale': 1, 'maladies de la peau et': 1, 'modern malady': 1, 'modern maladies': 1, "Comite des maladies du voyageur et d'importation": 1, 'SCAPULA NECK AND BODY FRACTURES': 1, 'chondrolipoma ofthe scapula': 1, 'intramuscular chondrolipoma of the scapula': 1, 'Intramuscular Chondrolipoma of the Scapula': 1, 'Chondrolipoma in the scapula': 1, 'HGD': 1, 'maladie sera ainsi diminuee': 1, 'auditory maladies': 1, 'female malady': 1, 'sprengel shoulder deformity': 1, 'urinary maladies': 1, 'injuries to the scapula': 1, 'dysKinesis of scapular movement) scapula syndrome': 1, 'dental maladies': 4, 'febrile malady': 3, 'maladies humaines': 7, 'autres maladies infectieuses': 1, 'maladie emergente': 5, 'Millennium malady': 2, 'SNDS': 1, 'Maladies infectieuses': 6, 'maladies professionnelles': 3, 'malformation of the scapula': 4, 'Congenital elevation of scapula': 1, 'deficit of the scapula': 2, 'Scapula Glenoid': 1, 'reduction of scapula lateral rotation': 1, 'reduction in scapula lateral rotation': 1, 'lower leg or scapula fractures': 1, 'Dry Scapulae': 1, 'fracture in the scapula': 1, 'fracture of the spine of the scapula': 2, 'Segmental fracture of acromion and spine of the scapula': 1, 'angle spine fracture of the scapula': 1, 'Fractures in the scapula': 1, 'the spine of the scapula': 2, 'maladie epileptique': 3, 'impaired stability of the scapula': 1, "L'Assurance maladie": 1, 'Ada and Miller Type 2 or 4 scapula fractures': 1, 'Ada-Miller Type 2 or 4 scapula fractures': 1, 'Fractures of the body of scapula': 1, 'maladie thromboembolique chronique': 1, 'scapula-humeral or coxo-femoral injuries': 1, 'Scapula body fracture': 1, 'UNUSUAL ECCHONDROMA SCAPULAE': 1, 'fractures of midshaft clavicle and ipsilateral scapula': 1, 'Displaced scapula fractures': 1, 'Scapula Fractures': 10, 'scapula injury': 3, 'left scapula': 1, 'Sprengel deformities': 5, 'scaphoid scapula': 4, 'MALADIES': 3, 'meme maladie': 2, 'ocular malady': 2, 'the winged scapula': 1, 'acromial/scapula fractures': 1, 'fractures of the scapula type A, B or C': 1, 'deformity of the scapula': 3, 'Scapula deformity': 1, 'pulmonary maladies': 8, 'maladies of': 2, 'leurs maladies': 1, 'pain among the scapulae': 1, 'painful winging of the scapula': 3, 'movement impairments of the scapula': 1, 'scapula body fractures': 10, 'scapula body': 3, 'Scapula Body Fractures': 1, 'Painful snapping of the scapula': 1, 'painful crepitus of the scapula': 1, 'hearing maladies': 2, 'PCIME': 2, 'maladie oculaire': 2, 'maladie de Biermer': 4, "Sprengel's scapula": 2, 'CMUc': 1, 'deformed scapula': 1, 'abnormal scapula motion': 2, 'lesions of the scapula': 4, 'acromion/scapula fractures': 2, 'nodule of scapula': 1, 'maladie des travailleurs': 9, 'classification internationale des maladies': 2, 'tumeur selon la classification internationale des maladies': 1, 'contrast disorders of the scapula': 1, 'Osteomyelitis of the scapula': 6, 'Hematogenous osteomyelitis of the scapula': 1, 'GEMUD': 1, 'scapula fractures': 1, 'SFs': 2, 'Voluntary winging of the scapula': 1, 'voluntary winging of the scapula': 1, 'neuromuscular WS': 1, 'fractures under the scapula': 1, 'maladies cecitantes': 1, 'processes of scapula': 1, 'spiritual malady': 2, 'protracted scapulae': 2, 'scapula-humeral peri-arthritis': 1, 'MALADIES INFECTIEUSES': 1, 'Alar scapula': 2, "Sprengel's syndrome": 5, 'maladie de Neville': 1, 'scapula asymmetry': 3, 'upward scapula rotation': 1, 'congenital deformity of the scapula or thorax': 1, 'asymmetry of scapula motion': 1, 'thrombophilie familiale': 1, 'ophthalmologic maladies': 1, "Familial Sprengel's disease": 1, 'upper and medial dislocation of the scapula': 1, 'congenital malformation of the scapula': 3, "left shoulder Sprengel's deformity": 1, 'maladies parasitaires': 2, 'maladies de la thyroide': 1, 'Snapping scapulae': 1, 'tuberculous osteomyelitis of the scapula': 2, 'familiale': 3, 'maladies Renales': 1, 'Scapula-A': 1, 'and snapping of scapula': 1, 'pain around the scapula': 4, 'putrid maladies': 1, 'suppurative ostemoyelitis of the scapula': 1, 'maladie toutes': 1, 'maladie de Cushing': 4, 'scapula-back type': 1, 'scapula-back': 1, 'myasthenie familiale': 1, 'maladie de Verneuil': 3, 'ISAF displacement': 1, 'ISAF': 1, 'Inferior scapula angle fractures': 1, 'Fractures of the inferior angle of the scapula': 1, 'Inferior Scapula Angle Fractures': 1, 'inferior scapula angle fractures': 1, 'inferior scapula angle fracture': 1, 'Skeletal maladies': 1, 'bilaterally hypoplastic scapula': 1, 'internal rotation of the scapula': 1, 'malignancy of the scapula': 1, 'resorption of the scapula': 1, 'cutaneous malady': 1, 'alar scapula': 3, 'maladies vasculaires peripherique,': 1, 'double fracture of the clavicle and scapula': 1, 'winging of scapulae': 3, 'fractures of the scapula or': 1, 'prolapse of the scapula': 1, 'Fractures of the clavicle and scapula': 2, 'and scapula': 4, 'maladie allergique': 1, '-Etre Familiale': 1, 'benign tumor of the scapula': 4, 'winged scapula (scapula alata': 1, 'pseudo-winging of the scapula': 2, 'fractures of the scapula, clavicle, or': 1, 'fracture of the spine of scapula': 1, 'age-associated maladies': 1, 'osteochondromatosis in the scapula': 1, 'pseudowinging scapula': 1, 'benign tumors of scapula': 1, 'coracoid process fracture of scapula': 1, 'coracoid process fracture of the scapula': 1, 'nonunion of the scapula': 2, 'developmental malady': 1, 'scapula nonunions': 2, 'scapula fracture nonunion': 2, 'bilateral dysplasia of the spine and of the scapula': 1, 'abnormalities of the scapula': 1, 'hypoplasia and dysplasia of the humerus and scapula': 1, 'divine malady': 2, 'Malpractice maladies': 1, 'medical maladies': 1, 'maladies of the eye': 2, 'scapula valga': 1, 'maladies de Still': 1, 'medial scapula pain': 1, 'malady of the eye': 2, 'depressed scapulas': 1, 'diabete et des maladies metaboliques': 1, 'dyskinetic scapula': 4, 'avulsion of the upper extremity with the scapula': 1, 'scapula and clavicle abnormalities': 1, 'planification familiale': 3, 'PF': 6, 'foramen scapulae': 1, 'foramen scapula': 1, 'dorsal luxation of the scapula': 1, 'Dorsal displacement of the scapula': 1, 'cette maladie': 3, 'restricted rotation of the scapula': 1, 'Scapula Fracture': 9, 'osteolytic lesion of the scapula': 3, 'nodular lesion of scapula': 1, 'scapula and acromion fractures': 1, 'scapula spine': 1, 'scapula spine base fracture': 1, 'scapula spine-based fracture': 1, 'pain on left scapula': 1, 'Fracture of the right scapula': 2, 'SIDA-MI': 1, 'Bone involvement of the scapula': 1, 'Os scapula': 1, 'dysplastic scapulae': 1, 'maladies terminales': 1, 'carpal maladies': 3, 'fractures of the scapula, sternum, and spinous processes': 1, 'postural abnormality of the scapulae': 1, 'MH': 2, 'Subcutaneous posterior scapula': 1, 'PNBSF': 1, 'spine of scapula facture': 1, 'Fracture of scapula': 4, 'glenoid or scapula spine fractures': 1, 'SIDA maladie': 1, 'dry scapula': 1, 'lytic lesion of the scapula': 1, 'Glenoid process of scapula': 1, 'Painful snapping scapula': 1, 'painful snapping scapula': 8, 'scapula tumor': 5, 'Scapula winging': 3, 'fractures to the clavicle and scapula': 1, 'osteoarthricular malady': 1, 'Fracture of the coracoid process of the scapula': 5, 'Fractures of the Body of Scapula': 1, 'scapula body fracture': 8, 'fractures of the body of scapula': 1, 'fracture of scapula body': 1, 'Fractures of the scapula body': 1, 'MTEV': 4, 'La maladie de Sachs': 1, 'Maladies neuromusculaires 2': 1, 'Stahleckeriid scapulae': 1, "maladies inflammatoires de l'intestin": 1, 'diarrhoeal malady': 1, 'scapula coracoid process': 1, 'fractures of the scapula, sternum': 1, 'congenital elevated scapula': 5, 'agenesis of the scapula': 1, 'Winged scapulae': 3, 'luxation of the canine scapula': 1, 'ML': 2, 'MPOC': 5, 'GCTs of the scapula': 1, 'lateral winged scapula': 1, 'Fractures of the body of the scapula': 1, 'Intrathoracic scapula': 1, 'fractures of the scapula and': 2, 'congenitally high scapula': 1, 'malrotated scapula': 2, 'pain in the scapula': 3, 'maladie emergente puis': 1, 'Primary bone tumors of the scapula': 1, 'Sarcoma of Scapula': 1, "FungatingEwing's Sarcoma of Scapula": 1, 'humerus, scapula and/': 1, 'Tubercular osteomylitis of scapula': 1, 'scapula Pain': 1, 'maladie lysosomale': 1, 'destabilization of the scapula': 1, 'coracoid process of the scapula': 1, 'Scapula tumors': 1, 'SSF': 1, 'Scapula skin folds': 1, 'fractures of the body of the scapula': 1, 'Maladie kystique de machoires': 1, 'LV maladie': 1, 'hypoplastic elevated scapula': 1, 'maladie angioproliferative multifocale': 1, "regie de l'assurance maladie": 1, 'radiation to the scapula': 2, 'ribs, scapula': 1, 'maladies des camelides': 1, 'maladie de Kaposi classique': 2, 'Pain in the left scapula': 1, 'dislocated scapula fracture': 1, 'injuries of the scapula fractures': 1, 'Fracture of the acromion scapulae': 1, 'Maladie residuelle minime': 1, 'maladie residuelle minime': 1, "maladie de Still de l'adulte": 6, 'maladie de Gaucher': 2, 'mediterraneenne familiale': 1, 'Maladie de Gaucher de type 1': 1, "Dr Johnson's maladies": 1, 'maladie pulmonaire obstructive': 2, 'maladie pulmonaire interstitielle': 1, 'maladie taboue': 1, 'deviation of the scapula at': 1, 'Necker- Enfants maladies': 3, 'SICK Scapula': 1, 'snapping scapula"': 1, '"winged" scapula': 1, 'scapula lesions': 3, 'displaced scapula fractures': 3, 'OF SCAPULA OF FRACTURES': 1, "maladie benigne de l'enfant": 1, 'angulus inferior of the scapula': 1, 'nodule on the scapula': 1, 'mandible and scapula': 1, 'fracture of the right scapula and the sternum': 1, 'maladies neurocognitives': 1, 'maladie neurocognitive': 1, 'Maladies Infectieuses': 2, 'maladies Infectieuses': 1, 'Sprengel': 8, 'hypoplastic, elevated and malrotated scapula': 1, 'psycho-social maladies': 1, 'maladies of the': 1, 'clavicle and scapula lesions': 1, 'fracture of the clavicle, scapula, and': 1, 'Lytic lesion in inferior angle of scapula': 1, 'Couverture maladie': 5, 'La maladie des genoux bleus': 2, 'maladie des genoux': 1, 'lofty scapulas': 1, 'gastroenterologic maladies': 1, 'fracture of scapula or clavicle': 1, 'Sprengel deformity of the left scapula': 1, 'congenital deformity of one or both scapulae': 1, 'scapula elevata': 1, 'Undescended scapula': 2, 'dislocation of the scapula': 8, 'Sprengel scapula': 1, 'congenital defect of the scapula': 1, 'fracture of the scapula and/or clavicle': 1, 'maladies retiniennes': 1, 'alata scapula': 1, 'scapula instability': 1, 'Scapula instability': 1, "sprengel's deformity": 4, 'incisura scapulae syndrome': 5, 'maladie-invalidite': 4, 'maladies dysimmunitaires': 1, 'maladies de peau sont': 1, 'congenital elevation of the scapulae': 1, 'pain between the scapulae': 1, 'Acromion fractures of the scapula': 4, 'rib, scapula': 1, 'maladies dixieme': 1, 'Trigger scapula': 1, 'scapulae muscles': 2, 'Pain between scapulae': 1, "Double Sprengel's Shoulder Deformity": 1, 'oral malady': 3, 'Hypoplasia of the body of the scapula': 1, 'maladies renales parenchymateuses': 1, 'des maladies du sein': 1, 'vascular malady': 1, "Sprengel's deformity of": 2, 'Ces maladies': 2, 'dislocation of scapula': 2, 'elevation of the scapula': 4, 'Anomalies of the scapula': 1, 'anomalies of the scapula': 1, 'glenoid fractures of the scapula': 1, 'scapula tumor lesion': 1, 'neuropathological maladies': 1, "Osteomyelite aigue hematogene de la scapula chez l'enfant": 1, 'fracture of ipsilateral scapula or clavicle': 1, 'Sprengel deformity-elevated scapula': 1, 'dysmorphic right scapula and glenoid': 1, "Sprengel's deformity of the": 1, 'SIL': 1, 'maladies hereditaires recessives': 1, 'cinq maladies recessives': 1, 'Scapula alataFacial paresis': 1, 'LAMal': 1, "Loi sur l'Assurance maladie": 1, 'scapula and acromioclavicular joint injuries': 1, 'cutaneous maladies': 8, 'Congenital Elevation of the Scapula': 1, 'congenital high-scapula': 1, 'of scapula and': 1, 'maladies lysosomales': 1, "maladie de l'ame": 1, 'maladies vasculaires': 1, 'hypoplasia of pelvic bones and scapulae': 1, 'maladies hydriques': 1, 'fractures of the clavicle, glenoid, and scapula': 1, 'weakness of the scapula,': 1, 'malignant lesions of the scapula': 2, 'sternum and scapula fractures': 1, 'maladie mystique': 1, 'Fracture of the Scapula': 1, 'displacement of the scapula upward': 1, 'Dislocation der Scapula': 1, 'congenital elevated (or high) scapula': 1, 'dysplasia of the affected scapula': 1, 'dental malady': 2, 'birth maladies': 1, 'displacement of scapula fractures': 1, 'wing scapula sign': 1, "Sprengel's shoulder deformity": 4, 'Scapula glenoid fractures': 1, 'pain to the scapula': 1, 'abnormally elevated scapula': 1, 'fracture of the scapula spine': 1, 'maladie respiratoire chronique': 1, 'injury malady': 1, 'Avulsions of the spine of the scapula': 1, 'avulsions of the scapula': 1, 'Dorsal Scapula': 1, 'fractured scapulas': 1, 'mass underneath the scapula': 1, 'type 2 scapula': 1, 'fractures of the processus coracoideus scapulae': 1, 'erosion of the scapula': 1, 'erosion of scapula': 1, 'Scapula defect': 1, 'misshapen scapula': 2, 'screaming maladies': 1, 'dysplasia of the clavicle and scapula': 1, 'Fracture Scapula': 1, 'maladie de Still': 2, 'maladie tout': 1, 'chronic osteomyelitis of the scapula': 1, 'Fractures of the acromial extension of the scapula': 1, 'maladies cardiovasculaire, pulmonaires': 1, 'under-rotation of the scapula': 1, 'functional maladies': 1, 'scapula corpus fracture': 1, 'maladie de Paget': 1, 'of ossification of scapulae': 1, 'retardation of ossification of scapulae': 1, 'osteolytic lesion in scapula': 1, 'osteolytic lesion of right scapula': 1, "l'Assurance Maladie": 1, 'maladie vasculaire choroidienne': 1, 'maladie tuberculeuse': 4, 'fractures of the carpus, scapula': 1, 'congenital evaluation of the scapula': 1, 'Necker-Enfants maladies': 1, 'coral maladies': 1, 'scapula damage': 2, 'scapula and upper extremity injury': 1, 'MBA': 2, 'clavicle and scapula fractures': 6, 'Hypoplastic scapulae': 3, 'Short scapula': 1, 'maladies hydriques liees': 1, 'Scapula clavicle fracture': 1, 'abnormal scapulae': 1, 'IwWS': 1, 'Traumatic winged scapula': 2, 'Scapula Sprengel deformity': 1, 'maladie primaire': 1, 'Fractures of the inferior aspect of the scapula': 1, 'nouvelles maladies': 2, 'nouvelles maladies infectieuses': 1, 'cerebral vascular maladies': 1, 'abnormal motion of the scapula': 1, 'spinal maladies': 3, 'Elastofibroma scapulae': 1, 'Autres maladies rhumatismales': 1, 'maladie diagnostiquee': 1, 'scapula body and process fractures': 1, 'OTA scapula fracture': 1, 'scapula body and process injuries': 1, 'fracture type of scapula': 1, "Sprengel's Deformity of the Shoulder and Hirschsprung's Disease": 1, 'upward and external rotation of the scapula': 1, 'CanMEDs-MF': 1, 'MF': 1, 'erosions of the scapula': 2, 'scapula abscess': 2, 'GMF-U': 1, 'impingement against the scapula': 1, 'clavicle-scapula spine impingement': 1, 'Assurance maladie': 1, 'Erosion of the scapula': 1, 'dorsal luxation of the left scapula': 1, 'maladie de kaposi classique': 1, 'Pulmonary maladies': 1, 'maladie de Brugeres': 1, 'AEEMA': 2, "Gogh's malady": 1, 'hypoplastic right scapula': 1, "P Sprengel's deformity": 1, 'Tumors affecting the scapula': 1, 'Fibrous dysplasia tumor of the scapula': 1, 'FD of scapula': 1, 'Unilateral Fibrous Dysplasia of the Scapula': 1, 'FD of the scapula': 1, 'maladies-infectieusesemergentes': 1, 'defects in the scapula': 1, 'defect scapula': 1, 'maladi moun fe': 1, 'maladi Bondye': 1, 'maladi bon lwa': 1, 'COMARES': 1, 'deformations of the scapulae': 1, 'Facklamia hominis scapula abscess': 1, 'abscesses of the scapula': 1, ', neoplastic maladies': 1, 'Maladies infectieuses et': 1, 'to scapula': 1, 'pain across the scapula': 1, 'Sprengel deformity"by': 1, 'clavicle, sternum, scapula fractures': 1, 'ischemic maladies': 1, "I'assurance-maladie": 1, 'asymmetric winged scapulae': 1, 'or elevated scapula': 1, 'crepitus at scapula': 1, 'la maladie de Grisel': 1, 'rib, scapula,': 2, 'malignant lesion of the scapula': 2, 'dissociation between the scapula and the clavicle': 1, 'motor maladies': 1, 'Scapula (Shoulder Blade) Disorders': 1, 'dislocated scapula': 3, 'osteolytic lesion in the scapula': 2, 'dislocation of the right scapula': 1, 'Developmental anomalies of the scapula': 1, 'Congenital malformations of the scapula': 2, 'fracture of the lower angle of scapula': 1, 'fracture of the inferior angle of the scapula': 4, 'FRACTURES OF THE SCAPULA': 2, 'proteotoxicity maladies': 1, 'Neurological maladies': 2, 'avulsion of the upper extremity and scapula': 1, 'Scapula Metastatic carcinoma': 1, 'Medical malady': 1, 'scapula body nonunion': 2, 'fractures to the scapula': 1, 'Maladie de Hogdkin': 1, 'maladies cutanees': 1, 'Sprengel deformity of the scapula': 2, 'drooping scapulae': 1, 'maladie de Cruveilhier': 1, 'maladie vasculaire cerebrale': 2, 'maladie rhumatismale': 1, 'scapula hypoplasia': 5, 'glenoid scapula fractures': 1, 'sciuromorph scapula': 1, 'Osteochondrosis of the inferior pole of the scapula': 2, 'osteochondrosis of the inferior pole of the scapula': 2, 'Scapula lower pole Panner disease': 1, "Caisse nationale de l'assurance maladie": 2, 'impairment of upper limb abduction with winged scapula': 1, "Arcite's malady": 1, "unilateral Sprengel's deformity": 1, 'descent of the scapula': 1, 'fractures of the clavicle and scapula': 6, 'fractures in the clavicle and scapula': 1, '-maladie serique': 1, 'Pongo scapulae': 1, 'anterior depression of the scapula': 1, 'granuloma of the scapula': 2, 'malformation of scapula': 1, 'congenital malformation of scapula': 1, "congenital Sprengel's deformity": 1, 'inferior displacement of the scapula': 1, 'scapulae of type III, IV and VI SSN': 1, 'maladie contagieuse': 3, 'Maladies Mentalis': 1, 'Pseudo-winging of the scapula': 2, 'rib, scapula, and': 1, 'painful scapula': 4, 'Fracture of the inferior pole of the scapula': 1, 'Tuberculous osteomyelitis of the scapula': 2, 'tuberculous infection of the scapula': 1, 'pain in scapula': 1, 'Pain in scapula': 1, 'scapula Fx': 1, 'displaced scapula body fracture': 1, 'Scapula body fractures': 1, 'Fx of the scapula': 1, 'Fractures of the Scapula Body': 1, 'Fx) of the scapula': 1, 'scapula body Fx': 1, 'sick scapula syndrome': 1, 'Meningioma of the scapula': 1, 'moonshine malady': 1, 'torsion of left scapula': 1, 'Tumors of the scapula and clavicle': 1, 'Small and high scapula': 1, "maladies de l'urethre": 1, 'sacrumsacrum scapula': 1, 'alopecia on the scapula': 1, 'Sprengel type scapula': 1, 'Sprengels deformity': 1, 'Maladies Infectieuses Emergentes': 1, 'lateral dislocation of the scapula': 1, 'lateral displacement of the right scapula': 1, 'autoimmune malady': 2, 'decentralisation de la couverture assurance maladie': 1, 'Medical maladies': 3, 'winged scapula deformity': 1, 'maladie post-orgasmique': 1, 'scapulae,': 1, 'scapula Ideberg Type 4 fracture': 1, 'MSA': 3, 'Epithelioid hemangioma of the scapula': 1, 'maladie parasitaire': 2, 'traumatic dislocation of the scapula and humerus': 1, 'scapula displacement': 2, 'Scapula 4': 1, 'left scapula lesion': 1, 'hypoplasia of scapulae': 1, 'illness maladie 108': 1, 'malpractice malady': 2, 'maladies psychiatriques': 1, 'tumorous affections of the scapula': 1, 'maladie de Marie': 1, 'Scapula and clavicle fractures': 1, 'Scapulae alatae': 1, 'injuries to the spine, clavicle/scapula, femur': 1, 'CM': 1, 'raised scapulae': 1, 'bone remodelling of the scapula': 1, 'intraosseous tumor of the scapula': 1, 'dysmorphic scapula': 2, 'neuroimmune maladies': 1, 'right scapula fracture': 1, 'wing scapula" deformity': 1, 'Osteolytic lesion in scapula': 1, 'lateral scapula rotation': 1, 'Snapping of the scapula': 1, 'maladies respiratoires infectieuses': 1, 'Maladi Zonbi': 1, 'Maladi Nanm': 1, 'maladi zonbi': 1, 'Maladi nanm': 1, 'maladi nanm': 1, 'Maladie asthmatiforme': 1, 'maladie asthmatiforme': 1, 'Angioma of the scapula': 1, 'destruction of spine scapula': 1, 'rib and scapula abnormalities': 1, 'painful winging of the scapula': 1, "l'Assurance maladie": 1, 'SIAM': 1, 'osseous lesion of the scapula': 1, 'Inferior notching of the scapula': 1, 'nonunion of the scapula spine fracture': 1, 'swelling to the scapula': 1, 'Disorders of the scapula': 1, 'destruction of the left scapula': 1, 'seroprevalence de la maladie': 1, 'ma maladie': 2, 'maladies hepatiques et renales': 1, 'neuropathic maladies': 2, 'CONGENITAL HIGH SCAPULA': 1, 'SPRENGEL': 3, 'maladi Sida': 1, 'discomfort in the scapula': 1, 'maladie intestinale': 3, 'scapula and glenoid fractures': 1, 'MFs) of the scapula': 1, 'fracture clavicula/scapula': 1, ', clavicle, scapula,': 1, 'costal and scapula exostoses': 1, 'Scapula Abscess': 1, 'inborn malady': 1, 'MALADY OF TOULOUSE-LAUTREC': 1, 'lateral deviation of the scapula': 1, 'avulsion of the scapula': 1, 'maladies of motor function': 1, 'Displaced fractures of the scapula': 1, 'non-displaced fractures of the scapula': 1, 'fractures of the scapula with': 1, 'displacement of scapula and clavicula': 1, 'scapula defects': 3, 'Neoplasms of the scapula': 1, 'sarcoma of the scapula': 3, 'Scapula and coracoid': 2, 'fractures of the inferior angle of the scapula': 1, 'of the scapula fractures': 1, 'high scapulae': 1, 'fracture of the ipsilateral scapula': 2, 'Sprengel s deformity': 1, 'cyst of scapula': 1, 'scapula-humeral and pelvic-femoral weakness': 1, 'maladie hemorragique': 1, 'scapula-spine pathologic': 1, 'dysplasia of scapulae': 1, 'diseases of the scapula': 1, 'duplication of the scapula': 2, 'neurodevelopmental maladies': 3, 'fracture of the spine, scapula and/or clavicle': 1, 'fractures of the scapula, clavicle': 1, 'scapula,': 2, 'Scapula,': 1, 'clavicle or scapula fracture': 2, 'ses maladies': 1, 'maladie coeur': 1, 'coracoid process fractures of the scapula': 1, 'Coracoid Process Fractures of the Scapula': 1, 'abnormal scapula': 3, 'maladie circulait': 1, 'maladie de Poncet': 1, 'maladie vertebrale': 1, 'fracture of the distal clavicle or scapula': 1, 'ailments and maladies': 1, 'maladies inflammatoires chroniques de l intestin': 1, 'deformity of winging of the scapula': 1, 'deformity of winging of scapula': 1, 'clavicle and scapula elevated': 1, 'ostochondroma of the scapula': 1, 'atrial maladies': 1, 'hypoplasia of the right scapula': 1, 'hypoplasia of the inferior part of the right scapula': 1, 'Hypoplasia of the right scapula': 1, 'sprengel anomaly': 2, 'inappropriate movement of the scapula': 1, 'abnormalities of scapula': 1, 'injury to the humerus, scapula, or clavicle': 1, 'fibromyxoid tumor of the scapula': 1, 'fibromyxoid sarcoma of scapula': 1, 'fibromyxoid sarcoma of the scapula': 1, 'Pain in the scapula': 1, 'Marathon maladies': 2, 'maladie thromboembolique veineuse': 7, 'maladie de Gougerot-Sjogren': 1, 'Kibler scapula': 1, 'type IV Kibler scapula': 1, 'LSSS': 1, 'dyslipidemies familiales': 1, 'SA': 4, 'scapula-humeral subluxation': 1, 'maladie de Crohn': 3, 'Maladie de Crohn': 1, 'Glenoid of the scapula': 1, 'flying scapula': 2, 'autoimmune, and neoplastic maladies': 1, 'muscular-skeletal maladies': 1, 'dyskinesia of the scapula': 3, 'hypoplasia of the right scapula, clavicle, and humerus': 1, 'osteolytic lesions of right scapula': 1, 'Tuberculous involvement of scapula': 1, "maladies infectieuses pour l'homme": 1, 'Winging Scapula': 2, 'fractures of the clavicle or scapula': 1, 'fractures in the clavicle, scapula': 1, 'bony defects of the scapula': 2, 'dysfunction of the scapula': 2, 'immunodeficiency maladies': 1, 'MT': 1, 'multisystem maladies': 1, 'congenital anomalies of the scapula': 1, 'congenital anomaly of the scapula': 2, 'adhesion of scapula': 1, 'adhesion of the scapula': 1, 'scrofulous maladies': 1, "maladies mentales et de l'encephale": 1, 'impaired abduction of the upper limb with winged scapula': 1, 'Winging of Scapula': 1, 'hypoplasia of the ipsilateral scapula, humerus and forearm bones': 1, 'fractures of the sternum or scapula': 1, 'maladie granulomateuse Secondaire': 1, 'maladies diarrheiques': 1, 'fractures of both scapulae': 1, 'genetic malady': 3, 'medical malady': 1, 'benign fibrohistiocytoma of the scapula': 1, 'maladie synoviale': 1, 'dyskinesis of scapula': 1, 'histiocytic maladies': 1, 'paludisme congenital-maladie': 1, 'midline fractures of the scapula complex': 1, 'deformed scapula fracture': 1, 'DS': 1, 'Fondation des maladies du coeur': 1, 'scapula area pain': 1, 'winging scapulae': 4, 'tropical malady': 1, 'Scapula notching': 1, 'maladie extrapelvienne': 1, 'Scapula Body Fracture': 2, 'Dyskinesis of the scapula': 1, 'scapula and clavicle fracture': 1, 'Stade de la maladie I': 1, 'undescended scapulae': 1, 'congenital abnormalities of the scapula': 1, 'Fracture of the scapula process': 1, 'protracted scapula': 1, 'maladies of the soul': 2, 'scapula fracture complication': 1, 'Scapula replacement': 1, 'scapula, clavicle, and': 2, 'scapula deformities': 2, 'Maladies inflammatoires intestinales': 4, 'Greenstick fracture of the scapula': 1, 'greenstick fracture of the scapula': 1, 'et-maladies': 2, 'geriatric maladies': 1, 'Snapping Scapulae': 1, 'scapula deviations': 1, 'maladie de Grisel': 2, 'abnormal scapula movement': 1, 'fractures of the clavicle, scapula': 1, 'pain of left scapula': 1, 'pain in the left scapula': 1, 'intraosseous schwannoma of the scapula': 2, 'intraosseous schwannoma of scapula': 1, 'tickborne maladies': 1, 'A scapula alata': 2, 'scapula conditions': 1, 'unilateral scapula alata': 1, 'a scapula alata': 2, 'Scapula Alata': 2, 'abducted scapula': 2, 'fracture of the clavicle and scapula': 2, 'anomalies of vertebrae, ribs, and scapulae': 1, 'painless scapula': 1, 'Sprengel s anomaly': 1, 'Sprengel s shoulder': 1, 'scapula scapula fractures': 2, 'face-scapula-humerus': 1, "d'hypercholesterolemie familiale de type IIa": 1, 'hypercholesterolemie familiale': 2, 'Sprengel deformity of Cavendish': 1, 'intraosseous lesion of the scapula': 1, 'multifocal scapula lesion': 1, 'abnormal movement of the scapula': 1, 'maladies endocriniennes de la croissance': 1, 'burst fracture of the right scapula': 1, "Sprengel's": 2, 'clavicle and scapula': 2, 'fracture of body of scapula': 1, 'fractures of the scapula and glenoid': 2, 'maladies et riposte': 1, 'SIMR': 1, 'malady for abuse': 1, 'fracture of left scapula': 2, 'hand maladies': 3, 'maladie aurait fortement': 1, 'diseases in the scapula': 1, 'lesions in the scapula': 1, 'fracture of the superior scapula': 1, 'dysplasias of the scapula': 1, 'Dysplasias in the scapula': 1, 'Granulocytic sarcoma of the scapula': 1, 'ANF of the scapula': 1, 'snapping scapula symptoms': 2, 'Painful Snapping Scapula': 1, 'snapping scapula condition': 1, "Sprengel's deformity of the shoulder joint": 1, 'maladie de Fanconi': 1, "Caisse nationale d'assurance maladie des travailleurs": 1, 'Acquired synostosis of the scapula and 2 ribs': 1, 'true-winged scapula': 1, 'fractures of the clavicle/scapula/sternum': 1, ', scapula and clavicle lesions': 1, 'Clavicle and scapula': 1, 'IAS fracture': 1, 'IAS) fractures': 1, 'Inferior angle of scapula fractures': 2, 'Inferior angle of scapula (': 1, 'IAS fractures': 1, 'hypoplasia or atrophy of the right clavicle, scapula, and humerus': 1, 'disruption of the scapula': 1, "maladies de l'enfant": 1, 'Humerus-scapula movement delay': 1, 'Maladie de Charcot': 2, 'maladies coeliaques': 1, 'maladie granulomateuse': 2, 'pain around scapula': 1, 'hyperinflammatory malady': 1, 'scapula smash fracture': 1, 'maladie coelique': 1, 'clunking of the scapula': 2, 'Scapulae asymmetry': 1, 'aneurysmal cyst of the scapula': 1, 'fractures of the scapula or spine': 1, 'resection of the scapula': 1, 'Resection of the scapula': 1, 'displacement of scapula': 1, 'fracture scapula': 3, 'decreased external rotation of the scapula': 1, 'La maladie de Lafora': 1, "Congenital high scapula (Sprengel's) deformity": 1, 'scapula-humeral dyskinesia': 1, '-winging of Scapula': 1, 'pseudo-winging of scapula': 3, 'scapula-thoracic dissociation': 2, 'Reseau sida et maladies infectieuses': 1, 'fractures of upper limb, including clavicle and scapula': 1, 'dysplastic and undescended scapula': 1, 'hypoplastic rotated scapula': 1, 'dysplastic scapulas': 1, 'misalignment of the scapula': 1, 'Dyskinesia of the scapula': 3, 'defect of dorsal scapula': 1, 'fracture of the scapula and clavicle': 1, 'systemic maladies': 1, 'maladie de Kaincope': 1, 'Maladie Dermatophytique': 1, 'maladie causee': 1, "Sprengel's shoulders": 1, 'fracture of the inferior right scapula': 1, 'tuberculous ostitis of the scapula': 1, 'asymmetry of the scapula': 2, 'snapping in scapula': 1, 'scapula and clavicle fractures': 6, 'scapulae asymmetry': 2, 'medial rotation of the scapula': 1, 'benign lesions of the scapula': 1, 'cerebral maladies': 1, 'HD': 1, 'fracture of the acromion or scapula': 1, 'adducted scapula': 2, 'maladie intestinale inflammatoire': 2, 'Spina-scapula': 1, 's scapula alata': 1, 'Etre Familiale': 1, 'of bilateral scapula': 1, 'CASE OF SPRENGEL': 1, 'maladies febriles': 1, 'maladies infectieuses et': 4, 'acromial and scapula fractures': 2, 'acromial or scapula spine fractures': 1, 'snapping scapula syndrome of': 1, 'maladies of Syndrome X': 1, 'Acquired scapula alata': 1, 'Maladies infectiouses': 1, 'maladie est cutanee': 1, 'maladie hydatique pulmonaire': 1, 'ONMNE': 1, 'underdeveloped scapula': 1, 'maladie veineuse thromboembolique': 1, 'Hypoplasia of the glenoid neck of the scapula': 1, 'lesions involving the scapula': 1, 'fractures of the thoracic spine, extremities, scapula, and clavicle': 1, 'Injuries to the scapula': 1, "Sprengel's Shoulder": 1, 'maladies renales chroniques': 1, 'fracture of the scapula, clavicula': 1, 'fracture of scapula, clavicle, or sternum': 1, 'fracture of the scapula, clavicle, or sternum': 1, 'fractures of the scapula, clavicula, or sternum': 1, 'maladie obstructive': 1, 'lesions of the right scapula': 1, 'hypermobility of the scapula': 1, 'dysplasia of the scapula': 2, 'fractures of the scapula or clavicle': 1, 'tumor at the scapula': 1, 'Sprengel deformity of the shoulders': 1, 'sprengel-deformity': 1, 'Left scapula': 1, 'maladies infectieuses tropicales': 2, 'osteomyelitis of the scapula': 3, 'hematogenous osteomyelitis of the scapula': 1, "maladie hereditaire de l'hemoglobine": 1, 'GLENOID CAVITY OF THE SCAPULA': 1, 'cryptococcal osteomyelitis of the scapula': 1, 'maladie T1': 1, 'maladie trophoblastique persistante ulterieurement': 1, 'weakness of the scapula stabilizers': 1, 'Sprengel deformity of scapula': 2, 'tumors of the clavicle and scapula': 1, 'syndrome of the angular of the scapula': 1, 'fracture of the middle third of the clavicle and scapula': 1, 'Scapula involvement': 1, 'Fractures of the scapula and': 2, 'reciprocal scapula fracture': 1, 'congenitally elevated scapula': 1, 'maladies renales hereditaires': 1, 'valgus scapula': 1, 'of scapula apophysis': 1, 'detachment of the scapula': 1, 'SNIIRAM': 1, 'clavicle, scapula': 1, 'familial maladies': 1, 'dysthyroidie familiale': 1, 'duplication of their right scapula': 1, 'mass under the scapula': 1, 'hypoplasia of scapula': 1, 'couverture maladie universelle complementaire': 1, 'winged scapula (scapula alata)': 1, 'spine of scapula fractures': 1, 'superior and lateral migration of the scapula': 1, 'dorsal scapula entrapment': 1, 'medecine familiale': 1, 'schwannoma of the scapula': 1, 'scapula/glenoid fracture': 1, 'maladie de Parkinson idiopathique': 1, 'right scapula prolapse': 1, 'Scapula prolapse': 1, 'Scapula dyskinesia': 1, 'MV': 1, 'maladie etait': 1, 'abducted scapulae': 1, 'scapula callus defect': 1, 'maladie hansenienne': 1, 'congenital elevation of the left scapula': 1, 'malady of hipp-libbi': 1, 'Sprengel deformity of': 1, 'Sprengel deformity of the right scapula': 1, 'agenesis of the ala of scapula': 1, 'injury to the scapula': 1, 'problems of the scapula': 1, 'congenital undescended scapula syndrome': 1, 'undescended scapula syndrome': 1, 'fractured right-scapula': 1, 'despair-related maladies': 1, 'maladie bronchique': 1, 'maladie de Turner': 1, 'Mascot malady': 1, 'lateral displacement of the left scapula': 1, 'Static winging scapula': 1, 'scapula.[5': 1, 'Maladie renale': 1, "maladies de l'hemoglobine": 1, 'maladie de Haglund': 2, 'maladie de systeme': 1, 'maladie-': 2, 'left scapulae fracture': 1, 'maladie autosomique': 1, "sprengel's deformity of scapula": 1, 'developmental abnormality of the scapula': 2, 'Flying scapulas': 2, 'scapula non-unions': 1, 'clavicle/scapula fracture': 1, "sur l'assurance maladie": 1, 'Osteocutaneous Scapula': 1, 'transverse ligament of scapula': 1, 'fractures of digits, scapula, or sternum': 1, 'fracture(s) of the scapula, sternum, digit': 1, 'fractured clavicle or scapula': 1, 'maladie systemique': 2, 'maladie de Still de l enfant': 1, 'scapula-thoracic dyskinesia': 1, 'Bilateral synostosis of seventh rib and scapula': 1, 'scapula nonunion': 1, 'high dysplasia': 1, 'scapulae and': 1, 'dyskinetic scapulae': 1, 'Dyskinetic scapulae': 1, 'syndrome de la maladie euthyroidienne': 1, 'multiple - maladie de Kaposi': 1, "maladie de Kaposi precede l'hemopathie": 1, 'ces maladies': 1, 'coracoid fracture of the scapula': 1, "Antiochus' malady": 1, 'fracture of the ipsilateral clavicle, scapula, coracoid process,': 1, "depenses de l'assurance maladie": 1, 'Myxofibrosarcoma of the left scapula': 1, 'Cette maladie hereditaire': 1, 'Scapula rotation': 1, 'fractura scapulae': 1, 'bone involvement of the scapula': 1, 'Scapula shorter': 1, 'Fractures of both scapulae': 1, 'congenital asymmetric high scapula': 2, 'maladies mitochondriales': 1, 'fractured scapula and': 1, 'pattern I scapula dyskinesis': 1, 'arthritic scapulae': 1, 'Les maladies de systeme': 1, 'spine of scapula': 2, 'Congenital evaluation of the scapula': 1, 'or scapula': 1, "Sprengel's deformity diorthosis": 1, 'scapula-humeral weakness': 1, 'hip and scapula': 1, 'SAT scapula dysfunction': 1, 'SDT scapula dyskinesia': 1, 'Scapula Dyskinesia': 2, 'Bone remodelling of the scapula': 1, 'impingement of scapula': 1, 'Fracture scapula': 1, 'Chondromyxoid fibroma of scapula': 1, 'osteolytic lesions in the scapula': 1, 'process of the scapula': 1, 'soins-et-maladies': 1, 'acromion fractures of the scapula': 1, 'transverse scapula fracture': 1, 'fracture to blade of scapula': 1, 'transverse fracture of the scapula': 1, 'maladie hydatique cerebrale': 1, 'malady of Naples': 1, 'maladie parasitaire tropicale': 2, 'congenital scapula alata': 1, 'scapula abnormalities': 1, 'maladie trophoblastique': 1, 'elevated scapula-scapula elevata': 1, 'vraie maladie': 1, 'pseudowinged scapula': 1, '" of the scapula': 1, 'winged left scapula': 1, 'pseudowinging of the scapula': 2, 'maladies-tropicales-negligees': 1, 'scapula muscles': 1, 'Fascio- scapula humeral muscular dystrophy': 1, 'fractures of scapula body': 1, 'glenoid cavity fractures of the scapula': 1, 'complex scapula fracture': 1, 'infraspinous fracture of the scapula': 1, 'Tuberculous osteomyelitis of the sternum and scapula': 1, 'hypoplasic scapulae': 1, 'maladie granulomateuse chronique': 1, 'IAS': 1, 'DYSMORPHISM OF THE SCAPULA': 1, 'maladies des os': 1, 'pillar of scapula': 1, 'scapula and ipsilateral clavicle fractures': 1, 'kudu scapula': 1, "maladie de pompe de l'adulte": 1, 'Bilateral congenital elevation of the scapula': 1, 'fractures of the clavicle and the scapula': 1, 'maladie serait': 1, 'Cette maladie emergente': 1, 'maladie foudroyante': 1, 'maladie X': 1, 'MAP': 1, 'maladie arterielle peripherique': 1, 'Clavicle or scapula fracture': 2, 'scapula bone destruction': 1, 'Necrosis of Scapula': 1, 'lesion in the scapula': 1, 'abnormalities in the scapulae and shoulders': 1, 'deformity of the right scapula': 1, 'tumor-like lesions of the scapula': 1, 'PCM': 1, 'paludisme congenial maladie': 1, 'congenital maladie': 1, 'paludisme congenital maladie': 1, "autres maladies de l'erythropoiese": 1, 'fracture the scapula': 1, 'maladies americains': 1, 'leaf maladies': 1, 'L scapula': 1, 'Fracture-dislocation of the scapula': 1, '-nouvelle-maladie-laisse-parfois': 1, 'Mondor malady': 1, 'Maladies Diarrheiques': 1, 'or tipped scapula': 1, 'dorsal scapula fistula': 1, 'DULM': 1, "Maladies osseuses de l'enfant": 1, 'parosteal lipoma of scapula': 1, 'Parosteal Lipoma of Scapula': 1, 'scapula foramina': 1, 'foramens of the scapula': 1, 'immune maladies': 3, 'JDS': 1, 'defect of the joint depression of scapula': 1, 'pagetoid scapula': 1, 'maladies gastroduodenales': 1, 'spine or scapula': 1, 'febrile maladies': 1, 'displaced fracture of acromion process of scapula': 1, 'congenital elevation of the scapula) anomalies': 1, "Sprengel's deformity of the scapula": 1, 'Maladie vasculaire peripherique': 1, 'left scapula fractures': 1, 'Sterkfontein scapula': 1, 'sexual maladies': 1, 'Instability of the scapula': 2, 'fractures of the sternum, clavicle and scapula': 1, 'fractures of the scapula and foot': 1, 'foramina in the scapula': 1, 'osteomyelitis of the scapula and humerus': 1, 'leur maladie': 1, 'dyslipidemie familiale': 1, 'Scapula 3': 4, 'Clavicle and scapula fracture': 1, 'CASE OF POST-TRAUMATIC SCAPULA ALATA': 1, 'knee and scapula deformity': 1, 'Fractures of the acromion and scapula': 1, 'RADIODIAGNOSIS OF THE SCAPULA': 1, 'Bacterial osteomyelitis of the scapula': 1, 'Scapula damage syndrome': 1, 'Excised scapula': 2, 'ipsilateral scapula pain': 1, "Chopin's malady": 1, 'rotator disability of the scapula': 1, 'deformations of the clavicula, scapula, ribs': 1, 'Tumors of the femur, humerus and scapula': 1, 'fracture of the body of scapula': 1, 'maladie hepatique cholestatique': 1, 'malfunction of the scapula': 1, 'Tumor of the scapula': 1, 'deformity in the right scapula': 1, "Sprengel's sedge": 1, 'bony impingement of the scapula': 1, 'maladie complexe': 1, 'scapula-thoracic weakness': 1, 'maladie coronarienne obstructive': 1, 'Abnormal scapula motion': 1, 'Myriad maladies': 1, 'of the acromion process of the scapula': 1, 'hypoplasia of the iliac wings and scapulae': 1, ', scapula, and dental alveolar fractures': 1, 'maladies nerveuses': 1, 'maladie de Devic': 1, 'MVTE': 1, 'maladies veneriennes': 1, 'Fracture of the inferior angle of the scapula': 1, 'maladie onchocerquienne': 1, 'maladie mysterieuse': 1, "Sprengel's deformity of the left scapula": 1, 'Neurodevelopmental Maladies': 1, 'Solitary scapula mass': 1, "Maggie's maladies": 1, 'maladie familiale': 1, 'Congenital High-Scapula': 1, 'hypoplasia of clavicles, scapulae and pubis': 1, 'rotation scapula': 1, 'Intraosseous pneumatocyst of the scapula': 1, 'intraosseous pneumatocyst of the scapula': 1, 'high scapula deformity': 1, 'clavicle/scapula': 2, 'winged scapula and': 1, 'maladie anevrismale': 1, 'Paralytic scapula vara': 1, 'maladies de la faune': 1, 'of the scapula or': 1, 'acromion and scapula fractures': 1, 'BSD': 1, 'maladie respiratoire infectieuse': 1, 'darn scapula': 1, 'transversum scapulae superius': 1, 'scapula or vertebrae fractures': 1, 'Maladies Lysosomales': 1, 'dry scapulae': 1, 'VD of type (III) of left male scapulae': 1, 'scaphoid, metacarpal, and scapula fractures': 1, 'MPE': 1, 'Maladie de la Feuille Cassante': 1, 'maladies leucocytaires': 1, 'maladie leucemogene': 1, 'scapula osteomyelitis': 1, 'Osteomyelitis of Scapula': 2, 'congenital deformity of the scapula': 1, 'Osteomyelitis of scapula': 1, 'maladie renale terminale': 1, 'Rseau sida et maladies infectieuses': 1, 'eye maladies': 2, 'classification Internationale des maladies': 1, 'I. scapula': 1, 'maladies de lourelle': 1, 'cyst of the scapula': 1, 'Brucellotic osteomyelitis of ilium and scapula': 1, "maladies emergentes dans l'ocean": 1, 'fractures of the acromion and the spina scapulae': 1, 'CMU-C': 1, 'AMO': 2, 'l assurance maladie': 1, 'bony dysplasia of the scapula, glenoid, or humerus': 1, 'RECONSTRUCTION OF THE SCAPULA': 1, 'rotation of scapula': 1, 'upward rotation of the scapula': 1, 'maladie vasculaire intestinale': 1, 'maladies infectieuses banales': 1, 'scapula diseases or deformity': 1, 'developmental deformities of the scapula': 1, 'fractures around the scapula': 1, 'SMAS': 1, 'disability of the scapula': 1, "Blackburn's scapula": 1, 'the scapulas': 1, 'maladies de la peau': 3, 'dyskinesis of the scapula and clavicle': 1, 'maladies of the mind': 1, 'scapula and elbow dislocations': 1, 'absence of scapulae and ilia': 1, 'MMC': 1, 'multiples maladies chroniques': 1, 'maladie de Castleman multicentrique': 1, 'AFFECT WINGED SCAPULA': 1, 'Osteotomy of the scapula': 1, 'acromia of the scapulae': 1, 'CMME': 1, 'dysplastic scapula and humerus': 1, 'primary hemangioma of the scapula': 1, 'scapula hemangioma': 1, 'CONGENITAL ELEVATION OF THE SCAPULA': 1, 'ASF': 1, 'Sprengel scapular anomaly': 1, 'Bilateral scapula fractures': 1, "maladie des l'enfance": 1, 'grating scapula': 1, 'Snapping or grating scapula': 1, 'CIM-10-MC': 1, 'maladie nouvellement diagnostiquee': 1, 'degenerative changes of the scapula': 1, 'Cette maladie tropicale': 1, 'maladies des systeme nerveux': 1, 'maladie invalidite': 1, ', clavicle, scapula, sternum': 1, 'Centre europeen de maitrise des maladies': 1, 'the scapula lata': 1, 'scapula lata': 1, 'scapula, sternum': 1, 'clavicle, scapula, sternum': 1, 'Recalcitrant SSS': 1, 'deformed scapulas': 1, 'Undescended (Sprengel deformity)-9': 1, 'maladie infectieuse courante': 1, 'fractures of the clavicle, scapula,': 1, 'deviation of the scapula': 1, 'CMU-': 1, 'malady of': 1, 'maladies pulmonaires obstructives': 1, 'SL': 1, 'proximal humerus or scapula': 1, 'pelvic, sternum and scapula fractures': 1, 'pelvic, scapula, and sternum fractures': 1, 'congenital deformities of the humerus and/or scapula': 1, 'nervous malady': 1, 'musculotendinous maladies': 1, 'maladies autoimmunes': 1, 'MII': 1, 'Malpractice malady': 1, 'fracture of right clavicle and scapula': 1, 'ageing maladies': 1, 'pagoda deformity of the scapula': 1, 'Fracture of the axillary margin of the scapula': 1, 'bilateral dysplasia of the neck of scapula': 1, 'Bilateral dysplasia of the neck of scapula': 1, 'pseudo-winging and snapping scapula syndrome': 1, 'Pseudo-winging and snapping scapula': 1, 'winged right scapula': 1, 'or tipping scapulas': 1, 'scapula tilt': 2, 'lateral rotation of the scapula': 1, 'General malady': 1, 'dysKinesis of scapular movement) scapula': 1, 'maladie immunitaire': 1, 'congenital hypoplasia of the glenoid neck and fossa of the scapula': 1, 'LB malady': 1, 'gunshot fractures of the scapula': 1, 'SSD': 1, 'Parosteal lipoma of the scapula': 1, 'abnormalities of the scapulae': 1, 'Fracture of the process of the scapula': 1, 'maladie vasculaire atherosclereuse': 1, 'maladie cardiovasculaire atherosclereuse': 1, 'MCVAS': 1, 'CHONDROMYXOID FIBROMA OF THE SCAPULA': 1, 'malformation of scapulae': 1, 'MALADIES OF': 1, 'haemoglobin maladies': 1, 'dislocation der scapula': 1, 'winged" scapula': 1, 'scapula hypoplastic': 2, 'and rotation of the scapula': 1, 'maladie appelee': 1, 'congenital elevation-Sprengle deformity of the scapula': 1, 'epileptic malady': 1, 'Maladies emergentes': 1, 'Damaged scapulae': 1, 'malformations in the spine, scapulae and/or ribs': 1, 'malady of powerlessness': 1, 'Fractures of the growing scapula': 1, 'dry scapulas': 1, 'protruding scapula': 1, 'aclassic hand anomaly with high scapula': 1, 'bowed scapula': 1, 'Scapula Mammary carcinoma': 1, 'maladie de Recklinghaussen': 1, 'maladie neurovasculaire': 1, 'nerfs et de leur maladies': 1, 'Cryptococcal osteomyelitis of the scapula and rib': 1, 'high scapula syndrome': 1, 'Sarcoma of the Scapula': 1, 'dysfunctions of the scapula': 1, 'scapula mass': 1, 'maladies hereditaire': 1, 'traumatic winging of the scapula': 1, 'Multifocal Scapula Fracture': 2, 'histoire familiale de syndrome hemorragique': 1, 'hypoplastic scapulas': 1, 'cramping inferior to the scapula': 1, 'autoimmune malady of the': 1, 'vitamin deficiency malady': 1, 'Anomaly of the scapula': 1, 'body-mind malady': 1, 'maladies multiples': 1, 'maladies contagieuses': 1, 'distortion of scapula and pubis': 1, 'benign tumor of scapula': 1, 'left winged scapula': 1, 'deficient rotation of the scapula': 1, 'scapula and': 1, 'Non comprehension de la maladie': 1, 'Glenoid of scapula': 1, 'Scapula elevata': 1, 'Retroversion of the scapula': 1, 'hyperostosis of the scapula': 1, 'scapula impingement': 1, 'pain around the scapula and wrist': 1, 'extra-neural maladies': 1, 'CHS': 1, 'sprengel anomaly of left scapula': 1, 'RAMA': 1, 'maladie parodontale': 1, 'scapula and chest': 1, 'injury to the scapula, clavicle': 1, 'Cette maladie a': 1, 'Scapulopexy of winged scapula': 1, 'deformity of the spine, ribs, clavicle, or scapula': 1, 'Primary winged scapula': 1, 'traumatic winging of scapula': 1, 'RAMQ': 1, 'Couverture Maladie': 1, 'high-riding scapula': 1, 'floral malady': 1, 'fibroma of the scapula': 1, 'dystopia spina scapulae': 1, 'margo cranialis scapulae': 1, 'abnormality on the left scapula': 1, 'Tip of the scapula': 1, 'maladie somatique': 1, 'fractures of the clavicle, scapula, and': 1, 'maladie inflammatoire pelvienne chronique': 1, 'abnormalities of the trunk, shoulder and scapula': 1, 'deviated scapula': 1, 'maladies chroniques non': 1, 'sclerotic lesion of the scapula': 1, 'dislocated fracture of the scapula column and glenoid': 1, 'maladies des': 2, 'displacement of the left scapula': 1, 'Scapula with': 1, 'Haemangiosarcoma of the scapula': 1, 'fracture of right scapula': 2, "maladie de l'endothelium": 1, "maladies de l'Oesophage": 1, 'Societe americaine de maladie infectieuse': 1, 'inferior scapulae': 1, 'of vertebral column and scapulae': 1, 'malformed scapulae': 1, 'pterygoid scapulae': 1, 'clavicle scapula': 1, 'Tubercular Osteomyelitis of Scapula': 1, 'tumors of scapula': 2, 'tubercular osteomyelitis of scapula': 1, 'maladie disseminee': 1, 'douleur maladie': 1, 'destruction of scapula': 1, 'thoracic spine or scapula fracture': 1, 'scapula and thoracic spine fractures': 1, 'depression of scapula': 2, 'Scapula 5': 1, 'maladie periodique associee': 1, 'maladie de Graves': 1, "Becker's Sprengel deformity": 1, 'elevated and rotated scapula': 1, 'CMNM': 1, '-maladies-neuromusculaires': 1, 'quebecois des maladies orphelines': 1, 'sleep maladies': 1, 'Avulsion of the Right Arm and Scapula': 1, 'fractures of the scapula, clavicle and sternum': 1, 'maladie de sachs': 1, 'de la maladie': 1, 'maladie renale diabetique': 1, 'I scapulae': 1, "'floral malady'": 1, 'Incarceration scapula': 1, 'spine of scapula fracture': 1, 'Scapula Myxoid': 1, 'ST': 1, 'scapula hump': 1, 'hypoplasia of the clavicle and scapula': 1, 'distal clavicle and scapula': 1, 'fractures of the acromion, clavicle, scapula': 1, 'scapula and elbow': 1, 'maladie de Hirschsprung': 1, "l'assurance-maladie": 1, 'scapulae tilt': 1, 'ScA': 1, 'scapulae rotation': 1, 'pterygoid scapula': 1, 'Fractures of the acromion process of the scapula': 1, 'maladie au cours': 1, 'Scapula spine fractures': 1, 'fractures of the clavicle, scapula, or sternum': 1, 'Nephropathie familiale': 1, 'shortening of the scapula': 1, 'right scapula': 1, 'SA-': 1, 'SA-Q': 1, 'SA condition': 1, 'subscapular hemangioma of the scapula': 1, 'pseudo winging of scapula': 1, 'benign lesions of scapula': 1, 'maladie interstitielle pulmonaire': 1, 'Scapula acromion coracoid': 1, 'Pseudowinging of the scapula': 1, 'traction apophysitis of the acromion process of the scapula': 1, 'scapula pro': 1, 'anterior tilt of the scapula': 1, 'maladi kalkilasyon': 1, 'fractures of other parts of the scapula': 1, 'maladie gelatineuse': 1, 'maladie causale': 2, 'deformities of the scapula': 1, 'osteomyelitis of scapula': 1, 'bifocal osteomyelitis of scapula and tibia': 1, 'fracture(s) of the scapula or sternum': 1, 'maladie animale': 1, 'coordinative dysfunction of the scapula': 1, "L'acropathie ulcero-mutilante familiale": 1, 'maladie de Still de': 1, 'fracture of the clavicle and the scapula': 1, 'maladies diseases': 1, 'fracture lesions of the scapula': 1, 'scapula muscle overgrowth': 1, 'Nariokotome scapula': 1, 'and scapula fractures': 1, 'maladie multifactorielle': 1, 'scapula dislocation': 1, 'syndromic malady': 1, 'asymmetry of scapula': 1, 'maladie de Carre virus': 1, "maladie inflammatoire chronique de l'intestin": 1, 'scapula-thoracic dysfunction': 1, 'Granuloma of the Scapula': 1, 'maladies pericardiques': 1, 'indemnisation maladie': 1, 'impairment of the scapula': 1, 'articular maladies': 1, 'Elastofibroma of scapula': 1, "' assurance maladie": 1, 'maladie des conserves': 1, 'maladies des reins': 1, 'snapping of scapula': 1, 'Painful Pseudowinging and Snapping of Scapula': 1, 'pseudowinging and snapping scapula syndrome': 1, 'snapping and pseudowinging of scapula': 1, 'Collum scapulae': 1, 'SMI': 1, 'maladies nouvelles et emergentes': 1, 'behavioral and physical maladies': 1, 'aplastic scapulae': 1, 'Ideberg I A fracture of the scapula': 1, 'Spinal maladies': 1, 'left Sprengel deformity': 1, 'papular eruption of the scapula': 1, 'carcinoma of the left scapula': 1, 'MTE': 1, 'scapula and humerus': 1, 'scapula body linear fracture': 1, 'anorexic maladies': 1, 'tumor of scapula': 1, 'assurance maladie obligatoire': 1, 'decalcification of scapulae': 1, "Regiel'assurance maladie": 1, 'maladie de Willebrand': 1, 'maladie de Willebrand diagnostiquee': 1, 'MW': 1, 'maladie de Willebrand (type 1)': 1, 'maladies infectieuses et emergentes de': 1, 'deformity in the scapula or proximal humerus': 1, 'rebbachisaurid scapula': 1, 'psychopathological maladies': 1, 'Dolabella scapula': 1, 'Primary tumors of the scapula': 1, 'lytic lesions of scapula': 1, 'injury to the right scapula': 1, 'rotatory movements of the scapula': 1, 'cleft scapula': 1, 'Congenital cleft scapula with type V ulnar longitudinal deficiency': 1, 'truncate scapula': 1, 'scapula malformation': 1, 'malformed scapula': 1, 'scapula malformations': 1, 'Malformation to the scapula': 1, 'CONGENITAL ELEVATION OF THE SCAPULAE': 1, 'apophysis of processus coracoideus scapulae': 1, 'maladie renale preexistante': 1, 'Excision of scapula': 1} | maladie |
Disease | MESH:C535803 | {'succinic semialdehyde dehydrogenase deficiency': 172, 'cPHB': 1, 'Succinic semialdehyde dehydrogenase deficiency': 80, 'SSADHD': 54, 'HPHB': 1, 'SSADH-D.': 3, 'SSADH-D': 5, 'GHB': 189, 'GHB dependence': 16, 'GHB use disorder': 11, 'GHB withdrawal syndrome': 17, 'GHB withdrawal symptoms': 9, 'GUD': 5, '4-hydroxybutyric aciduria': 56, '4-hydroxybutyricaciduria': 3, 'GVG': 2, 'deficiency of succinic semialdehyde dehydrogenase': 11, 'succinic semialdehyde dehydrogenase deficiencies': 2, 'GABA aminotransferase deficiency': 1, 'BDH': 5, 'AHB': 2, 'Succinic Semialdehyde Dehydrogenase Deficiency': 21, 'SSADH deficient': 12, 'SSADH deficiency': 160, 'of succinic semialdehyde dehydrogenase': 1, 'SSADH': 18, 'Succinic semialdehyde dehydrogenase (SSADH) deficiency': 48, 'GHB addiction': 7, '4-Hydroxybutyl aciduria': 1, '4-hydroxypropiophenone aciduria': 1, '4-hydroxybutyrate acidemia': 1, 'GABA withdrawal syndrome': 7, 'GWS': 8, 'epileptiform GWS': 1, 'GABA': 67, 'succinic semialdehyde dehydrogenase (SSADH) deficiency': 56, 'ALPHA-HYDROXYBUTYRATE': 3, 'VERSATILITY OF POLY-4-HYDROXYBUTYRATE': 1, 'SSADH-deficient': 33, 'succinate semialdehyde dehydrogenase (SSADH) deficiency': 10, '4-Hydroxybutyric aciduria': 10, 'deficiencies in SSADH': 1, 'SSADH Deficiency': 14, 'GABA paraneoplastic': 1, 'inherited gamma-hydroxybutyric aciduria': 1, 'GHB toxicity': 6, 'GHB abuse': 28, 'GHB Dependence': 1, 'gamma-hydroxybutyric aciduria': 42, 'SSADH deficiency disorder': 1, 'VGAT': 1, 'GHB overdose': 20, 'GHB withdrawal': 14, 'COMPARISON OF GAMMA-HYDROXYBUTYRATE': 1, 'GHB overdoses': 5, 'GHB drop': 1, 'GHB-withdrawal syndrome': 2, 'GABA deficiency': 18, 'GHB dependency': 1, 'GABA-withdrawal syndrome': 6, 'SSAD deficiency': 1, 'Deficiency of SSAD': 1, 'GHB-dependence': 1, 'SSA dehydrogenase deficiency': 1, 'SSDH': 1, 'succinic semialdehyde deficiency': 3, 'SSA': 2, 'Succinic semialdehyde dehydrogenase (SSADH; EC 1.2.1.24) deficiency': 1, 'succinic semialdehyde dehydrogenase deficiency;3-HMG': 1, 'HYDROXYBUTYRIC ACID': 3, 'HYDROXYBUTYRIC': 2, 'GAMMA-HYDROXYBUTYRIC': 6, '4-AMINO-3-HYDROXYBUTYRIC': 1, 'GABA neuron': 2, 'GABA metabolism': 1, 'succinic semialdehyde dehydrogenase': 9, 'gamma-hydoxybutyric aciduria': 3, 'GAD': 1, 'GABA dysfunction': 13, 'Succinate semialdehyde dehydrogenase': 1, 'SODIUM 4-HYDROXYBUTYRATE': 5, 'Succinic semialdehyde dehydrognase deficiency': 1, 'BOHB': 2, 'GHB aciduria': 5, 'HBDH abnormalities': 1, 'GAMMA-HYDROXYBUTYRIC ACID': 2, 'GABA system dysfunction': 1, 'GABA SYSTEM': 1, 'GHB poisoning': 8, 'DH': 1, 'Succinate semialdehyde dehydrogenase (SSADH) deficiency': 1, 'deficiency of SSADH': 2, 'GABA-T deficiencies': 1, 'GABA deficiency diseases': 1, 'GABA-ERGIC INHIBITION': 1, 'bHB': 1, 'BHB': 4, 'deficient for SSADH': 1, 'SSADH deficiencies': 2, 'gamma-hydroxybutyric addiction': 1, '1 , 2 SSADH deficiency': 1, 'HB': 7, 'hydroxybutyric aciduria': 2, 'HBD': 1, 'succinate semialdehyde dehydrogenase deficiency': 16, 'ALPHA-HYDROXYBUTYRIC': 6, 'Succinic Semialdehyde Dehydrogenase (SSADH) deficiency': 1, 'SUCCINATE-SEMIALDEHYDE DEHYDROGENASE': 1, 'SUCCINATE-SEMIALDEHYDE': 1, 'GABA-A deficit': 1, 'GABA deficit': 2, 'GABA hypofunction': 8, 'MSNs': 1, 'gamma-hydroxybutyric [GHB] aciduria': 1, 'Succinic semialdehyde dehydrogenase (EC 1.2.1.24) deficiency': 1, 'BEHAVIORAL EFFECTS OF GAMMA-HYDROXYBUTYRATE': 1, 'WITH SODIUM 4-HYDROXYBUTYRATE': 1, 'USE OF SODIUM 4-HYDROXYBUTYRATE': 1, 'succinic semialdehyde dehydrogenease (SSADH) deficiency': 1, 'HBUT': 1, 'GABA-Withdrawal Syndrome': 1, 'succinic semialdehyde dehydrogenase (EC 1.2.1.24) deficiency': 1, '4-hydroxybutyric acidemia': 1, 'GABA neuropathies': 1, 'Deficiency of SSADH': 3, 'GAMMA-SODIUM HYDROXYBUTYRATE': 1, 'SSADHD deficiency': 1, 'P4HB': 9, 'GHB-deficiency': 1, 'BOH': 1, 'GABA-related disorders': 2, 'GABA-associated disorders': 1, 'INCREASED GABA RELEASE FROM INTERNEURONS': 1, 'Succinic semialdehyde dehydrogenase': 7, 'Deficiency of SSD': 1, 'SSD': 1, 'succinate semialdehyde dehydrogenase': 1, 'GABA-ergic dysfunction': 2, 'GHB intoxication': 9, 'SSDHD': 1, 'Succinic semialdehyde dehydrohenase deficiency': 1, 'G-TASTE': 1, 'Succinic semialdehyde deficiency': 1, 'PV': 1, 'Succinic Semialdehyde Dehydrogenase (SSADH) Deficiency': 2, 'ALPHA-HYDROXYBUTYRATE DEHYDROGENASE': 1, 'n-HBDH': 1, 'h-HBDH': 1, '4-hydroxybutyric acid-uria': 1, 'GABA transporters': 1, 'GHB-withdrawal': 1, 'GHB use disorders': 2, 'GHB dependence syndrome': 1, 'Succinic semialdehyde dehydrogenase (SSADH) deficient': 1, 'P4HB infection': 2, 'ALPHA-HYDROXYBUTYRIC ACID DEHYDROGENASE': 1, 'BETA-HYDROXYBUTYRATE': 2, 'GHB poisonings': 1, 'SSR': 1, 'deficiency of GABA A receptors': 1, 'USE OF SUCCINIC SEMIALDEHYDE DURING SEVERE COMAS': 1, 'disorders of GABA,': 1, 'THERAPEUTIC TRIALS OF SUCCINIC SEMIALDEHYDE IN': 1, 'Murine Succinate Semialdehyde Dehydrogenase Deficiency': 1, '4-Hydrozybutyric Aciduria': 1, 'SSADHD.39': 1, 'GABA interneuron deficiency': 1, 'autosomal recessive deficiency of succinic semialdehyde dehydrogenase': 1, 'GABA receptor': 2, 'SODIUM HYDROXYBUTYRATE': 1, 'Canine Succinic Semialdehyde Dehydrogenase Deficiency': 1, 'succinic semialdehyde dehydrogenase (NAD+) (SSADH) deficiency': 1, 'SSADH enzyme deficiency': 2, 'GB': 2, 'SGRI': 1, 'BHBA': 1, 'GAMMA HYDROXYBUTYRATE': 1, 'sIPSCs': 1, 'GHB Use Disorder': 1, 'GHB withdrawal syndrome symptoms': 1, 'Gamma-hydroxybutyric aciduria': 3, 'inborn error of GABA metabolism': 2, 'autosomal-recessive succinic semialdehyde dehydrogenase deficiency': 1, 'GABA-ACTION': 1, '4-hydroxybutyric (gamma-hydroxybutyric, GHB) aciduria': 1, 'SSADH deficiency disease': 2, 'GABA RELEASE': 2, 'GABA-MEDIATED': 1, 'MSN': 1, 'SSH': 1, 'SSH deficiency': 1, 'HGFM': 1, 'disorder of GABA': 1, 'SUCCINIC SEMIALDEHYDE': 3, 'Succinate-semialdehyde dehydrogenase (SSADH) deficiency': 1, 'gamma-Hydroxybutyric acidemia': 1, 'SSADHD syndrome': 1, 'HBDH': 1, 'GABA Dysfunction': 1, 'SSADH (succinic semialdehyde dehydrogenase) deficiency': 1, 'Deficiency of succinate semialdehyde dehydrogenase': 1, 'deficiency of GABA': 1, 'GHB-abuse': 1, 'inborn errors of GABA metabolism': 1, 'GABA-T deficiency': 2, '4-hydroxybutyric (GHB) aciduria': 1, '4-Hydroxybutyric Aciduria': 1, 'GABA-transferase deficiency': 1, 'HH': 1, 'SSAD': 1, '4-hydroxybutyric and dicarboxylic acidurias': 1, 'GHB intoxication injury': 1, 'GABA neuron defects': 1, 'gamma-hydroxybutyric (GHB) aciduria)': 1, 'GABA transmission': 1, 'GABA-ATs': 1, 'ACUTE TOXICITY OF SUCCINIC SEMIALDEHYDE': 1, 'GHB-use disorders': 1, 'GABA neuron dysfunction': 5, 'HYDROXYBUTYRATE': 2, 'BETA-HYDROXYBUTYRIC': 1, 'BHBT': 1, '4-Hydroxybutyricaciduria': 1, 'GABOB': 2, 'GAMMA-AMINO-BETA-HYDROXYBUTYRIC ACID': 3, 'Autosomal deficiency of SSADH': 1, 'GHB Withdrawal Syndrome': 1, 'HYDROXYBUTYRATE BY': 1, 'Succinate semialdehyde dehydrogenase deficiency': 1, 'Dependence on GHB': 1, 'Inherited succinic semialdehyde dehydrogenase (SSADH) deficiency': 1, 'GABA deficiencies': 1, 'Epilepsy GABA GPCRs': 1, 'Succinic Semialdehyde Dehydrogenase Deficiencya': 1, 'deficiency of GABA(A) receptor': 1, 'ultra-rare succinic semialdehyde dehydrogenase deficiency': 1, 'GABA abnormalities': 1, 'Succinic Semialdehyde dehydrogenase deficiency': 1, 'GABA(A)ergic dysfunction': 1, 'OBSTETRICAL ANESTHESIA WITH 4-HYDROXYBUTYRIC ACID': 1, 'succinate semialdehyde dehydrogenase (SSADH; EC1.2.1.24) deficiency': 1, 'succinate semialdehyde dehydrogenase (SSADH;': 1, 'FMG': 1, 'GHB-dependent': 1, 'GABA underactivity': 1, 'GABA receptors': 1, 'gamma-hydroxybutyric (GHB) aciduria': 1, 'SSADH-deficient human': 1, 'SSADH (Aldh5a1) deficiency': 1, 'gamma-hydroxybutyric (GHB) aciduria) deficiency': 1, 'betaHB': 1, 'SSADH; aldehyde dehydrogenase 5a1, ALDH5A1) deficiency': 1, 'TREATMENT OF GHB INTOXICATION': 1, 'GHB-': 1, 'ACUTE GHB INTOXICATION': 1, 'SSADH Deficient': 1, 'SSADH-deficiency': 1, 'deficiency in SSA dehydrogenase': 1, 'SSADHD disorder': 1, 'Succinate Semialdehyde Dehydrogenase Deficiency': 1, 'Succinic semialdehyde dehydrogenase (': 2, 'GHB addicts': 1, 'GHB addict': 1, 'GABA transporter deficiency': 1, 'GABA hypoactivity': 1, 'EFFECTS OF SODIUM GAMMA-HYDROXYBUTYRATE': 1, 'DERIVATIVES OF 4-DIMETHYLAMINO-3-HYDROXYBUTYRIC': 1, 'Itonic': 1, 'GABA-INDUCED': 1, 'GABA disorder': 1, 'GAT1 deficiency': 1, 'BETA-PENTAMETHYLENE-GAMMA-HYDROXYBUTYRIC ACID': 1, 'TONIC GABA INHIBITION': 1, 'GABA INHIBITION': 1, 'GABA-related hypersomnia': 1, 'g-hydroxybutyric aciduria': 1, 'BETA-HYDROXYBUTYRIC ACID': 1, 'CONTROL OF GABA RELEASE': 1, '4-HBA': 1, 'GABA Epilepsy': 1, 'GAMMA-HYDROXYBUTYRATE': 3, 'Hydroxybutyric aciduria': 1, 'GABA Deficiency': 1, 'BIOCOMPATIBILITY OF P4HB': 1, 'GHB symptom': 1, 'GABA neurotransmission': 1, 'GHB-related harms': 1, 'ALA': 1, 'succinate-semialdehyde dehydrogenase deficiency': 1, 'GABA-ergic hypofunction': 1, 'GABA-deficit': 1, 'SADGA': 1, 'GAOSU': 1, 'GABA receptor deficiency': 1, 'GABA-ergic impairment': 1, 'SSADH Deficiencya': 1, 'GABA interneuronopathy': 1, 'Succinic semialdehyde dehydrogenase (SSADH,': 1, 'semialdehyde dehydrogenase (SSADH) deficiency': 1, '-HYDROXYBUTYRATE': 1, 'GABA receptor dysfunction': 1, 'LEVELS OF 4-HYDROXYBUTYRATE': 1, '4-HYDROXYBUTYRATE': 1, 'HYDROXYBUTYRATE OF SODIUM': 1, 'Deficiency of succinic semialdehyde dehydrogenase': 1, 'gamma-Hydroxybutyric aciduria': 1, 'GHBuria': 1, 'GABA synaptopathy': 1, 'GHB congener': 1} | GHB |
Disease | MESH:C535805 | {'Stargardt-like macular dystrophy': 79, "Stargardt's disease-3": 1, 'Stargardt-like Macular Dystrophy': 7, 'STGD3': 82, 'Stargardt-like': 10, 'dominant Stargardt-like macular dystrophy': 6, 'Stargardt disease type 3': 5, 'Stargardt-like macular dystrophy (Type 3)': 1, 'Stargardt-like macular dystrophy type 3': 5, 'Autosomal Dominant Stargardt-like Macular Dystrophy': 1, 'Autosomal Stargardt-like Macular Dystrophy': 1, "Stargardt's-like macular dystrophy": 3, 'type 2 or type 3 MNV': 4, 'Autosomal dominant Stargardt-like macular dystrophy': 6, 'STGD Group 3': 1, 'Stargardt disease 3': 12, 'autosomal dominant Stargardt-like macular dystrophy': 6, 'type 2 and type 3 MNV': 4, 'STGD3 disease': 11, 'Stargardt-Like Macular Dystrophy': 1, 'Autosomal Stargardt-like macular dystrophy': 1, 'stargardt-like macular dystrophy': 3, 'STGD3-like': 1, 'STGD3-like macular dystrophy': 1, 'Stargardt disease-3': 7, 'Stargardt-like maculopathy': 2, "Stargardt's disease type 3": 2, 'Stargardt type 3': 2, 'Stargardt disease Type 3': 1, "macular dystroph*'6": 1, 'Stargardt-like dominant macular dystrophy': 2, 'Stargardt-like features': 1, 'STGD phenotype 3': 1, 'Stargardt-like juvenile macular dystrophy': 3, 'Stargardt disease-like macular dystrophy': 1, 'Stargardt-3': 5, 'Stargardt-3 dominant disease': 1, 'Stargardt-3 dominant inheritary disease': 1, 'Stargardt-like Maculopathy': 1, 'Stargardt-like (': 1, 'STGD3) maculopathy': 1, 'Dominant Stargardt macular dystrophy': 1, 'STGD3 macular dystrophy': 2, 'Stargardt disease-3 macular dystrophy': 2, 'Stargardt-like syndrome': 1, 'Stargardt-like macular dystrophies': 2, 'ADSTGD': 1, "Stargardt's disease 3": 2, 'autosomal dominant Stargardt-like macular dystrophy': 1, 'Stargardt 3': 2, 'Stargardt-like macular dystrophy-3': 1, 'Stargardt like': 1, 'Autosomal dominant Stargardt-like (STGD3) disease': 1, 'chorioretinal Stargardt-like atrophy': 1, 'stargardt-like dystrophy': 1, 'Stargardts-like macular dystrophy': 1, 'Stargardt-3 disease': 3, 'Stargardt-3 (STGD3) disease': 1, 'ADMD': 1, 'Stargardt-like (STGD4) macular dystrophy disease': 1, "Stargardt-like and bull's eye macular dystrophies": 1, 'Stargardt-like macular dystrophy type-3': 1, 'autosomal dominant Stargardt-like pattern dystrophy': 1, 'Stargardt and Stargardt-like macular dystrophies': 1, 'Stargardt-Like': 1, 'Stargardt-like flecked fundus': 1, 'Stargardt-like macular dystrophy 3': 1, 'Stargardt-like dystrophy': 1, 'autosomal dominant Stargardt-like disease': 1, 'Stargardt Disease 3': 3, 'Stargardt-like or': 1, 'AUTOSOMAL DOMINANT STARGARDT-LIKE MACULAR DYSTROPHY': 1, 'Stargardt type 3 (STGD3) disease': 1, 'ophthalmological Stargardt-like': 1, 'Stargardt-like dominant progressive macular dystrophy': 2, 'type 2 or type 3 macular neovascularization': 1, 'type 1, type 2, and type 3 MNV': 1, 'Autosomal Dominant Stargardt-like Macular Dystrophy-3': 1, 'MNV type 1, type 2, and type 3': 1, 'macular neovascularization (MNV) type 1, type 2, and type 3': 1, 'Stargardt-like dominant macular dystrophies': 1, 'type 3 or type 2 MNV': 1, 'Stargardt or autosomal dominant multifocal pattern dystrophy': 1, 'group 3 STGD': 1, 'Stargardt disease type-3': 1, 'STGD3-': 1, 'Autosomal dominant Stargardt disease-3': 1, 'Stargardt-like macular dystrophy 4': 1, 'STGD4': 1} | STGD3 |
Disease | MESH:C535807 | {'MBS': 124, 'Mobius syndrome 1': 1, 'MBS Impairment': 3, 'N-MBS': 1, 'Moebius syndrome 1': 1, 'Poland-Moebius syndrome 1': 1, 'MBS II': 1, 'MBS impairment': 2, 'MBS poisoning': 1, 'CTC-MBS': 1, 'MBS I/II': 1, 'PI-MBS': 1, 'CLASSIFICATION OF HUMAN MBS': 1, 'Hx-MBS': 1, 'PR-MBS': 1, 'Moebius Syndrome 1': 2, 'ACID-TRIGGERED ACTIVATION OF PH-MBS': 1, 'Moebius Syndrome MBS': 1, 'MBS metabolic syndrome': 1, 'CONSTRUCTION OF THE MBS-2 MICROSCOPE': 1, 'TARGETING MBS': 1, 'BO-MBS': 1} | MBS |
Disease | MESH:C535808 | {'MTS': 2357, 'DDP': 1279, 'MTS.Clinical': 1, 'MTS.Paramedic': 1, 'DFN': 76, 'Mohr-Tranebjaerg syndrome': 147, 'deafness-dystonia': 12, 'Deafness-dystonia': 3, 'X-linked (DFN) disorders': 1, 'deafness-dystonia-optic atrophy': 1, 'DFN-1': 10, 'deafness/dystonia syndrome': 3, 'MTS-1': 1, 'X-linked deafness-dystonia syndrome': 3, 'DDON) syndrome': 4, 'Deafness-dystonia-optic neuronopathy': 2, 'MTS-SL': 1, 'X-linked recessive deafness-dystonia-optic neuronopathy': 1, 'X-linked recessive deafness-dystonia-optic neuronopathy syndrome': 1, 'Deafness-dystonia-optic neuronopathy (DDON) syndrome': 2, 'DDON syndrome': 6, 'deafness-dystonia-optic neuropathy': 2, 'DDON': 11, 'Mohr-Tranebjaerg': 4, 'deafness dystonia syndrome': 21, 'Deafness/dystonia syndrome': 1, 'deafness-dystonia-optic neuropathy syndrome': 6, 'Mohr-Tranebjaerg Syndrome': 12, 'deafness-dystonia peptide': 3, 'NMTS': 1, 'Deafness-dystonia syndrome': 3, 'deafness-dystonia syndrome': 22, 'deafness dystonia protein': 2, 'deafness-dystonia-optic neuronopathy': 4, 'Dystonia-Deafness Syndrome': 3, 'MTS-I': 1, 'MTS-II': 1, 'node MTS': 1, 'Mohr-Tranebjaerg-Jensen': 1, 'Schiller DDP': 1, 'DDP ( 1)': 1, 'Deafness Dystonia': 1, 'Deafness-dystonia-optic neuronopathy syndrome': 2, 'Deafness-Dystonia-Optic Neuropathy syndromes': 1, 'MOE': 1, 'MTS - metastasis': 1, 'lung MTS': 6, 'dystonia optic neuronopathy': 1, 'deafness dystonia optic neuronopathy': 1, 'Deafness-Dystonia-Optic Neuronopathy Syndrome': 1, '-MTS': 3, 'MTS^': 1, 'apocrine MTS': 1, 'Eccrine MTS': 1, 'eccrine MTS': 1, 'XLA-MTS': 3, 'XLA-MTS syndrome': 2, 'X-linked deafness-dystonia-optic atrophy syndrome': 1, 'X-linked Mohr-Tranebjaerg syndrome': 3, 'Mohr Tranebjaerg syndrome': 1, 'optic neuronopathy': 4, 'XLA-Mohr-Tranebjaerg syndrome': 1, 'MTS - NPH': 1, 'ATL MTS': 1, 'Mohr-Tranebjaerg, and Opitz G/BBB syndromes': 1, 'NSCLC MTS': 1, 'peritoneal MTS': 1, 'LNF MTS': 1, 'LN-MTS': 1, 'B-MTS': 1, 'MTS-01': 1, 'DFN-3': 1, 'DDS': 5, 'MTS type 1a and 1b': 2, 'MTS types 1a and 1b': 2, 'MTS type 2': 2, 'MTS type 3': 2, 'Deafness-dystonia-optic neuronopathy 1': 1, 'deafness-dystonia-optic neuronopathy syndrome': 5, 'DDPIN': 1, 'RMTS': 1, 'deafness-dystonia (Mohr-Tranebjaerg) syndrome': 2, 'MTSET': 2, 'DFN fractures': 1, 'Mohr-tranebjaerg syndrome': 2, 'Dystonia Deafness': 1, 'X-linked recessive deafness-dystonia syndrome': 1, 'Dystonia-deafness syndrome': 4, 'DDP tumors': 1, 'DFN deafness': 1, 'pulmonary MTS': 1, 'deafness/dystonia protein1': 2, 'dystonia-deafness syndrome': 5, 'MTS-': 6, 'Deafness-Dystonia Syndrome': 3, 'MTS Gliosis': 2, 'Deafness-dystonia syndromes': 3, 'X-linked deafness-dystonia-optic neuronopathy': 1, 'deafness-dystonia optic neuronopathy': 1, 'LBP DDP': 1, 'DDP resistance': 1, 'CRC-MTS': 1, 'X-linked Dystonia-Deafness syndrome': 1, 'LN MTS': 2, 'deafness-dystonia-optic neuropathy (': 2, 'degeneration of auditory nerve Mohr-Tranebjaerg syndrome': 1, 'Dystonia and deafness': 1, 'X-linked (DFN': 2, 'deafness dystonia (Mohr-Tranebjaerg) syndrome': 2, 'Mohr-Tranebjaerg deafness-dystonia syndrome': 2, 'DDP-M': 1, 'X-linked disease deafness-dystonia syndrome': 1, 'MTS Metastasen': 1, 'MTS;2': 1, 'MTS-Ca': 1, 'MTS-Ca8': 1, 'MTS-N.': 1, 'Mohr- Tranebjaerg syndrome': 1, 'DFN-02': 1, 'MAS;2.MTS;3.SWV': 1, 'MTS type 1b': 2, 'MTS -': 1, 'lipomatous MTS': 1, 'deafness and dystonia syndrome': 1, 'neurodegenerative deafness and dystonia syndrome': 1, 'MTS metastasis': 3, 'Mitochondrial function Deafness-dystonia syndrome': 1, 'DDPs': 1, 'deafness-dystonia peptides': 1, 'Deafness-Dystonia-Optic Neuropathy (DDON) Syndrome': 1, 'MTS 12': 1, 'MTS HS': 1, 'MTS**N': 1, 'MTS metastatic': 1, 'Dystonia with deafness': 1, 'Deafness with dystonia': 1, 'Mohr-Tranebjaerg dystonia-deafness syndrome': 1, 'Dystonia-Deafness syndrome': 3, 'DDP&GEM': 1, 'TLE-MTS': 3, 'OMDQ MTS': 2, 'MTS-L': 1, 'OMDQ MTS-L': 1, 'MTS-2': 1, 'DDS syndrome': 1, 'Dystonia deafness syndrome': 1, 'Dystonia Deafness Syndrome': 1, 'Dystonia Deafness syndrome': 1, 'dystonia-deafness': 2, 'ID/DD31 Deafness-dystonia': 1, 'MTS-EH': 1, 'MTS-ET': 2, 'MTS-EA': 1, 'X-linked recessive mitochondrial deafness-dystonia syndrome': 1, 'X-linked deafness-dystonia-optic neuropathy syndrome': 1, 'dystonia deafness syndrome': 2, 'LLC-DDP': 1, 'DDP IV': 1, 'DDCH) syndrome': 1, "deafness, dystonia, and central hypomyelination'": 1, 'TPM-MTS': 1, 'neurodegenerative Deafness and Dystonia Syndrome': 1, 'DDP_ATCP_96': 1, 'DDP_ATCP_218': 1, 'DDP_ATCP_42': 1, 'DDP_ATCP_38/39': 1, 'genodermatosis MTS': 1, 'Dystonia-Deafness': 1, 'DYSTONIA DEAFNESS SYNDROME': 1, 'HA-DDP': 1, 'deafness dystonia': 2, 'Lymph node MTS': 1, 'lymph node MTS': 2, 'nodes MTS': 1, 'MTS) Metastatic': 1, 'd-MTS': 1, 'Lung MTS': 1, 'Optic Neuronopathy syndrome': 2, 'deafness/dystonia proteins': 1, 'DFN paralysis1': 1, 'deafness-dystonia syndromes': 2, 'MTS tumors': 1, 'Deafness Dystonia Syndrome': 2, 'Mohr-Tranebjaerg syndrome/': 1, 'MTS syndrome': 1, 'opticoacoustic nerve atrophy': 2, 'MTS IA': 1, 'DDP-IV': 1, 'MTS ligament': 1, 'Deafness-dystonia-optic neuropathy (DDON) syndrome': 1, 'deafness-dystonia optic neuropathy': 1, 'deafness-dystonia-optic atrophy (': 1, 'PMS': 1, 'deafness-dystonia-optic atrophy syndrome': 1, 'MTS 35': 1, 'iMTS-Ls': 1, 'Na-MTS': 1, 'Deafness-dystonia-optic neuronopathy (': 1, 'SyMTS': 1, '-DDP': 1, 'X-linked Mohr-Tranebjaerg (deafness-dystonia) syndrome': 1, 'MTS L': 1, 'deafness-dystonia-optic neuronopathy [DDON] syndrome': 1, 'DFNA': 1, 'DCM': 1, 'deafness-dystonia-optic neuron disease syndromes': 1, 'X-linked dystonia-deafness syndrome': 3, 'MTS V': 1, 'MTS-Stufe II': 1, 'MTS IV': 1, 'deafness dystonia peptide': 1, 'MTS/': 1, 'DDP-R': 2, 'DDP-H': 1, 'DDPL': 1, 'dystonia/deafness peptide like': 1, 'MTS-WTD': 1, '-Tranebjaerg': 1, 'DDON syndromes': 1, 'developmental malformations-deafness-dystonia syndrome': 1, 'Mitochondrial function deafness-dystonia': 1, 'Dystonia-deafness-optic neuronopathy syndrome': 1, 'MTS metastases': 1, 'X-linked DDS': 1, 'SALIVARY GLAND MTS': 1, 'AR Mohr-Tranebjaerg syndrome': 1, 'deafness-dystonia-opticn neuronopathy syndrome': 1, '- DDP': 1, 'MTS-7': 1, 'MTS from spearmint': 1, 'Childhood-Onset Dystonia and Optic Atrophy': 1, 'MTS melanoma metastasis': 1, 'Deafness-dystonia-optic neuronopathy syndrome disease': 1, 'ELSC-DDP': 1, 'Leigh syndrome Dystonia-deafness syndrome': 1, 'MTS type 2 or type 3': 1, 'MTS type 1a': 1, 'MTS CPS 2': 1, 'MTS CPS': 1, 'brain MTS': 1, 'DFN-19': 1, 'MTS 3': 1, 'MTS 5': 1, 'MTS 4': 1, 'deafness-dystonia-optic neuronopathy (DDON) syndrome': 1, 'liver MTS': 1, 'Deafness, dystonia': 1, 'deafness/dystonia peptide': 3, 'Deafness/Dystonia peptide': 1, '231/DDP': 1, 'Mohr-Tranebjaerg disease': 1, 'deafness Dystonia Mental retardation': 1, 'MTS-3': 1, 'MTS-4': 1, 'MTS H': 1, 'MTS I': 1, 'MTS HS Temporal lobe': 1, 'Siha-DDP': 1, 'MTS-Ch': 1, 'Mohr-Tranebjaerg/deafness-dystonia syndrome': 1, 'X-Linked Dystonia-deafness syndrome': 1, 'GC': 1, 'Mohr-Tranebjaerg syndrome 46': 1} | MTS |
Disease | MESH:C535809 | {'neurodevelopmental alterations': 356, 'ocular alterations': 142, 'altered mental state': 55, 'Altered mentality': 14, 'Neurodevelopmental alterations': 8, 'intellectual alterations': 6, 'Ocular alterations': 7, 'neuropsychiatric alterations': 156, 'AMS': 15, 'Altered Mental State': 12, 'neuropsychiatric alteration': 9, 'mentally altered': 15, 'mental alterations': 97, 'mental alteration': 67, 'neurodevelopmental alteration': 25, 'ocular surface alterations': 22, 'Mental state alterations': 2, 'Altered mental statusb': 3, 'Altered mental state': 29, 'Mental alteration': 9, 'Mental alterations': 8, 'SV': 1, 'neuropsychiatric behavioural alterations': 1, 'Altered mental statusGlasgow': 1, 'Altered mental statusD.': 1, 'Ocular vascular alterations': 1, 'cutaneous and ocular alterations': 1, 'altered mental': 7, 'altered mental states': 1, 'brain and neurodevelopmental alterations': 2, 'unilateral ocular alteration': 1, 'ocular and skeletal alterations': 1, 'auditory and ocular alterations': 2, 'altered ocular movement': 1, 'ocular alteration': 11, 'and neurodevelopmental alterations': 2, 'ocular and auditory alterations': 2, 'ocular surface alteration': 7, 'neurodevelop-mental alterations': 1, 'neurodevelopmental and eye problems': 1, 'Ocular globe alteration': 1, 'intellectual alteration': 1, 'Neurodevelopmental Alterations': 6, 'neurodevelopmental delayed alterations': 1, 'neurodevelopmental brain alterations': 2, 'postoperative altered mental state': 1, 'neuropsychiatric and neuropsychological alterations': 1, 'Altered ocular movements': 2, 'altered mental sensorium': 1, 'altered mentality': 19, 'altered ocular movements': 6, 'neurological and ocular alterations': 1, 'altered mental statusLess': 1, 'Altered mental statusa': 5, 'Altered mental attitude': 1, 'ocular and neurodevelopmental defects': 1, 'ocular movement alterations': 3, 'ocular and palpebral alterations': 1, 'activity alterations': 1, 'altered mental state syndromes': 1, 'ocular and hearing alterations': 1, 'Altered mental': 5, 'Altered Mental state': 2, 'Altered mental statusRespiratory': 1, 'intracranial non-ocular alterations': 1, 'ADA': 2, 'alteration/deficiency in activation': 1, 'altered emotional activity': 1, 'ocular vascular alterations': 2, 'mental and muscular alterations': 1, 'alterations in ocular movement': 1, 'Altered mental staus': 1, 'Altered mental statusCold': 1, 'ALTERATION OF ALLERGENIC ACTIVITY': 1, 'ALTERED ACTIVE': 1, ', ocular, and neurological alterations': 1, 'altered stature': 1, 'mental and physical developmental alterations': 1, 'ocular and cerebral alterations': 1, 'ocular and vertebral alterations': 1, 'ocular alterations in': 1, 'Altered oneiric activity': 1, 'pyramidal and ocular alterations': 1, 'Altered mental capacity': 1, 'ocular and/or auditory alterations': 1, 'Altered mental statusc': 2, 'ocular movements alterations': 1, 'neuropsychiatric and sexual alterations': 1, 'Ocular Surface Alterations': 1, 'Altered Mental': 1, 'alterations of intellectual functions': 2, 'Mollica-Pavone-Anterer syndrome': 1, 'mental or neurological alteration': 1, 'haematological or neuropsychiatric alterations': 1, 'Ocular Alterations': 1, 'cardiac, ocular and hearing alterations': 1, 'developmental retardation of eyes': 1, 'cerebellar and ocular alterations': 1, 'alteration of the external ocular movements': 1, 'mental and neurological alterations': 1, 'anterior ocular alteration': 1, 'neurological and mental alterations': 1, 'movement alteration or impairment': 1, 'febrile or mentally altered': 1, 'HISTOPATHOLOGIC STUDY OF OCULAR ALTERATIONS': 1, 'mental state alterations': 1, 'motor and neuropsychiatric alterations': 1, 'neurodevelopmental, mental, and ocular defects': 1, 'abnormal eye movements, and retardation': 1, 'Herelopia and ocular alterations by': 1, 'and neuropsychiatric alterations': 1, 'mental state alteration': 1, 'Altered mental statusn': 1, 'synaptic and neurodevelopmental alterations': 1, 'mental, ocular or myoskeletal anomalies': 1, 'MAT': 1, 'altered ocular aberrations': 1, 'neurodevelopmental alterations in the': 1, 'facial and ocular alterations': 1} | neurodevelopmental alterations |
Disease | MESH:C535810 | {'Primary choroidal atrophies': 2, 'choroidal atrophies': 9, 'age-related choroidal atrophy': 28, 'choroidal atrophy': 532, 'atrophy of the choroid': 53, 'Friend-Moloney-Rauscher-Graffi': 1, 'FMRGr': 1, 'tigroid and focal atrophy of choroid': 2, 'central regional total choroidal vascular atrophy': 1, 'Central regional total choroidal vascular atrophy': 2, 'Moloney-virus-induced murine leukemia': 1, 'FMR': 4, 'Friend-Moloney-Rauscher': 5, 'MoMLV': 14, 'Moloney sarcomas': 9, 'myopic choroidal atrophy': 6, 'Moloney-induced virus lymphoma': 1, 'atrophied choroid': 2, 'Moloney lymphomas': 3, 'congenital disorder of the macular region and choroid': 1, 'Moloney sarcoma tumours': 1, 'Moloney leukemia': 11, 'Myopic Choroidal Atrophy': 1, 'MDCA': 3, 'Diffuse choroidal atrophy': 2, 'Choroidal Atrophy': 6, 'diffuse choroidal atrophy': 11, 'choroid atrophy': 40, 'Moloney sarcoma': 27, 'choroidal vascular atrophy': 20, 'Choroid atrophy': 3, 'Choroidal atrophy': 28, 'MoMCF': 1, 'choroidal/choriocapillaris atrophy': 1, 'Degenerative choroidal atrophy': 1, 'Moloney leukemias': 1, 'Moloney lymphoma': 18, 'atrophy of choroidal capillaries': 3, 'Moloney': 13, 'atrophy of the choriocapillaris and choroid': 1, 'choroidal pigment atrophy': 1, 'Nummular Choroidal Atrophy': 1, 'retino-choroidal atrophy': 6, 'Moloney murine leukemia': 10, 'Moloney sarcoma cell': 1, 'MSC) tumors': 1, 'MSC': 1, 'PIM': 1, 'atrophy of choroidal tissue': 3, 'MOS deficiency': 1, 'moloney leukemia': 1, 'atrophy of the posterior choroid': 1, 'Moloney leukemia virus infection': 1, "Moloney's sarcoma": 3, 'Moloney sarcoma tumors': 1, 'Alopecia region 1': 1, 'Alopecia region': 1, 'MoMLV tumours': 1, 'Age-Related Choroidal Atrophy': 3, 'Age-related choroidal atrophy': 3, 'ARCA': 2, 'atrophy of choroidal vessels': 6, 'MoMLV INTEGRATION': 1, 'choroidal stromal atrophy': 1, 'M-MLV': 2, 'atrophy of the RPE-choroid': 1, 'parapapillary choroidal atrophy': 2, 'MLV': 2, 'Mo-MLV': 1, 'macular choroid atrophy': 1, 'choroidal vessel atrophy': 3, 'atrophy of choriocapillaris/choroid': 1, 'atrophy of the choroids': 2, 'atrophy around choroidal neovascularisation': 1, 'choroidal capillary atrophy': 5, 'atrophy in the choroid': 1, 'regional alopecia': 3, 'atrophy of choroid': 8, 'choroidal and choriocapillary atrophy': 1, 'Moloney viremia': 1, 'choroidal atrophy and dysplasia': 1, 'Moloney Leukemia Virus': 1, 'atrophy of choroidal': 1, 'atrophy of the choriocapillaris/stromal choroid': 1, 'mIN': 1, 'Nape region alopecia': 1, 'choroidal fundus and macular atrophy': 1, 'choroideal atrophy': 2, 'pigmented para-venous retino-choroidal atrophy': 2, 'pigmentepithelial choroidal atrophy': 1, 'CSDI': 1, 'total regional choroidal atrophy': 1, 'alopecia of the pubic and axillary regions': 1, 'Moloney sarcoma-leukemia': 1, 'MOV10 deficiency': 1, 'Juxtapapillary choroidal atrophy': 1, 'alopecia regions': 1, 'choroidal atrophy or dysplasia': 1, 'atrophy of choroidal stromal': 1, 'Moloney Murine Leukemia': 2, 'alopecia of the axillary and mammary region': 2, 'alopecia of the pubis region': 1, 'Moloney virus leukemia': 1, 'atrophy of the inner choroid': 1, 'bilateral central choroidal atrophy': 1, 'atrophy of RPE and choroid': 2, 'diffuse choroidal atrophies': 1, 'Moloney Virus (PIM': 1, 'atrophy of the choroidal vessels': 1, 'Tapetal and choroidal atrophy': 1, 'Pigmented para-venous retino-choroidal atrophy': 1, 'annular choroidal atrophy': 1, 'atrophy of inner choroidal and': 1, 'Moloney tumour': 1, 'enlargement of the choroidal, parapapillary atrophy': 1, 'alopecia of the pubic region': 1, 'Atrophy of the choroid': 1, 'Primary choroidal atrophy': 1, 'Moloney leukaemia': 4, 'Parapapillary diffuse choroidal atrophy': 2, 'MSV-tumour': 1, 'regional choroidal dystrophies': 1, 'Moloney MuLV Infections': 1, 'MSV tumor': 1, 'choroids atrophy': 1, 'Moloney Leukemia': 1, 'Macular diffuse choroidal atrophy': 1, 'Moloney-murine-leukaemia': 1, 'macular and choroidal atrophy': 1, 'alopecia of the central scalp region': 1, 'atrophy of the choroid and': 1, 'MST': 1, 'Moloney sarcoma tumor': 1, 'atrophy alopecia': 1, 'choroidal microvascular atrophy': 1, 'focal choroidal atrophy': 1, 'MOS insufficiency': 1, 'age related choroidal atrophy': 1, 'Moloney murine leukaemia': 2, 'foveal/choroidal atrophy': 2, 'atrophy of the choroid capillaries': 1, 'moloney sarcoma': 1, 'Moloney type C': 1, 'M-MuLv infection': 1, 'choroidal atrophy window defect': 1, 'atrophy of the choriocapillaris of the choroid': 1, 'choroidal vascular atrophies': 1, 'posterior choroidal atrophy': 1, 'atrophy of the choroid pigmentation': 1, 'Circumpapillary choroid atrophy': 1, 'regional choroidal dystrophy': 1, 'Parapapillary Diffuse Choroidal Atrophy': 1, 'PDCA': 1, 'Moloney MLV': 1} | choroidal atrophy |
Disease | MESH:C535811 | {'Moco': 13, 'CONCENTRATION OF MOLYBDENUM': 1, 'Moco-deficiency': 6, 'Mo': 14, 'Mo deficiency': 29, 'cofactor deficiency': 21, 'MoCo-deficient': 4, 'MoCo deficiency': 20, 'molybdenum cofactor deficiency': 225, 'MB': 2, 'molybdenum deficiency': 50, 'CT': 1, 'deficiency of aldehyde oxidase': 3, 'Molybdenum cofactor deficiency': 116, 'MOCOD': 5, 'deficiency of molybdenum': 6, 'MoCD': 46, 'Molybdenum cofactor Deficiency': 1, 'Moco deficiency': 51, 'MCD': 9, 'AO': 23, 'COPPER-MOLYBDENUM-SULFATE': 1, 'MOLYBDENUM': 11, 'selenium or cofactors deficiency': 1, 'Molybdenum-Cofactor Deficiency': 1, 'Metal Cofactor': 1, 'Cofactor deficiency': 6, 'cofactor deficiencies': 7, 'Molybdenum Cofactor Deficiency': 21, 'Cofactor A': 1, 'molybdenum cofactor deficiencies': 5, 'Molybdenum deficiency': 29, 'NRCs': 1, 'molybdenum cofactor': 6, 'Molybdenum cofactor': 5, 'MoCo': 3, 'MoCo cofactor deficiency': 1, 'Cofactor D Deficiency': 1, 'TBCD deficiency': 1, 'TBCD-deficient': 1, 'Moco-sulfurase deficiency': 1, 'lupus cofactor': 7, 'LC': 1, 'Lupus Cofactor': 1, 'MBC': 1, 'BH4 cofactor deficiency': 3, 'Mo deficits': 1, 'TMA': 20, 'ROLE OF COFACTORS': 1, 'cofactor-deficient': 1, 'MOCOS': 3, 'MoNDs': 1, 'FeMoco': 1, 'otros cofactores': 1, 'molybdenum factor deficiency': 1, 'Mo Deficiency': 2, 'MoSto': 1, 'HD': 1, 'Honey Dew TMA': 1, 'LF': 1, 'Low Friction TMA': 1, 'Molybdenum cofactor (MoCo) deficiency': 5, 'molybdenum-cofactor deficiency': 4, 'deficiency of the molybdenum cofactor': 1, 'molybdenum cofactor sulfurase deficiency': 2, 'aldehyde oxidase': 7, 'cobalamin cofactor deficiencies': 1, 'AAO': 10, 'enzyme disorder cofactor deficiency': 1, 'Molybdenum cofactor (': 2, 'NUCLEAR COFACTORS': 1, 'Vitamin and Cofactor Metabolism Disorders': 1, 'vitamin and cofactor metabolism disorders': 1, 'Mo-deficiency': 2, 'deficiencies of molybdenum': 1, 'maternal Moco deficiency': 1, 'SMCC': 2, 'Mo deficient': 1, 'Molybdenum Deficiency': 4, 'Molybdenum (Mo) deficiency': 1, 'TBCs': 2, 'ACS': 1, 'MCSU': 2, 'Lupus cofactor': 1, 'molybdenum co-factor deficiencies': 2, 'Mo- and V-nitrogenases': 1, 'dehydrogenase, oxidase or transferase deficiency': 1, 'dehydrogenase, transferase, and oxidase': 1, 'MoCoD': 7, 'MoCoD.': 3, 'molybdenum': 5, 'FROM COFACTORS TO POST-TRANSLATIONAL MODIFICATIONS': 1, 'MoCD sequelae': 1, 'MoCD-A': 4, 'MoCD-A.': 2, 'cofactor': 4, 'Cofactor': 6, 'MoCD disease': 2, 'Moco deficiency (': 1, 'Moco deficiency disease': 3, 'MoCD Disease': 1, 'MoCD) disease': 1, 'molybdenum toxicosis': 3, 'molybdenum cofactor (Moco) deficiency': 4, 'deficiency of the molybdenum': 1, 'AOX-': 1, 'CID': 1, 'MOCO deficiency': 3, 'tetrahydropterin-cofactor deficiency': 1, 'Molybdenum Cofactor Deficiencies': 1, 'DIETARY MOLYBDENUM': 1, 'intracellular cofactor deficiency': 1, 'Combined sulfite and xanthine oxidase deficiency': 1, 'cofactor (haem) deficiency': 1, 'MC': 1, 'Disorders of Cofactors and Vitamins': 1, 'deficiencies of vitamin cofactors': 2, 'Molybdenum': 7, 'Sulfite and xanthine oxidase deficiency': 1, 'molybdenum deficiencies': 2, 'abnormalities of cofactor metabolism': 1, 'Vitamin and cofactor deficiencies': 1, 'cofactor responsive': 1, 'Vitamin and Cofactor Responsive Disorders': 1, 'Ln-MBs': 1, 'Molybdenum cofactor (Moco)-deficiency': 1, 'CM': 1, 'Mo deficiencies': 2, 'EFFECT OF MOLYBDENUM SALTS': 1, 'Deficiency in molybdenum cofactor': 1, 'Cofactor-related metabolic disorders': 1, 'DIPYRROMETHANE COFACTOR': 1, 'ITS COFACTORS': 1, 'Molibdenum cofactor deficiency': 1, 'MoCD deficiency': 2, 'TcoFs': 1, 'Deficiency of molybdenum': 1, 'Cofactor disorders': 1, 'molybden cofactor deficiency': 1, 'MOLYBDENUM AUXILIARIES': 1, 'sulfite oxidase and xanthine dehydrogenase deficiencies': 1, 'aldehyde oxidase deficiencies': 1, 'molibdenum cofactor deficiency': 1, 'FMN': 1, 'TBC': 4, 'TBCE deficiency': 1, 'Molybdenum cofactor (Moco) deficiency': 3, 'Moco-deficient': 6, 'deficiency of xanthine oxidase and sulfite oxidase': 1, 'MoCo deficient': 1, 'Molybdenum cofactor deficiency disorders': 1, 'molybdenum cofactor (MoCo) deficiency': 2, 'deficiency in Mo': 1, 'COFACTOR-LIKE': 2, 'FLAVIN COFACTOR': 1, 'HEME REDOX COFACTORS': 1, 'RCo': 1, 'molybdenum co-factor deficiency': 8, 'enzymatic cofactor deficiency': 1, 'cofactors': 1, 'MOLYBDENUM DISULFIDE': 1, 'molybdenum cofactor (MOCO) deficiency': 1, 'Molydenum cofactor deficiency': 1, 'COFACTOR REQUIREMENTS': 1, 'SDMH': 1, 'MH': 1, 'MoDTC': 2, 'Disorders of vitamin and cofactor': 1, 'deficiency of sulphite, zanthine and aldehyde oxidase': 1, 'Molybdenum co-factor deficiency': 4, 'deficiency of molybdenum-dependent enzymes': 1, 'BH4 cofactor deficiencies': 1, 'MOLYBDENUM COFACTOR': 3, 'MOLYBDENUM-DEPENDENT DEHYDROXYLATION': 1, 'ENZYME COFACTORS': 1, 'BETWEEN REDUCED MOLYBDENUM': 1, 'MOLYBDENUM SITE': 1, 'MoDTC 1a-1c': 1, 'vitamin- and cofactor- deficiencies': 1, 'COFACTORS': 4, 'vitamin cofactor deficiencies': 1, 'vitamin and cofactor metabolism deficiencies': 1, 'Disorders of vitamin and cofactor metabolism': 1, 'aldehyde oxidase deficiency': 1, 'Moco- and SOD-deficiency': 1, 'vitamin cofactor deficiency': 1, 'Disorders of cofactor (vitamin) metabolism': 1, 'cofactors deficiency': 1, 'deficiency of cofactors': 1, 'deficiency of xanthine dehydrogenase and sulfite oxidase': 1, 'vitamin or cofactor deficiencies': 1, 'molybdopterin cofactor sulfurase deficiency': 1, 'deficiency of folate cofactors': 1, 'MMD': 1, '-Cofactors': 1, 'PCT': 1, 'Molybdenum co-factor deficiency': 1, 'vitamin, and cofactor disorders': 1, 'Moco deficiencies': 1, 'MOSTO': 1, 'MoP': 1, 'vitamin and cofactor deficiency': 1, 'MOCS1 deficiency': 1, 'deficiencies in aldehyde oxidase': 1, 'Moco Deficiency': 2, 'NMO': 1, 'deficiency of molybdenum cofactor': 2, 'MoCo-deficiency': 2, 'MS': 1, 'MN': 1, 'AO deficiency': 2, 'RiCoF': 1, 'cobalamin cofactor deficiency': 2, 'molybdenum cofactor complex deficiency': 2, 'Molybdenum cofactor (MoCF) deficiency': 1, 'DIVERSE COFACTORS': 1, 'Moco deficient': 2, 'MOLYBDENUM-TECHNETIUM': 1, 'deficiency of prothrombinase cofactor FV': 1, 'MOLYBDENUM BLUES': 1, 'LCF': 1, 'COFACTOR CANNIBALISM': 1, 'molybdenum cofactor-deficient': 3, 'MO': 1, 'EFFECT OF MOLYBDENUM': 2, 'TMA DKL': 1, 'Mo-MGD': 1, 'Deficiency in the molybdenum cofactor': 1, 'Cu and Mo deficiencies': 1, 'CSR-SALAD': 1, 'MOCO deficiencies': 1, 'Cofactor Deficiency': 1, 'MBD': 1, 'molybdenum cofactor deficiency.12': 1, 'Fe-GP': 1, 'AO-deficient': 1, 'vitamin and cofactor deficiencies': 1, 'GMoC': 1, 'Mo-deficient': 1, 'GMoC.': 1, 'Mo-co deficiency': 1, 'molybdenum co-factor (Moco) deficiency': 1, 'VITAMINS AND COFACTORS': 1, 'MOCODA': 2, 'molybdenum cofactor deficiency of complementation group A': 1, 'vitamin/cofactor deficiency': 1, 'ESSENTIAL COFACTOR': 1, 'molybdenum cofactor deficiency A': 1, 'MoC deficiency A': 1, 'MOLYBDENUM-DEPENDENT ENZYMES': 1, 'BETWEEN MOLYBDENUM': 1, 'Mo-toxicity': 1, 'MSNPs': 1, 'cofactor diseases': 1, 'deficiency of the adenosylcobalamin cofactor for MUT': 1, 'MOLYBDENUM CULTURE MEDIUM': 1, 'Cofactor deficiencies': 2, 'MoCoD-A': 1, 'MoCoD-A.': 1, 'Molybdenum cofactor deficiencies': 1, 'MoCoD of complementation group A': 1, 'MoBP': 2, 'deficiency of reduced cofactors': 1, 'CDWA': 1, 'Cofactor deficiency disorders': 1, 'Cofactor diseases': 1, 'MoCo deficiencies': 1, 'molybdenum cofactor (MoCo) deficiencies': 1, 'DiSCo': 1, 'MOCD': 2, 'MC deficiency': 1, 'Molybdenum cofactor (MC) deficiency': 1, 'molybdenum co-factor deficient': 1, 'Molybdenum co-factor deficiencies': 1, 'disorder of cofactor metabolism': 1, 'Cofactor defect': 1, 'Molybdenum deficiencies': 1, 'Arachnomelia MOCS1': 1, 'Impairs Cofactor': 1, 'vitamin/cofactor deficiencies': 1, 'enzyme and cofactor deficiencies': 1, 'CCM': 2, 'METABOLISM OF COFACTORS': 1, 'cofactor-responsive epilepsy': 1, 'CFs': 1, 'deficiency of sulfite and xanthine oxidase': 1, 'CELLULAR COFACTORS': 1, 'Vitamin/cofactor disorders': 1, 'Molybdenum-cofactor deficiency': 2, 'CMA': 1, 'Deficiency of molybdenum cofactor': 1, 'HMCS-CT': 1, 'MOLYBDENUM COFACTOR - MOCO': 1, 'molybdenum cofactor deficient': 2, 'D cofactor deficiency': 1, 'FATE OF MOLYBDENUM-99': 1, 'MOCOS deficiency': 1, 'combined MAO deficiency': 1, 'deficiency of molybdenum cofactor dependent enzymes': 1, 'AO or MOCOS deficiencies': 1, 'Cofactor deficit': 1, 'LSM': 1, 'MCV': 1, 'COFACTOR': 2, 'Inborn errors of molybdenum': 1, 'molybdenum deficiency,9': 1, 'MoCD A': 1, 'deficiency of both xanthine oxidase and sulfite oxidase': 1, 'hereditary Moco deficiency': 1, 'Brain-Derived Cofactor': 1, 'VMS': 1, 'AO deficient': 1, 'Cofactor-Related Disorders': 1, 'cofactor-related disorders': 1, 'FeMo-co.': 1, 'Disorders of vitamins, cofactors': 1, 'disorders of molybdenum metabolism': 1, 'COF': 1, 'PRC': 1, '-cofactor-oxidase': 1, 'MoCD NS': 1, 'SUBSTRATE-COFACTOR RATIOS': 1, 'deficiency of molybdenum cofactor sulfurase': 1, 'molybdenum cofactor dependent enzymes': 1, 'TBCEL deficiency': 1, 'AOR': 1, 'vitamin/cofactor/trace element metabolism disorders': 1, 'MOLYBDENUM AS ANTICARIES ELEMENT': 1, 'ANTIBODY COFACTOR': 1, 'Cofactors deficiency': 1, 'molybdenum cofactor deficiency (': 1, 'Molybdenum sufficiency': 1} | molybdenum cofactor deficiency |
Disease | MESH:C535812 | {'macrocrania': 280, 'Macrocrania': 40, 'MOMO syndrome': 18, 'MOMO': 7, 'Benign macrocrania': 1, 'essential macrocrania': 1, 'Macrosomia, obesity, macrocephaly and ocular abnormalities (MOMO) syndrome': 1, 'Benign Macrocrania': 1, 'benign macrocrania of infancy': 1, 'macrocephaly and ocular abnormalities syndrome': 1, 'benign macrocrania': 2, 'BMC': 1, 'MOMO) syndrome': 1, 'MOMO Syndrome': 2, 'Acronym MOMO syndrome': 1, 'MACROCRANIA': 1, 'Nonhydrocephalic macrocranias': 1, 'Macrocephaly, macrosomia, facial dysmorphism (MMFD) syndrome': 1, 'MMFD syndrome': 1} | macrocrania |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.